Isolierung der viralen Replikation Compartment angereicherte Teil nuklearen Fraktionen von Adenovirus-infizierten normalen menschlichen Zellen

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Cite this Article

Copy Citation | Download Citations

Hidalgo, P., Gonzalez, R. A. Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells. J. Vis. Exp. (105), e53296, doi:10.3791/53296 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

Adenoviren enthält ein doppelsträngiges DNA-Genom, das in den infizierten Zellkern repliziert. Wenn der Virus-DNA in den Zellkern, lokalisiert es neben PML nuclear bodies 1. Folgende virale frühe Genexpression wird die Kernarchitektur erheblich umstrukturiert Induzieren der Bildung von viralen Mikroumgebungen, bezeichnet als virale Replikation Compartments (RC) 2. Seit Adenovirus (Ad) RC sind Websites, auf denen Virusgenom Replikation und Expression der viralen späten Gene stattfinden, bieten sie eine Umgebung für die Rekrutierung von allen notwendigen viralen und zellulären Faktoren, die in diesen Prozessen zu beteiligen. Interessanterweise eine Vielzahl von zellulären Proteinen für die zelluläre antivirale Reaktion verantwortlich ist, wie das die DNA-Reparatur, die angeborene Immunantwort und Tumorsuppression kooptiert zu diesen viralen Orte 2. Daher kann Ad RC berücksichtigt werden regulatorische Hubs, die effiziente virale Replikation zu fördern, während gleichzeitig die Regulierung derzelluläre antivirale Antwort, die anzeigt, dass diese Strukturen sind der Schlüssel zum Verständnis der Virus-Wirt-Zell-Interaktionen. Dennoch sind die molekularen Mechanismen der RC Bildung, ihrer Zusammensetzung und damit verbundenen Tätigkeiten sind weitgehend unverstanden.

Adenoviralen RC sowie RC von anderen DNA-Viren, die im Zellkern repliziert sind nicht auf Membranen cytoplasmatische RC 3 zugeordnet ist, im Gegensatz. Darüber hinaus sind diese virusinduzierten Strukturen wahrscheinlich vollständig von Proteinen und Nukleinsäuren aufgebaut sein. RC in Zellen mit RNA-Viren infiziert gebildet (gewöhnlich als viralen Fabrik) isoliert, unter Ausnutzung ihrer zytoplasmatischen Lokalisation und membrangebundenen Status, der ihre detaillierte morphologische, funktionelle und biochemische Charakterisierung 4 erleichtert hat.

Nach unserem Kenntnisstand haben Atom viralen RC nicht isoliert wurden, möglicherweise aufgrund der Komplexität der Kernarchitektur und Abwesenheit der intranukleären membranes, die ihre Isolierung erleichtern würde. Ihre Studie wurde stattdessen auf die Immunfluoreszenzmikroskopie, Fisch und Transmissionselektronenmikroskopie verlassen. Doch trotz Komplikationen inhärenten Isolierung subnuclear Strukturen, andere Kernbereichen wie Kernkörperchen und Cajal Bodies haben, bevor 5,6 isoliert. Da Nucleoli und RC beide aus Proteinen und Nukleinsäuren besteht, und haben einen Durchmesser zwischen 0,5 - 5 um, stellten wir die Hypothese, dass RC auch zugänglich Isolation. Deshalb, um genauer zu charakterisieren, die molekulare Zusammensetzung und Funktionen RC verbunden sind, haben wir eine neuartige Methode, um subnuclear Fraktionen mit RC bereichert zu isolieren. Zu diesem Zweck stellten wir Sub-Kernfraktionen mit Geschwindigkeitsgradienten und Saccharose Kissen ähnlich Verfahren verwendet werden, um Kernkörperchen 7 oder sonstigen Kerndomänen 6 zu isolieren und gründete ein zellfreies System, das die Untersuchung der molekularen Zusammensetzung und die damit verbundenen Tätigkeiten erlaubtRC. Diese Technik ist daher das Verständnis der voran Virus-Wirt-Zell-Wechselwirkungen und ist ein mächtiges Werkzeug, das auch die detaillierte Analyse von RC zu erleichtern, sollte aus anderen Viren, die im Zellkern repliziert und induzieren Bildung replikations Abteile ähnliche Abmessungen wie jene in Adenovirus- gebildet infizierte Zellen, wie Herpesviren, Papillomaviren oder Polyomaviren.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. HFF Zellkultur und Ad-Infektion

  1. Ausbreiten Ad5 Virus in Monoschichten von HEK-293 Zellen und Titer als fluoreszierende bildenden Einheiten (FFU) auf HFF-Zellen, wie zuvor. 8 beschrieben
  2. Wachsen Menschliche Vorhautfibroblasten (HFF) in 10 ml DMEM / 10% fötales Rinderserum (FBS) in sterile Kulturschalen von 100 mm bei 37 ° C und 5% CO 2 in einem befeuchteten Inkubator. Bestimmen Sie die Zellzahl unter Verwendung einer Neubauer Kammer durch Zählen der Zellen in den vier 16-Quadratmeter-Sets. Die Zellzahl pro ml wird durch Berechnen der Anzahl der Zellen in den vier 16-Quadrat-Sets und Multiplizieren dieser Zahl mit 10 4 erhalten. Für jeden Zeit nach der Infektion in Schritt 1.3 verwendet, so führen 1 x 10 7 HFF-Zellen.
  3. Mock-Infektion oder infizieren HFF-Zellen mit Adenovirus Typ 5 (Ad5) Wildtyp (WT) (H5pg4100 8) in 100 mm Gewebekulturschalen mit 1 ml von Ad5 in DMEM pro Schale bei einer MOI von 30 Fokus Erzeugungseinheit oder FFU pro Zelle. Inkubieren für 2 Stunden in ahumidified Zellkulturbrutschrank bei 37 ° C und 5% CO 2, sorgfältig rockt die Gerichte alle 15 Minuten, um eine homogene Verteilung des Virusinokulum über die Zellen zu gewährleisten. Nach dieser Zeit, entfernen Sie das Medium und fügen Sie frisches DMEM mit 10% FBS und Inkubation für 16, 24 oder 36 Stunden in einem befeuchteten Zellkulturbrutschrank bei 37 ° C und 5% CO 2. Fahren Sie mit Schritt 2.1.

2. Herstellung von Sub-Kern Fraktionen mit Adenovirus RC Angereichert

  1. Ernte-Ad5-infizierte oder scheininfizierte HFF-Zellen mit einem Zell scrapper und sammeln die Zellen in sterile Zentrifugenröhrchen. Bestimmen Sie die Anzahl der Zellen, wie in Schritt 1.2. Verwenden 1 x 10 7 Zellen für jede Zeit nach der Infektion in Schritt 1.3 angegeben.
  2. Zentrifugieren Sie die Zellen bei 220 × g, 4 ° C für 5 min.
  3. Zellpellet in eiskaltem PBS (137 mM NaCl, 2,7 mM KCl, 10 mM Na 2 HPO 4 und 1,8 mM KH 2 PO 4). Wash Zellpellets 3 mal mit 5 ml eiskaltem PBS pro Waschgang. Zu diesem Zweck Zentrifuge die Zellen bei 220 × g, 4 ° C für 5 min, dekantieren und den Überstand verwerfen (SN) und Zellpellet durch vorsichtiges Pipettieren.
  4. An der Plasmamembran zu stören, Zellpellet in 700 ul eiskaltem hypotonischen Puffer (10 mM HEPES pH 7,9, 10 mM KCl, 1,5 mM MgCl 2, 0,5 mM DTT, 20 μ g / ml Phenylmethylsulfonylfluorid (PMSF) eine Mischung aus Cystein, Serin, Threonin und Aspartylproteasehemmstoffen einschließlich 10 μ g / ml Rinderpankreas-Trypsininhibitor, 10 μ g / ml Pepstatin A und 10 μ g / ml N-Acetyl-L-Leucyl-L-Leucyl-L -argininal) und lassen Sie die Zellen schwellen auf Eis für 3 Stunden.
  5. Lyse der Zellen unter Verwendung eines Homogenisators mit einem locker sitzende A-Typ Teflonpistill. Führen Sie 80 Dounce Schlaganfälle und Monitorproben alle 20 Hübe von Hellfeld-Mikroskopie, um sicherzustellen, dass alle Zellen lysiert worden sind, aber das Kerne not beschädigt oder zerrissen.
  6. Zentrifugieren Sie die Zellhomogenat bei 300 × g, 4 ° C für 5 min. Lagern Sie den SN als cytoplasmatische Fraktion bei -20 ºC in einem Zentrifugenröhrchen.
  7. Um Zelltrümmer aus Keimen in 750 μ l der Lösung 1 (S1) (zu entfernen, das Pellet 0,25 M Saccharose, 10 mM MgCl 2 20 μ g / ml PMSF, eine Mischung aus Cystein, Serin, Threonin und Aspartyl-Protease-Inhibitoren einschließlich 10 μ g / ml Rinderpankreas-Trypsininhibitor, 10 μ g / ml Pepstatin A und 10 μ g / ml N-Acetyl-L-Leucyl-L-Leucyl-L-argininal) und die Schicht über ein gleiches Volumen der Lösung 2 (S2) (0,35 M Saccharose, 0,5 mM MgCl 2, 20 μ g / ml PMSF, eine Mischung aus Cystein, Serin, Threonin und Aspartyl-Protease-Inhibitoren einschließlich 10 μ g / ml Rinderpankreas-Trypsininhibitor, 10 μ g / ml Pepstatin A und 10 μ g / ml N-Acetyl-L-Leucyl-L-Leucyl-L-argininal). Centrifuge bei 1.400 × g, 4 ° C für 5 min.
  8. Entsorgen Sie die SN mit einer Mikropipette. Vermeiden Sie das Pellet aufzurühren.
  9. Das Pellet enthält isolierten Zellkernen in 750 μ l S2.
  10. Um subnuclear Fraktionen mit Adenovirus RC (RCF) angereichert zu isolieren, beschallen resuspendiert Kerne mit einem Ultraschallbad, mit Hilfe von zwei 5 min Impulse, oder bis alle Kerne werden lysiert, wie durch Hellfeldmikroskopie beobachtet. Gebraucheissätze in Ultraschallbad wie notwendig, um Proben, die bei oder unter 4 ° C zu halten.
  11. Schichten beschallt Kernen über einem gleichen Volumen der Lösung 3 (S3) (0,88 M Saccharose, 0,5 mM MgCl 2) und Zentrifuge bei 3.000 x g, 4 ° C für 10 min. Bewahren Sie die 1,5 ml Überstand als nukleoplasmatischen Fraktion (NPL) bei -70 ºC. Das Pellet in 700 μ l S2 und speichern als RCF bei -70 ºC.

3. Western-Blot-Analysen der RCF

HINWEIS: Western-Blot-Analyse der Npl und RCF Fraktionen set Seite 640 & mgr; l für Npl und 300 μ l RCF aus dem in Stufe 2.11 erhaltenen Gesamtvolumens.

  1. Mix 15 μ l jeder subnuclear Fraktion in Laemmli-Puffer 2x (4% SDS, 20% Glycerin, 10% 2-Mercaptoethanol, 0,004% Bromphenolblau, 0,125 M Tris HCl pH 6,8) und Kochen bei 95 ºC für 5 min. Laden der Proben in einem 10% Natriumdodecylsulfat-Polyacrylamid-Gelelektrophorese (SDS-PAGE) Denaturierungsgel und separaten Proteinen für 1,5 h bei 20 Milliampere (mA).
  2. Transferproteine ​​durch Elektroblotting für 1,5 h bei 400 mA auf Polyvinylidendifluorid (PVDF) -Membranen.
  3. Block Membran für 2 Stunden bei RT mit 3% fettfreier Trockenmilch in PBS.
  4. Inkubieren O / N bei 4 ºC mit dem primären Antikörper gegen virale E2A DNA-bindendes Protein (B6-8 9) bei einer 1: 500-Verdünnung in PBS / 0,3% fettfreier Trockenmilch.
  5. Waschen der Membran 3 mal mit PBS / 0,1% Tween 20 für 10 min.
  6. Inkubieren Sie die Membran mit Maus-anti-IgG-Sekundär ein10.000-Verdünnung in PBS für 2 h bei RT: tibody bei einer 1 bis Meerrettichperoxidase (HRP) gekoppelt.
  7. 3 mal für 10 min Waschen der Membran mit PBS / 0,1% Tween 20.
  8. Entwickeln Sie die Membran unter Verwendung verstärkter Chemilumineszenz und Röntgenfilme.

4. Virale DNA-Nachweis in RCF

HINWEIS: DNA-Isolierung aus beiden Npl und RCF Fraktionen, verwenden Sie 210 μ l für Npl und 100 μ l für RCF des in Stufe 2.11 erhaltenen Gesamtvolumen.

  1. Inkubieren subnuklearer Fraktionen für 1 h bei 55 ° C mit 1 mg / ml Proteinase K und 0,5% Tween 20.
  2. Proteinase K inaktiviert durch Inkubation der Proben für 10 min bei 95 ° C.
  3. Zentrifugieren Sie die Probe bei 20000 · g, bei Raumtemperatur für 2 min.
  4. Sammeln Sie die SN. Ausfällung der DNA mit 1/10 Volumen 3 M Natriumacetat und einem Volumen Isopropanol, O / N bei 4 ° C.
  5. Zentrifugieren der Proben bei 20.000 xg bei RT für 10 min.
  6. Entsorgen Sie die SN usingen ein Mikropipette. Bei 20000 × g, 4 ° C für 5 min Waschen des Pellets mit 70% Ethanol und zentrifugiert.
  7. Resuspendieren der DNA in 10 μ l 10 mM Tris-HCl pH 7,4
  8. Quantifizierung DNA unter Verwendung eines Spektrophotometers durch Messung der optischen Dichte (OD) bei 260 nm.
  9. Zur Amplifikation viraler DNA, verwenden 100 ng DNA aus jedem subnuclear Fraktion in einer Standard-PCR-Reaktion unter Verwendung von Taq-DNA-Polymerase in 25 μ l-Reaktionsvolumen mit Primern, die die Amplifikation einer Region innerhalb des hauptsächlichen späten Transkriptionseinheit zu ermöglichen, von Nucleotid 7273 bis Nukleotid 7353 (81 bp) (Fw: GAGCGAGGTGTGGGTGAGC; Rv: GGATGCGACGACACTGACTTCA). Verwenden Sie die folgenden Zyklusbedingungen: Initiale Denaturierung für 3 min bei 95 ° C, gefolgt von 20 Amplifikationszyklen (1 min bei 95 ° C, Annealing für 1 min bei 62 ° C und Verlängerung für 30 Sekunden bei 72 ° C) und einem abschließenden Verlängerungsschritt für 3 min bei 72 ° C.
  10. Führen Sie das PCR-Produkt in 2% Agarose-Gelen, bei 90 V. Stain mit EthidiumBromid bei 0,5 μ g / ml Endkonzentration und visualisieren DNA, virale DNA-Anreicherung in der RCF mauern. Griff Ethidiumbromid mit äußerster Vorsicht und immer darauf achten, Handschuhe zu tragen, da diese Verbindung ist ein potenter mutagen. Entsorgen Ethidiumbromid gemäß gültiger Richtlinien.

5. späten viralen mRNA-Nachweis in RCF

HINWEIS: Für die RNA-Isolierung aus beiden Npl und RCF Fraktionen, verwenden Sie 640 μ l für Npl und 300 μ l für RCF aus dem in Stufe 2.11 erhaltenen Gesamtvolumen.

  1. Isolieren von RNA aus subnuclear Fraktionen unter Verwendung von Trizol nach den Herstelleranweisungen. Resuspendieren RNA in 50 μ l DEPC (diethilpyrocarbonate) behandelten Wasser.
  2. Quantifizierung der RNA mit einem Spektralphotometer, um die OD bei 260 nm messen (ca. 3 μ g erhalten). Bewahren Sie die RNA in 50 ng / & mgr; l-Aliquots bei -70 ºC.
  3. Überprüfen gereinigte RNAdie Abwesenheit von DNA-Kontamination durch Durchführung einer PCR-Kontrollreaktion in Abwesenheit von reverser Transkriptase (RT) unter Verwendung von 5 ng Gesamt-RNA und die in Schritt 4.9 beschriebenen Zyklusbedingungen.
    1. Wenn DNA-Kontamination fehlt kein Amplikon sollte hergestellt werden. Wenn DNA-Kontamination vorhanden ist, läßt man die Proben mit 10 U DNase I, 10 U RNase-Inhibitor, 0.1 M Tris-HCl pH 8,3, 0,5 M KCl und 15 mM MgCl2 30 Minuten bei 37 ºC. Gehen Sie erneut zu isolieren RNA, wie in Schritt 5.1.
  4. Virale mRNA zu RCF zugeordnet analysieren, verstärken 100 ng RNA aus jeder subnuclear Fraktion durch RT-PCR unter Verwendung von Primern, um adenoviralen späten mRNA aus verschiedenen Genfamilien (Tabelle 1) zu detektieren.
    1. Für die reverse Transkription (RT), Verwenden von 100 ng RNA, die voneinander subnuclear Fraktion in einem Standard-RT-Reaktion unter Verwendung von M-MuLV RT-Enzym in 20 μ l Reaktionsvolumen 1 h bei 42 ºC und 10 min bei 70 ºC.
    2. Zur Verstärkung, benutzen 1μ l der cDNA in der PCR-Reaktionen, wie in Schritt 4.9. Mithilfe der folgenden Zyklusbedingungen: Initiale Denaturierung für 3 min bei 95 ºC, gefolgt von 25 Zyklen der Amplifizierung (1 min bei 95 ºC, Annealing für 1 min bei der in Tabelle 1 und Erweiterung angegeben für 30 Sekunden bei 72 ºC Temperatur) und ein abschließenden Extensionsschritt für 3 min bei 72 ºC.
  5. Führen Sie die RT-PCR-Produkte in 2% Agarose-Gelen, bei 90 V. Stain Gele mit Ethidiumbromid bei 0,5 μ g / ml Endkonzentration und zu visualisieren, um Viren späten mRNA-Assoziation mit dem RCF mauern. Griff Ethidiumbromid wie in Schritt 4.10 angegeben.

6. Immunfluoreszenz Visualisierung von RCF

HINWEIS: Carry-out dieses Verfahren unter einer Sterilbank, um eine Kontamination der Proben zu vermeiden, mit jedem Staubpartikel und alle Lösungen auswählen, vor dem Gebrauch.

  1. Spot 5 ul der in Schritt 2.10 dire erhalten RCF Bruchctly auf einem Silan-beschichteten Objektträger.
  2. Lassen Sie die Stelle trocken für ca. 5 min bei RT.
  3. Re-Hydrat durch langsam und indirekt Pipettieren von 500 μ l PBS in einem Tropfen neben dem RCF Stelle und lässt sie durch Kippen des Schiebe fließen. Lassen Sie das überschüssige PBS von der Seite.
  4. Block durch Bedecken der Probe mit 500 μ l PBS / 5% Rinderserumalbumin (BSA) für 2 h bei RT.
  5. 3 Mal vorsichtig und indirekt Pipettieren von 500 μ l PBS auf die Probe zu waschen der Folie. Neigen Sie den Schieber zum Ableiten des überschüssigen PBS.
  6. Inkubieren der Probe mit dem primären Antikörper gegen an einer 1-Virus E2A DNA-bindendes Protein (B6-8 9): 500 Verdünnung in PBS für 2 h bei RT. Decken Sie die beschmutzte Probe mit 20 μ l der Antikörperlösung und Inkubation in einer feuchten Kammer, um ein Austrocknen zu verhindern.
  7. 3 Mal Waschen der Probe mit PBS / 0,02% Tween 20 durch leichtes und indirekt Pipettieren von 500 μ l PBS auf die Probe. Neigen Sie den Schieber, um weg von der ex DrainProzesswaschlösung.
  8. 2.000 Verdünnung in PBS bei 4 ° C, für 1 h: die Proben mit Maus-anti-IgG-Sekundärantikörper mit einem Fluorophor, das bei 488 nm in einem 1 angeregt wird, gekoppelt zu inkubieren. Decken Sie die beschmutzte Probe mit 20 μ l der Antikörperlösung und Inkubation in einer feuchten Kammer, um ein Austrocknen zu verhindern.
  9. 3 Mal Waschen der Probe mit PBS / 0,02% Tween 20 durch leichtes und indirekt Pipettieren von 500 μ l PBS auf die Probe. Neigen Sie den Schieber zum Ableiten des überschüssigen Waschlösung.
  10. Decken Sie die beschmutzte Probe auf dem Objektträger mit einem Deckglas mit 2 μ l PBS / 10% Glycerin als Einschlussmittel. Dichtung mit klarem Nagellack und speichern al -20 ºC.
  11. Analyse der Proben unter Verwendung eines Fluoreszenzmikroskops mit einem 63x-Objektiv und einem 1,4 numerischen Apertur (NA) bei einer Wellenlänge von 488 nm.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Da virale Replikation Abteile (RC) sind subnuclear viral induzierten Strukturen von Proteinen und Nukleinsäuren, ähnlich zu anderen Kerndomänen zusammengesetzt, erwiesen sie zugänglich Isolierung zu sein durch Geschwindigkeitsgradienten basierend auf biochemischen Funktionen. Kritischen Schritte bei der Fraktionierung Protokolls sind in Abbildung 1. Bei jedem dargestellten Schritt die Proben müssen durch Hellfeldmikroskopie überwacht, um die Integrität der verschiedenen subzellulären Fraktionen sicherzustellen. Beispielsweise, wenn Schwellung der Zellen, Inkubationszeit in der hypotonischen Puffer muss, um in das Cytoplasma eine Beschädigung der Kerne zu quellen standardisiert werden. Nach der Zell Homogenisierung intakten Zellkernen, frei von zytoplasmatischen Komponenten einschließlich endoplasmatischen Retikulum Membranen, müssen erhalten werden. Außerdem muss die Beschallungszeit ist, um die Kernmembran aller Zellen ohne Störung RC Bruch standardisiert werden.

Nach Erhalt der Teilkernfraktionen, SchlüsselKontrollen müssen einbezogen werden, um den Verein und Anreicherung von Bona-fide-RC Marker in der RCF bestimmen. Adenoviralen RC werden üblicherweise in infizierten Zellen durch Immunfluoreszenz unter Verwendung von Antikörpern gegen das virale E2A-72K-Protein (DBP) visualisiert. DBP ist ein virales Protein, das direkt an der viralen Genomreplikation beteiligt; Daher ist die Anwesenheit von DBP in Partikeln in der RCF angereichert zeigt die direkte Assoziation dieses viralen Proteins mit den isolierten Teilchen, wie in Abbildung 1 dargestellt. Weiterhin Nachweis von DBP in RCF durch Western-Blot bestätigt die Assoziation dieses Protein an das isolierte RC. In Abbildung 2 ist gezeigt, daß durch späten Zeitpunkten nach der Infektion (36 hpi), DBP ist in der RCF angereichert im Vergleich zum nukleoplasmatischen Fraktion (NPL), was zeigt, dass RC mit diesem Verfahren zu verschiedenen Zeitpunkten nach der Infektion mit dem erwarteten zeitlichen erhalten Muster der DBP Verein RC. Eine wesentliche Viruskomponente RC ist die virale DNA itself. In Experimenten wie die in Figur 3 gezeigt zeigen wir, dass steigende Mengen an viraler DNA assoziieren mit RCF als der Replikationszyklus des Virus fortschreitet, was darauf hinweist, dass wie bei DBP, das zeitliche Muster der DNA-Replikation in diesen Fraktionen können untersucht werden.

Neben der viralen Proteine ​​und das virale Genom enthält, sind RC auch Seiten von viralen späten Genexpression. In 4 zeigen wir repräsentative Ergebnisse von Experimenten, die von RT-PCR-Messung der Höhe der verschiedenen Arten von späten viralen mRNA und ihre Trennung zwischen RCF und Npl bei 36 hpi. Viralen späten mRNA werden in RC synthetisiert und ihre postranscriptional Verarbeitung initiiert in diesen Stätten; später diese viralen mRNA dissoziiert von RC, freigesetzt zu dem Kernplasma und werden anschließend in das Cytoplasma exportiert. Die Gesamtanzahl der reifen viralen späten mRNA (ML mRNA) wurde unter Verwendung von Primern, die ein Exon-Übergang des dreiteiligen Leaders verstärken gemessen wird, einSequenz, die die 5'aller adenoviralen späten mRNA (4A) bildet. Exon-Verbindungen in der mRNA des spezifischen reifen Transkripte des L2, L4 und L5 wurden Familien ebenfalls gemessen. Es wurde festgestellt, dass die späte Phase der viralen Replikationszyklus fortschreitet, zunehmende Mengen von späten viralen mRNA in das Zytoplasma exportiert; jedoch durch späten Zeiten Herstellung der L5 mRNA-Spezies im Vergleich zu den anderen späten mRNA-Familien weiter erhöht. In den in Abbildung 4 gesät repräsentative Ergebnisse ein etwa 2,5-fachen Unterschied in der ML-mRNA ist in Npl beobachtet, verglichen mit RCF, wie erwartet. Interessanter beim Vergleich von mRNA von bestimmten Familien erscheinen sowohl L2 und L4 mRNA in ähnlichen Mengen zwischen beiden subnuclear Fraktionen (4B bzw. C) verteilt werden, während im Gegensatz dazu zeigte die L5 mRNA eine fast 2fache Erhöhung Npl im Vergleich zu RCF. Diese Ergebnisse deuten auf eine Differenzmuster in dem sy nthesis und Freisetzung der verschiedenen viralen späten mRNA-Spezies von adenoviralen RC (wie zuvor 10 vorgeschlagen worden ist). Signifikant Diese Ergebnisse zeigen auch, daß genaue Messungen der verschiedenen Schritte bei der Biogenese der viralen mRNA kann unter Verwendung von isolierten RC mit diesem neuen Verfahren durchgeführt werden.

Abbildung 1
Abbildung 1. Hellfeldmikroskopie von verschiedenen Schritten während des Fraktionierungsverfahrens. Während der Isolierung der RC, müssen die Proben, die durch ein optisches Mikroskop beobachtet, um die Integrität der subzellulären Fraktionen sicherzustellen. Die Abbildung zeigt die in dem Verfahren verwendet werden, um zu erhalten RCF Schritte, von der Schwellung der HFF-Zellen, um die Trennung der Kerne und Isolierung von RCF durch Saccharose-Kissen. 40x Mikroskopische Aufnahmen: Maßstabsleiste 50 μ m; 63x Mikroskopische Aufnahmen: Maßstabsleiste 5 μ m; DBP wird grün dargestellt.tps: //www.jove.com/files/ftp_upload/53296/53296fig1large.jpg "target =" _ blank "> Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Figur 2
Abbildung 2. Western Blot gegen DBP. Die Proben werden mittels SDS-PAGE analysiert und für die Western-Blot gegen DBP, einem gutgläubigen Marker der viralen RC verarbeitet. Die Anreicherung des Proteins in RCF zu bestimmen, ist es nützlich, um das Vorhandensein und die relative Menge an DBP in sowohl RCF und Npl zu verschiedenen Zeiten nach der Infektion zu vergleichen. In HFF-Zellen 16 hpi stellt einen frühen Zeitpunkt während des adenoviralen Replikationszyklus; 24 hpi markiert den Übergang in der Spätphase der Infektion als die virale DNA-Synthese beginnt; 36 hpi stellt einen späten Zeitpunkt nach der Infektion. Das erwartete Molekularmasse von DBP gezeigt. Bitte click Sie hier, um eine größere Version dieser Figur zu sehen.

Figur 3
Abbildung 3. PCR-Assay für die virale DNA (vDNA) in RCF. DNA-Erkennung wurde von RCF und Npl bei 24 und 36 hpi gereinigt. Virus-DNA wurde durch PCR unter Verwendung von für das virale Genom Grundierungen. Die Grafik zeigt die Anreicherung von viraler DNA in RCF bei 36 hpi. Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Figur 4
.. Figur 4. Analyse der späten viralen mRNA-RNA wurde aus RCF und Npl isoliert und durch RT-PCR analysiert, um die spezifischen viralen späten mRNA zu detektieren (A) Gesamt späten viralen mRNA (ML: Major Late); (B) mRNA aus der L2 Familie, (C) mRNA aus der Familie L4; (D) mRNA aus der L5-Familie. Werte stellen Mittelwert ± Standardabweichung von dreifachen Proben. Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Name Vorwärts-Primer-Sequenz (5'-3 ') Reverse-Primer-Sequenz (5'-3 ') Glühtemperatur
ML mRNA GCCTCCGAACGGTACTCCGCC CGCCACGGTGCTCAGCCTACC 60 ºC
L2 mRNA GTCACAGTCGCAAGATGTCCAAGC GCAACGCCAGCATGTCCTTATGC 58 ºC
L4 mRNA CCTCCGAACGGTACTCCGC CCTTGCTCATCTTGCGACTGTG 58 ºC
L5 mRNA GTCACAGTCGCAAGATGAAGCG GGTAACTAGAGGTTCGGATAGGCG 60 ºC

. Tabelle 1 verwendeten Primer für Viral späten mRNA Amplifikation ML mRNA: Diese Primer ermöglichen die Amplifizierung einer Region innerhalb der dreiteiligen Leader, die 5'-Sequenz, die für alle viralen späten mRNA ist; L2 mRNA Primer ermöglichen die Amplifikation einer spezifischen Region innerhalb des pV mRNA; L4 mRNA Primer ermöglichen die Amplifikation einer spezifischen Region innerhalb des 100 K mRNA; L5 mRNA ermöglicht die Amplifikation einer Region innerhalb der Faser mRNA. Die Reihenfolge und die Anlagerungstemperaturen für jede primER werden gezeigt.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
DMEM Gibco 12100-046 Warm in 37 ºC water bath before use
Fetal Bovine Serum Gibco 12484-028
Sucrose, Ultra Pure Research Organics 0928S Prepare a 2.55 M stock solution and store at 4 ºC
Dounce homogenizer Kontess Glass Company 884900-0000
Branson 1800 Ultrasonic Bath Branson Z769533 SIGMA Turn on 15 min before use.
Goat anti-Mouse IgG1 Secondary Antibody, Alexa Fluor 488 conjugate Life Technologies A-21121 Use at a 1:2,000 dilution in PBS
Silane-Prep Slides Sigma S4651-72EA Open in a laminar flow cabinet
SuperSignal West Pico Chemiluminescent Substrate Pierce ThermoScientific 34080

DOWNLOAD MATERIALS LIST

References

  1. Doucas, V., et al. Adenovirus replication is coupled with the dynamic properties of the PML nuclear structure. Genes & Dev. 10, 196-207 (1996).
  2. Schmid, M., Speiseder, T., Dobner, T., Gonzalez, R. A. DNA virus replication compartments. J. Virol. 88, 1404-1420 (2014).
  3. Boon, J. A., Diaz, A., Ahlquist, P. Cytoplasmic viral replication complexes. Cell host microbe. 8, 77-85 (2010).
  4. Paul, D., Hoppe, S., Saher, G., Krijnse-Locker, J., Bartenschlager, R. Morphological and biochemical characterization of the membranous hepatitis C virus replication compartment. J. Virol. 87, 10612-10627 (2013).
  5. Busch, H., et al. Isolation of Nucleoli. Exp Cell Res. 24, Suppl 9. 150-163 (1963).
  6. Lam, Y. W., Lyon, C. E., Lamond, A. I. Large-scale isolation of Cajal bodies from HeLa cells. Mol. Biol. Cell. 13, 2461-2473 (2002).
  7. Lam, Y. W., Trinkle-Mulcahy, L., Lamond, A. I. The nucleolus. J Cell Sci. 118, 1335-1337 (2005).
  8. Groitl, P., Dobner, T. Construction of adenovirus type 5 early region 1 and 4 virus mutants. Methods Mol Med. 130, 29-39 (2007).
  9. Reich, N. C., Sarnow, P., Duprey, E., Levine, A. J. Monoclonal antibodies which recognize native and denatured forms of the adenovirus DNA-binding protein. Virology. 128, 480-484 (1983).
  10. Leppard, K. N. Selective effects on adenovirus late gene expression of deleting the E1b 55K protein. J Gen Virol. 74, (Pt 4), 575-582 (1993).
  11. Gonzalez, R., Huang, W., Finnen, R., Bragg, C., Flint, S. J. Adenovirus E1B 55-kilodalton protein is required for both regulation of mRNA export and efficient entry into the late phase of infection in normal human fibroblasts. J. Virol. 80, 964-974 (2006).
  12. Castillo-Villanueva, E., et al. The Mre11 Cellular Protein Is Modified by Conjugation of Both SUMO-1 and SUMO-2/3 during Adenovirus Infection. ISRN Virology. 2014, 14 (2014).
  13. Morris, S. J., Scott, G. E., Leppard, K. N. Adenovirus late-phase infection is controlled by a novel L4 promoter. J. Virol. 84, 7096-7104 (2010).
  14. Wright, J., Leppard, K. N. The human adenovirus 5 L4 promoter is activated by cellular stress response protein p53. J. Virol. 87, 11617-11625 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics