Loop-vermittelte isothermen Amplifikation (LAMP) Assays für die artspezifischen Nachweis von

Immunology and Infection
 

Cite this Article

Copy Citation | Download Citations

Barkway, C. P., Pocock, R. L., Vrba, V., Blake, D. P. Loop-mediated Isothermal Amplification (LAMP) Assays for the Species-specific Detection of Eimeria that Infect Chickens. J. Vis. Exp. (96), e52552, doi:10.3791/52552 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

Globale Hühnerproduktion Zehnfache über den letzten 50 Jahren mit den Entwicklungsländern Hosting fast viermal die Expansion in den Industrieländern erlebt erhöht (www.faostat.org) . Da die Bedeutung der Hühnerproduktion zur Welternährungssicherheit hat sich so hat auch das Profil von Erregern, die schwere Krankheit bei Hühnern verursachen können. Ein gutes Beispiel sind die Eimeria-Arten, allgegenwärtigen einzellige Parasiten, die die Darmerkrankung Kokzidiose 1 führen können. Wo immer Hühnern gezüchtet werden ein oder mehrere Eimeria-Spezies wahrscheinlich gemeinsame 2-4 sein. In der entwickelten Welt Eimeria werden vor allem von Chemoprophylaxe kontrolliert und beschäftigt Shuttle oder Rotationsprogramme, die Auswirkungen der Widerstand 5 zu minimieren. Lebendimpfstoffe sind auch in Systemen, in denen Vogel Wert ist ausreichend, um die Kosten zu rechtfertigen (zB, Zuchttiere, Schichten und einige Broilern 5). Als result dieser Maßnahmen klinischen Kokzidiose wird oft gut kontrolliert, auch wenn subklinische Infektion ist häufig 5. In den Entwicklungsländern die Impfung ist selten und Drug Application häufig weniger gut informiert. Als Folge subklinischen und klinischen Kokzidiose ist häufiger und übt eine erhebliche wirtschaftliche Auswirkungen 3.

Diagnose von Eimeria-Infektion traditionell auf Läsion Scoring post-mortem, obwohl auch die Autoren der am häufigsten verwendeten Bewertungssystem kommentierte, dass für einige Arten "es erscheint zweifelhaft, ob eine solche Regelung sollte in jedem, aber mittelschweren Infektionen versucht werden" 6. Ergänzende Hinweise können durch mikroskopische Nachweis des umweltbeständig Oozyste Lebenszyklusphase in Fäkalien oder Wurf Proben gesammelt werden, auch wenn sich überlappenden Morphologie können alle, aber die Experten 6,7 verwechseln. Molekulare Alternativen mittels Polymerase-Kettenreaktion (PCR), Zufalls amplification polymorpher DNA PCR (RAPD-PCR) und die quantitative PCR-Technologien wurden für bis zu 20 Jahre 8-10 zur Verfügung, aber sie bislang gescheitert populär geworden. Relative Kosten und der Bedarf an Fachlaborgeräte oder Verarbeitung ihre Aufnahme beschränkt, trotz der oft subjektiv und technisch anspruchsvolle Art des älteren pathology- und Mikroskopie-basierte Ansätze 10,11. Eine solche Beschränkung kann in vielen der ärmeren Regionen der Welt, wie Südostasien, wo die Auswirkungen der Kokzidiose auf die Armut kann proportional größer 12 sein übertrieben werden. Als Antwort gibt es einen klaren Bedarf an neuen unkompliziert und empfindlich, aber kostengünstiger, Eimeria-Spezies-spezifische diagnostische Tests.

Loop-vermittelte isothermische Amplifikation (LAMP) ist ein leicht zu DNA-Polymerase-angetriebene Technik, die zur Amplifikation großer Mengen an DNA herzustellen. Am wichtigsten ist, verwendet LAMP eine Bst DNA polymerase anstelle der Taq-DNA-Polymerase die üblicherweise in PCR verwendet werden, die DNA-Amplifizierung bei einer einzigen konstanten Temperatur ermöglicht, ohne das Erfordernis der thermischen Zyklen 13,14. Leuchte kann selbst in den rudimentären Labor oder im Feld zugänglich Anwendung sein. Durch eine relative Beständigkeit gegenüber vielen PCR-Inhibitoren, hohe Empfindlichkeit und Spezifität Charakterisiert wurden LAMP-Assays für ein breites Spektrum von Krankheitserregern einschließlich Virus der infektiösen Bursitis, Clostridium perfringens und Cryptosporidium 15-17 entwickelt. In Reaktion auf neue kosteneffektive Eimeriaspezies spezifische Diagnose ein Panel von spezifisch jede der sieben Eimeria-Spezies, die Hühner infizieren LAMP-Assays entwickelt worden, 18 verlangen. Anwendungen für die neuen Tests umfassen die Überwachung Parasiten Auftreten, von besonderem Wert, da die Zuordnung der Arten wie Eimeria maxima oder Eimeria necatrix mit schlechten wirtschaftlichen performance 3,4. Weitere Anwendungen sind die Beurteilung der Wirksamkeit von Antikokzidium Strategie eines Bauernhof, Diagnose subklinische Infektion oder klinischen Erkrankung und Bewertung von Risiken durch Eimeria zu einem Bauernhof gestellt.

Protocol

1. Vorlage Vorbereitung

Hinweis: alle genomischen DNA-Matrize mit Verdacht auf einen der sieben Eimeria-Spezies, die Hühner infizieren abgeleitete DNA enthalten, können als Matrize für LAMP-basierten Eimeriaspezies Identifizierung verwendet werden. Darmgewebeproben für Feld diagnostische Analyse sollten bei der routinemäßigen post-mortem wie hier beschrieben gesammelt werden.

  1. Wählen Sie den Abschnitt (oder Abschnitte) des Darms zu prüfen. Siehe Tabelle 1 für einen Führer zu Probe Standortwahl und die Eimeria-Spezies am wahrscheinlichsten 18 und 1 für die Spezies-spezifische Bereich der Verteilung und Lage der Probenahmestellen zu sein.
    Hinweis: Dies ist von zentraler Bedeutung, da Eimeria sind insbesondere Host-Site-spezifisch. Jede Art, die Hühner infiziert wird durch die Darmbereich, die es zielt auf 19 festgelegt. Die Entscheidung kann durch die bisherigen Erfahrungen der Farm, Interesse an einem oder mo beeinflusst werdenre spezifische Eimeria-Arten oder andere Diagnose-Anzeigen 6.
  2. Verbrauch 5 cm oder mehr Längen der Darmabschnitt (en), ausgewählt für Eimeria mit sterilen Schere oder einem Skalpell zu testen. Optional, lagern die Proben für eine anschließende Analyse in einem Fixiermittel, wie beispielsweise in RNAlater 18 oder 95% Ethanol.
    HINWEIS: Wenn die Speicherung in Ethanol die Probe sollte in sterilem, Tris-Ethylendiamintetraessigsäure gewaschen werden (TE) Puffer vor der Verwendung.
  3. Schneiden Sie die Probe in Längsrichtung offen, die meisten Darminhalt zu entfernen (falls vorhanden) und kratzen Zellen von der Schleimschicht frei entweder mit dem Rand eines sterilen Glasobjektträger oder eine Ethanol / Flamme sterilisiert Scherenblatt. Wahlweise für eine Sammelprobe sind Zellen, die aus allen vier der artspezifischen Darm-Websites in einer einzigen Röhre.
  4. Legen Sie die Abstreifgut in ein steriles 1,5 ml Schraubverschluss-Mikroröhrchen mit 100 ul sterilem TE-Puffer mit 1(W / v) Chelex 100-Harz 0%.
  5. Schütteln Sie jede Probe 1 min kräftig. Stellen Sie sicher, dass der Schraubdeckel sorgfältig verschlossen und dann in einem kochenden Wasserbad inkubiert für 10 min.
  6. Nach Kochen ermöglichen jede Probe bei Umgebungstemperatur für 1-2 min abkühlen.
  7. Zentrifuge jede Probe unter Verwendung einer Mikrozentrifuge bei Höchstgeschwindigkeit (zB ~ 10.000 × g) für 1 min.
  8. Sammel 2 ul des erhaltenen Überstands werden Vorlage in jeder Lampe Assay durchgeführt werden. Optional bündeln mehrere Darmstelle in einem einzigen Rohr, einen Multi-Site-Assay bereitzustellen.

2. Eimeria LAMP Primer Vorbereitung (Pre-Test)

  1. Bereiten Eimeria LAMP Primer Aktien ausreichend für 100 Tests:
    1. Den Inhalt jeder lyophilisierten Eimeria LAMP Primer durch Zugabe von Wasser molekularen Grad bis zu einer Konzentration von 100 uM (nach Angaben des Herstellers). Wenn nicht angegeben, berechnet das Volumen der molekularen reines Wasser erforderlich using die physikalischen und Molekulargewichte von jedem Primer.
    2. Pipette 60 ul molekular reines Wasser in einem separaten 0,5 ml Flip-Top-Mikrozentrifugenröhrchen für jede Eimeria-Arten, die untersucht werden.
    3. Hinzufügen Primer FIP, BIP, F3, B3, LF und LB für die Ziel Eimeriaspezies zum Wasser unter Verwendung der in Tabelle 2 gezeigten Mengen, wodurch eine Reihe von sieben artspezifischen Primer Mischungen.
    4. Vortexen mischen die Primerlösung, dann Impulsmikrozentrifuge und einfrieren, bis sie benötigt.
  2. Bereiten Sie eine LAMP Reaktion Mastermix für jeweils Eimeria-Arten, die untersucht werden. Multiplizieren Sie die in Tabelle 3 gezeigten Mengen mit der Anzahl der Proben und fügen Sie drei bis Positivkontrolle Negativkontrolle und Pipettieren Ersatz. Pipette in ein 0,5 oder 1,5 ml Flip-Top-Mikrozentrifugenröhrchen.

3. Eimeria LAMP Assay

  1. Pipette 23 ul Eimeria artspezifischen Bst DNA-Polymerase / LAMP Mastermix in einen 0.5 ml Mikrozentrifugenröhrchen.
  2. Add 2 ul DNA-Template (in Abschnitt 1 hergestellt), eine endgültige Reaktionsvolumen von 25 ul.
  3. Add 2 ul Eimeria artspezifischen genomische DNA zu einem Reaktions (positive Kontrolle). Add 2 ul Wasser molekularen Grad an Reaktion (Negativkontrolle).
    HINWEIS: Wenn artspezifischen genomischer DNA ist nicht verfügbar, eine frühere positive LAMP oder Standard-PCR-Produkt können stattdessen verwendet werden.
  4. Inkubieren in einem Wasserbad oder Heizblock bei 62 ° C für 30 min. Optional de-aktivieren Bst DNA-Polymerase durch Erhitzen auf 80 ° C für 10 Minuten, wenn die Reaktion nicht sofort gelesen werden.

4. LAMP Assay Auslese

  1. Am Ende der Inkubation beurteilen die Farbe jedes Reaktion durch Auge unter Raumbeleuchtung. Negative Ergebnisse erscheinen in der Farbe rosa bis violett erscheinen positive Ergebnisse Himmelblau 20.
  2. Wahlweise bestätigen die LAMP Untersuchungsergebnis in einer laboratory, indem 5 ul LAMP-Reaktionsprodukt mit 1 ul DNA-Gelbeladungspuffer für Agarose-Gelelektrophorese unter Verwendung eines 2% igen Agarosegel in 1 x Tris / Borat / EDTA (TBE) -Puffer: vorgefärbter Verwendung eines Nukleinsäurefarbstoff (5 ul pro 50 ml Agarose). In 5 ul einer 1 Kb Molekülgröße DNA-Leiter in Spur 1 des Gels auf Fragmentgröße Berechnung ermöglichen.

Representative Results

Assay-Validierung

Während der Überprüfung wurde jede Eimeria artspezifischen LAMP-Test unter Verwendung einer Reihe von reinen DNA-Proben, die alle sieben Eimeria-Arten, die den Hühner sowie Huhn genomischer DNA als Hoststeuer infizieren getestet. Agarose-Gelelektrophorese wurde verwendet, um jeden Test zu lösen und zeigte absolute Artspezifität ohne Host Kreuzreaktivität 18. Als nächstes erstellt eine zehnfache Verdünnungsreihe mit gereinigtem Eimeria tenella genomischen DNA ergab ein Assay Empfindlichkeitsgrenze zwischen einem und zehn Genomkopien 18. Keine Obergrenze wurde mit bis zu positive Ergebnisse erzielt und mit der höchsten Konzentration (100.000 Genomkopien) 18 bestimmt.

Anwendung mit Feldproben

Die Proben für die Untersuchung gewonnen Eimeria dürften von Hühner tot abgeleitet werden, als Folge der p gekeultoor Gesundheit oder für Sentinel Gesundheitsüberwachung gekeult, was auf eine eher Probengröße von zwischen einem und drei als Teil einer Routine. Testen drei Vögel von einem US-Hähnchenmastanlage im Rahmen eines Überwachungsprogramms gesammelt ergab drei Sätze von Darmproben. Gezielte Anwendung der artspezifischen LAMP Assays Priorisieren der bevorzugten Darmstellen für jede Eimeria-Spezies (Tabelle 1), erlaubt eine visuelle Identifizierung von Eimeria-Infektion bei allen Tieren getestet, indem hydroxynaphthol Blau als Indikator (Figur 2A). Die mit einem negativen LAMP Reaktion bei Verwendung hydroxynaphthol blau erzielt Farbe von Violett bis hin zu rosa, aber ist immer verschieden von der durch ein positives Ergebnis erzielt blau. Bestätigung durch Agarosegelelektrophorese liefert vergleichbare Ergebnisse (2B). Während der Feldanwendung kann der Benutzer wählen, um den Vollbildmodus gegen alle sieben Arten gelten, oder das Ziel nur die Spezies als priorisiertwichtig oder bekannt ist, dass auf dem Hof ​​zirkulierenden oder die Umgebung.

Das Versagen des PCR-basierte Ansätze als Diagnostika etablieren für das Auftreten von Eimeria unterstreicht das Erfordernis der Einfachheit in jedem neuen Test. Während LAMP bietet einfachere Zubereitung und Verarbeitung als PCR, bleibt die Forderung, mehrere Darmstellen pro Vogel testen entmutigend. Herstellung einer einzigen gepoolten DNA-Probe pro Vogel, die dann mit einem oder mehreren LAMP Assays getestet werden können, ist wahrscheinlich attraktiver. Das gleiche Ergebnis wie bei jeder Darm Website wurde getrennt verarbeitet werden (Abbildung 2 Verarbeitung einer Sammelprobe pro Tier, was von jedem der spezifischen Darm Standorten in Tabelle 1 mit allen sieben LAMP-Assays beschrieben und gebündelt vor DNA-Präparation, für die Prüfung gesammelten Materials vorausgesetzt verglichen mit Figur 3).

Figur 1 Abbildung 1. Darmprobenahmestellen für LAMP Erfassung von Eimeria Parasiten, die Hühner infizieren. Wird die Darmabschnitten von je Eimeria-Arten gezielt durch die farbigen Linien markiert ist, mit den bevorzugten Standorten der Probenahme durch die Anzahl zwischen den gestrichelten schwarzen Linien angezeigt (E. acervulina: gelb / 1, E. Brunetti: pink / 2, E. maxima: blau / 3, E. mitis: orange / 4, E. necatrix: rot / 5, E. praecox: grün / 6 und E. tenella: grau / 7). Bitte klicken Sie hier, um eine größere Version dieses Bild anzuzeigen.

Abbildung 2
Abbildung 2. LAMP Diagnose von Eimeria-Infektion herm drei kommerziellen Masthähnchen. LAMP Reaktionen gelöst mit (A) hydroxynaphthol blau, wo ein himmelblau-Reaktion war positiv und eine violette bis rosa Reaktion war negativ, und (B) Agarose-Gelelektrophorese. Die Darm Sites abgetastet wurden, wie in Tabelle 1 für jede Parasitenarten dargestellt. A = E. acervulina, B = E. brunetti, Ma = E. Maxima, Mi = E. mitis, N = E. necatrix, P = E. praecox und T = E. tenella. Spur 1 enthielt die GeneRuler 1 Kb DNA-Leiter. Bitte klicken Sie hier, um eine größere Version dieses Bild anzuzeigen.

Figur 3
Abbildung 3. LAMP Diagnose einer Eimeria-Infektion unter Verwendung von drei verschiedenen kommerziellen Masthähnchen Sammelproben. LAMP reacgen gelöst mit hydroxynaphthol blau, wo ein himmelblau-Reaktion war positiv und violett bis rosa Reaktion war negativ. A = E. acervulina, B = E. brunetti, Ma = E. Maxima, Mi = E. mitis, N = E. necatrix, P = E. praecox und T = E. tenella. Bitte klicken Sie hier, um eine größere Version dieses Bild anzuzeigen.

Beispielseite Eimeriaspezies Assay (wahrscheinlich)
Duodenum (D) E. acervulina, E. praecox
Jejunum / Ileum * (J / I) E. maxima, E. necatrix
Caeca (C) E. necatrix, E. tenella
Terminalen Ileum (TI) E. Brunetti, E. mitis Sammelprobe (P) E. acervulina, E. Brunetti, E. maxima, E. mitis, E. necatrix, E. praecox E. tenella

Tabelle 1 Intestinal regionsspezifische Auswahl von Kandidaten Eimeriaspezies Assays. Die Wahl der Region abgetastet variiert für jede Eimeria-Spezies, wie in Abbildung 1 veranschaulicht. Gepoolten Proben beinhalten aus allen vier spezifischen Stellen, die dann für die DNA-Präparat kombiniert wurden gesammelt Materials.

Primer * Lizenz Konzentration (uM) Volumen (ul)
Wasser - 60
Vorwärtsprimer (FIP) 100 40
Rückwärts Inner Primer (BIP) 100 40
Zukunfts Outer Primer (F3) 100 10
Rückwärts Outer Primer (B3) 100 10
Loop-Forward (LF) 100 20
Loop Backward (LB) 100 20
Gesamt 200

Tabelle 2. Herstellung eines LAMP Primer Vormischung. Die Komponenten und Proportionen erforderlich, um eine Primer-Vormischung zur LAMP vorzubereiten. Volumes gezeigt werden, sind 100 LAMP Reaktionen. * Primer Identitäten wie in den Materialien und gezeigt Barkway et al (2011) 18.

Auf konz n Schlussreaktion konz n Volumen pro Reaktion (ul)
DDW - - 10.1
THERMOPOL Puffer 10 x 1 x 2.5
MgSO 4 100 mM 2 mM 0,5
Primer Mix * Tabelle 2 2.5
dNTPs 25 mM 400 uM 0.4
Betain 5 M 1 M 5
Hydroxynaphthol blau 3 mM 120 & mgr; M 1
Bst DNA-Polymerase 8.000 U / ml 8 U 1
Gesamt 23

Tabelle 3. Herstellung einer LAMP Reaktion Mastermix. * Eimeria artspezifisch.

Materials

Name Company Catalog Number Comments
RNAlater Ambion AM7024
Ethanol VWR Chemicals 20821.321 Caution, highly flammable
100 x Tris-EDTA (TE) buffer concentrate Sigma-Aldrich T9285
Chelex 100 resin Bio-Rad 142-1253
Molecular grade water Invitrogen 10977035
E. acervulina F3 Sigma-Aldrich VC00021 *CCTAACATTTCGCTTCACGGAC
E. acervulina B3 Sigma-Aldrich VC00021 *ATGAGCAAGTGGAACACCTTG
E. acervulina FIP Sigma-Aldrich VC00021 *AGAGCACAGTGGCAGTGC-AGCAGACAGCATGGCTTACCT
E. acervulina BIP Sigma-Aldrich VC00021 *GAAGACCCTCTGAAGAACGGA-CCTTCTCACCGCTTACCGG
E. acervulina LB Sigma-Aldrich VC00021 *TAAGGTTACACCCGTGGAGG
E. acervulina LF Sigma-Aldrich VC00021 *GCCATGCACAAAGCGACTT
E. brunetti F3 Sigma-Aldrich VC00021 *GGCCATCAAGTTCCATGAGC
E. brunetti B3 Sigma-Aldrich VC00021 *TCAACCTCCTGAGTGTGGTT
E. brunetti FIP Sigma-Aldrich VC00021 *GAAAATGCCTTCGTAGCTGCT-GCTGGGTACGGAGCGTCTT
E. brunetti BIP Sigma-Aldrich VC00021 *TACTTCCTAGGATCCATCCTCGC-AGTTTCGCTGCCGCCTC
E. brunetti LB Sigma-Aldrich VC00021 *GAAACGCTCGAACATGGC
E. brunetti LF Sigma-Aldrich VC00021 *CTTCTCCACAGACCCAGAGGT
E. maxima F3 Sigma-Aldrich VC00021 *ACTACGGAAAAGTGCGTAGCT
E. maxima B3 Sigma-Aldrich VC00021 *CCTTCCTCCCTTCTGAAAACTG
E. maxima FIP Sigma-Aldrich VC00021 *GAGTCACTGCTGATGTACCAAA
AG-GAACTATGCCGCTTTCCCCTG
E. maxima BIP Sigma-Aldrich VC00021 *AGAATGCGGATTTGTTAGCAGC-AGCAAGTCCAAGGTGTGTGTA
E. maxima LB Sigma-Aldrich VC00021 *CAAGCCTACGCGGACATC
E. maxima LF Sigma-Aldrich VC00021 *TTATGCAGCTGGGTCAACG
E. mitis F3 Sigma-Aldrich VC00021 *ACGATAGCCAAGACACGTAAGG
E. mitis B3 Sigma-Aldrich VC00021 *CCCCGTGATAAGAGTAGGAACA
E. mitis FIP Sigma-Aldrich VC00021 *CGCGGGTCGTGAGATTTAAATT
AT-GGAAGATCAGGACGGGCACT
E. mitis BIP Sigma-Aldrich VC00021 *GTTTCAGTTGATGAACAAGCGA
GA-TGCGCCTCTAGAATCAAGACG
E. mitis LB Sigma-Aldrich VC00021 *TCCATGCATCCCCTTGTT
E. mitis LF Sigma-Aldrich VC00021 *CGTGGGCACAGATTGATTC
E. necatrix F3 Sigma-Aldrich VC00021 *TGGCTTTCCCGCGTACC
E. necatrix B3 Sigma-Aldrich VC00021 *CGGCCCAACACAAAGACTG
E. necatrix FIP Sigma-Aldrich VC00021 *CGCTTGAGTTTTAAGCTATGCA
CA-GACCCAAGCAGCTCACCAA
E. necatrix BIP Sigma-Aldrich VC00021 *CGCCATGCCATTCAATGAACG-*GAGGCATACCGGCGTTGTC
E. necatrix LB Sigma-Aldrich VC00021 *GTCTGTAACTTGGGACGTTGT
E. necatrix LF Sigma-Aldrich VC00021 *GAACAGCCGGAGCCTCTC
E. praecox F3 Sigma-Aldrich VC00021 *GCCCTTGTATGTTGCTGTTTCT
E. praecox B3 Sigma-Aldrich VC00021 *GCGCACGAATCTGAATCACAC
E. praecox FIP Sigma-Aldrich VC00021 *ATCTCCTCAAAGACTTTCGCGT
A-GCGCTTGGCTATATCCATAGG
E. praecox BIP Sigma-Aldrich VC00021 *GCTCTCGTGGCATACTTGC-GCCAGGAGCCACTGATTGT
E. praecox LB Sigma-Aldrich VC00021 *GAATAGCATTGCCAGGTGG
E. praecox LF Sigma-Aldrich VC00021 *GTCCACTGTCATTAATATTGC
TGC
E. tenella F3 Sigma-Aldrich VC00021 *GCTTGTGAAGGTCAGCGTG
E. tenella B3 Sigma-Aldrich VC00021 *GCTGAGTCCATACGTACTTCCT
E. tenella FIP Sigma-Aldrich VC00021 *GCCACTGCTATGGAAAGTCAC
AC-CATAACTGGCATGCAGGGGT
E. tenella BIP Sigma-Aldrich VC00021 *GTTTGGCCCGAAAGTTGTGAA
GA-CGTCAGAAATTGCTGCCCAAT
E. tenella LB Sigma-Aldrich VC00021 *CGCATGTGCAGTTGAAGACA
E. tenella LF Sigma-Aldrich VC00021 *CCAAATGTATCTGCTAGTTATA
TTAACAAG
10 x ThermoPol reaction buffer New England Biolabs B9004S
MgSO4 Sigma-Aldrich M7506
dNTPs Promega U1330
Betaine solution (5 M) Sigma-Aldrich B0300
Bst polymerase New England Biolabs M0275S
Hydroxynaphthol blue Sigma-Aldrich 33936 Dissolved in molecular grade water.
UltraPure agarose Invitrogen 16500-500
10 x Tris/Borate/EDTA (TBE) buffer Invitrogen AM9863
Blue/Orange DNA loading dye (x6) Promega G1881
GeneRuler 1Kb DNA ladder Thermo Scientific SM0313
SafeView nucleic acid stain NBS Biologicals NBS-SV

DOWNLOAD MATERIALS LIST

References

  1. Chapman, H. D., et al. A selective review of advances in coccidiosis research. Adv Parasitol. 83, 93-171 (2013).
  2. Shirley, M. W., Smith, A. L., Tomley, F. M. The biology of avian Eimeria with an emphasis on their control by vaccination. Adv Parasitol. 60, 285-330 (2005).
  3. Fornace, K. M., et al. Occurrence of Eimeria species parasites on small-scale commercial chicken farms in Africa and indication of economic profitability. PLoS ONE. 8, (12), e84254 (2013).
  4. Schwarz, R. S., Jenkins, M. C., Klopp, S., Miska, K. B. Genomic analysis of Eimeria spp. populations in relation to performance levels of broiler chicken farms in Arkansas and North Carolina. J Parasitol. 95, (4), 871-880 (2009).
  5. Peek, H. W., Landman, W. J. Coccidiosis in poultry: anticoccidial products, vaccines and other prevention strategies. Vet Q. 31, (3), 143-161 (2011).
  6. Johnson, J., Reid, W. M. Anticoccidial drugs: lesion scoring techniques in battery and floor-pen experiments with chickens. Exp Parasitol. 28, (1), 30-36 (1970).
  7. Haug, A., Gjevre, A. G., Skjerve, E., Kaldhusdal, M. A survey of the economic impact of subclinical Eimeria infections in broiler chickens in Norway. Avian Pathol. 37, (3), 333-341 (2008).
  8. Procunier, J., Fernando, M., Barta, J. Species and strain differentiation of Eimeria spp. of the domestic fowl using DNA polymorphisms amplified by arbitrary primers. Parasitology Research. 79, (2), 98-102 (1993).
  9. Schnitzler, B. E., Thebo, P. L., Mattsson, J. G., Tomley, F. M., Shirley, M. W. Development of a diagnostic PCR assay for the detection and discrimination of four pathogenic Eimeria species of the chicken. Avian Pathol. 27, (5), 490-497 (1998).
  10. Vrba, V., Blake, D. P., Poplstein, M. Quantitative real-time PCR assays for detection and quantification of all seven Eimeria species that infect the chicken. Vet Parasitol. 174, (3-4), 183-190 (2010).
  11. Morris, G. M., Gasser, R. B. Biotechnological advances in the diagnosis of avian coccidiosis and the analysis of genetic variation in Eimeria. Biotechnol Adv. 24, (6), 590-603 (2006).
  12. Perry, B., Randolph, T., McDermott, J., Sones, K., Thornton, P. Investing in animal health research to alleviate poverty. ILRI (International Livestock Research Institute). Nairobi, Kenya. (2002).
  13. Nagamine, K., Hase, T., Notomi, T. Accelerated reaction by loop-mediated isothermal amplification using loop primers). Mol Cell Probes. 16, (3), 223-229 (2002).
  14. Notomi, T., et al. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28, (12), E63 (2000).
  15. Kaneko, I., et al. Detection of enterotoxigenic Clostridium perfringens in meat samples by using molecular methods. Appl Environ Microbiol. 77, (21), 7526-7532 (2011).
  16. Karanis, P., et al. Development and preliminary evaluation of a loop-mediated isothermal amplification procedure for sensitive detection of cryptosporidium oocysts in fecal and water samples. Appl Environ Microbiol. 73, (17), 5660-5662 (2007).
  17. Xue, C., et al. Rapid detection of Infectious bursal disease virus by reverse transcription loop-mediated isothermal amplification assay. J Vet Diagn Invest. 21, (6), 841-843 (2009).
  18. Barkway, C. P., Pocock, R. L., Vrba, V., Blake, D. P. Loop-mediated isothermal amplification (LAMP) assays for the species-specific detection of Eimeria that infect chickens. BMC Vet Res. 7, (1), 67 (2011).
  19. Long, P., Joyner, L., Millard, B., Norton, C. A guide to laboratory techniques used in the study and diagnosis of avian coccidiosis. Folia Veterinaria Latina. 6, (3), 201-217 (1976).
  20. Goto, M., Honda, E., Ogura, A., Nomoto, A., Hanaki, K. Colorimetric detection of loop-mediated isothermal amplification reaction by using hydroxy naphthol blue. BioTechniques. 46, (3), 167-172 (2009).
  21. Arakawa, A., Baba, E., Fukata, T. Eimeria tenella infection enhances Salmonella typhimurium infection in chickens. Poult Sci. 60, (10), 2203-2209 (1981).
  22. Blake, D. P., Smith, A. L., Shirley, M. W. Amplified fragment length polymorphism analyses of Eimeria spp.: an improved process for genetic studies of recombinant parasites. Parasitol Res. 90, (6), 473-475 (2003).
  23. Lund, M., Nordentoft, S., Pedersen, K., Madsen, M. Detection of Campylobacter spp. in chicken fecal samples by real-time PCR. J Clin Microbiol. 42, (11), 5125-5132 (2004).
  24. Raj, G. D., et al. Real-time PCR-based quantification of Eimeria genomes: a method to outweigh underestimation of genome numbers due to PCR inhibition. Avian Pathol. 42, (4), 304-308 (2013).
  25. Blake, D. P., Hesketh, P., Archer, A., Shirley, M. W., Smith, A. L. Eimeria maxima: the influence of host genotype on parasite reproduction as revealed by quantitative real-time PCR. Int J Parasitol. 36, (1), 97-105 (2006).
  26. Beck, H. P., et al. Molecular approaches to diversity of populations of apicomplexan parasites. Int J Parasitol. 39, (2), 175-189 (2009).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics