Generasjon av innfødte Chromatin Immunoprecipitation sekvensering biblioteker til Nucleosome tetthet analyse

Genetics
 

Summary

Vi presenterer en modifisert innfødt chromatin immunoprecipitation sekvensering (ChIP-seq) metodikk for generering av sekvens datasett egnet for en nucleosome tetthet ChIP-seq analytiske rammen integrere micrococcal nuclease (MNase) tilgjengelighet med histone endring målinger.

Cite this Article

Copy Citation | Download Citations

Lorzadeh, A., Lopez Gutierrez, R., Jackson, L., Moksa, M., Hirst, M. Generation of Native Chromatin Immunoprecipitation Sequencing Libraries for Nucleosome Density Analysis. J. Vis. Exp. (130), e56085, doi:10.3791/56085 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Vi presenterer en modifisert innfødt chromatin immunoprecipitation sekvensering (ChIP-seq) eksperimentelle protokollen kompatibel med en Gaussian blanding distribusjon basert analyse metodikk (nucleosome tetthet ChIP-seq, ndChIP-seq) som aktiverer generering av kombinert målinger av micrococcal nuclease (MNase) accessibility histone modifikasjoner genomet-wide. Nucleosome plassering og lokale tetthet og posttranslational endring av deres histone underenheter, handle sammen å regulere lokale transkripsjon stater. Kombinasjon målinger av nucleosome tilgjengelighet med histone endring generert av ndChIP-seq tillater samtidig avhør av disse funksjonene. NdChIP-seq metodikken gjelder lille antall primære celler utilgjengelig for cross-linking basert ChIP-seq-protokoller. Sammen kan ndChIP-seq måling av histone endring i kombinasjon med lokale nucleosome tetthet å få ny innsikt i delte mekanismer som regulerer RNA transkripsjon i sjeldne primære celle populasjoner.

Introduction

Eukaryote genomet er pakket inn i chromatin via gjentatte nucleosome strukturer som består av to kopier av fire histone proteiner (f.eksH2A, H2B, H3 og H4) omskrevet av 146 base parene av DNA1,2. Chromatin remodeling kontrollere nucleosome posisjon innen genet promoter grenser og delta i regulering av genuttrykk ved å endre tilgjengelighet av DNA transkripsjonsfaktorer og RNA polymerase maskiner3, 4.

Amino terminal haler av histones i nucleosome er utsatt for ulike kovalente endringer, inkludert acetylation, metylering, fosforylering, ubiquitylation, sumoylation, formylering og hydroksylering av bestemte aminosyrer5 , 6 , 7 , 8. posisjoner og grader av disse modifikasjonene diktere en chromatin tilstand som påvirker chromatin struktur og kontroll tilgang til molekylær komplekser som tillater aktivering av transkripsjon7. Gitt at begge nucleosome tetthet og histone endring spiller en rolle i kontrollen lokale genet transkripsjon, utviklet vi en innfødt ChIP tilnærming som gjør samtidig måling av nucleosome tetthet og histone endring9, 10.

Innebygd ChIP-seq utnytter endonuclease micrococci nuclease (MNase) å fordøye intakt chromatin i sin opprinnelige tilstand innen den kjerne11,12, en egenskap som har vært utnyttet for å tilordne nucleosome posisjonering13 , 14 , 15. nucleosome tetthet ChIP-seq (ndChIP-seq) utnytter for fortrinnsrett tilgang av MNase åpne områder av chromatin å generere målinger som kombinerer MNase tilgjengelighet med histone endring10. ndChIP-seq er egnet for profilering av histone endringer i sjeldne primære celler, vev og kultivert celler. Her presenterer vi en detaljert protokoll som aktiverer generering av sekvens datasett egnet for en tidligere beskrevet analytisk ramme arbeid10 som integrerer fragment størrelse innlegget immunoprecipitation, bestemmes av par-end lese grenser, til samtidig Undersøk MNase tilgjengelighet med histone endring målinger. Tidligere bruk av denne protokollen til 10.000 primære menneskelige navlestrengsblod avledet CD34+ celler og menneskelige embryonale stamceller avslørt unikt forhold mellom chromatin struktur og histone endringer innenfor disse celle typer10 . Gitt sin evne til å måle samtidig nucleosome tilgjengelighet og histone modifisering, ndChIP-seq er i stand til avsløre epigenomic funksjoner i en celle befolkning på et enkelt nucleosome nivå, og løse heterogene signaturer i deres konstituerende elementer. Et eksempel på utforskning av heterogene mobilnettet bestander av ndChIP-seq er etterforskningen av bivalent arrangører, der både H3K4me3, en aktiv merke og H3K27me3, et undertrykkende merke, er tilstede10.

Protocol

Merk: Minimum inndataene for denne protokollen er 10 000 celler per enkelt immuno-nedbør (IP) reaksjon. Skrive ut angitte eksperimentelle regnearket og bruke som en retningslinje å planlegge ut eksperimentet. Incubations ved romtemperatur antas for å være på ~ 22 ° C. Alle buffer oppskrifter finnes i tabell 1. Alle bufferne bør lagres på 4 ° C og holdt på is under prosedyren ikke annet er angitt.

1. celle forberedelse

  1. Kultivert celler
    1. Vask cellene med 1 mL av fosfat buffer saltvann (PBS) og nøyaktig bestemme cellen konsentrasjonen med en hemocytometer. Hvis det er mer enn en million celler, øke volumet på PBS.
    2. Basert på celle greven, aliquot en tilsvarende 70 000-100.000 celler i en bakteriefri 1.5 mL tube, og rotere ned på 500 x g for 6 min på 4 ° C. Bruker en pipette, sakte fjerne og forkaste nedbryting (uten å forstyrre den cellen pellet) og resuspend pellets i iskalde lyseringsbuffer + 1 x protease hemmer cocktail (bilde) til en konsentrasjon av 1000 celler / µL. Bland godt av pipettering opp og ned 20-30 ganger. Det er viktig at cellen klumper er avbrutt. Prøv ikke å skape bobler.
    3. Gå direkte til dag 1 (del 2) av ndChIP-seq-protokollen eller flash fryse celle pellet i flytende nitrogen og store på-80 ° C.
  2. Sorterte celler
    1. Samle 70 000-100.000 sorterte16 celler i en 1,5 mL tube med 350 µL av Hanks bufrede salt løsning (HBSS), eller PBS + 2% fosterets bovin serum (FBS).
    2. Nedspinning hver celle aliquot på 500 x g for 6 min på 4 ° C. Bruker en pipette, sakte fjerne nedbryting (uten å forstyrre den cellen pellet) og resuspend i iskalde lyseringsbuffer + 1 x PIC å en final konsentrasjon av 1000 celler / µL. Bland godt i lyseringsbuffer av pipettering opp og ned 20 – 30 ganger. Kontroller at celle klumper er avbrutt. Prøv ikke å skape bobler.
    3. Gå direkte til dag 1 (del 2) av ndChIP-seq-protokollen, eller flash fryse celle pellet i flytende nitrogen og store på-80 ° C.

2. dag 1: ndChIP-seq

  1. Utarbeidelse av antistoff-perle komplekset
    1. Forbered en 37 ° C vannbad og en is bøtte. Arbeider på is, forberede 1 x IP buffer/1 x PIC og 1 x antistoff (Ab) fortynning buffer, og holde dem på isen. Hente Protein A (eller G) magnetiske perler (se diskusjon for valgkriterier) fra 4 ° C lagring og bland godt ved svak puls-vortexing. Hold det på is.
      Merk: Puls-vortexing betyr vortexing stoppes hver gang en full spiral er dannet i røret.
    2. Overføre 24 µL av Protein A (eller G) magnetiske perler per IP reaksjon til en ny 2 mL tube. Registrere volumet av perler og holde røret på is. For eksempel 7 IPs, bruke 24 µL x 7 = 168 µL.
    3. Sett røret på røret magneten og vente på løsningen å bli klart indikerer perle separasjon. Uten å forstyrre perler, nøye fjerne nedbryting bruker en pipette og kast. Ta tuben av rør magneten og plassere den på is.
    4. Legge til en like volum (dvs., første volum av perler) iskald IP bufferen + 1 x PIC blande. Bland ved pipettering opp og ned. Gjør ikke vortex.
    5. Plasser den IP buffer + 1 x bilde + perler tilbake på røret magneten og vente på løsningen å bli klart indikerer perle separasjon. Uten å forstyrre perler, nøye fjerne nedbryting bruker en pipette og kast. Gjenta kaldt IP buffer + 1 X PIC vask to ganger for totalt 3 vasker.
    6. Etter siste vask, resuspend perler i en like volum (dvs., første volum av perler) iskald IP bufferen + 1 x PIC blande. Bland ved pipettering opp og ned. Gjør ikke vortex. Holde røret på is.
    7. På is, hell 10 mL av IP buffer + bilde i en 25 mL V-formet reservoaret. Bruke en flerkanals pipette, legge til 130 µL av iskalde IP buffer + 1 x bilde blanding i individuelle brønner i en ren V bunn 96-brønns plate. Fyll en brønn per IP. Etiketten tallerkenen som "Ab-perle kompleks".
    8. Legg 12 µL av vasket Protein A (eller G) magnetiske perler i hvert godt som inneholder IP-buffer + bilde, og blande av pipettering opp og ned. Hold de resterende vasket perlene på is.
    9. Få godkjent antistoffer fra kald oppbevaring og tine på is, hvis nødvendig. Arbeider på is, fortynne antistoffer med 1 x Ab fortynning buffer til konsentrasjoner vist i tabell 2.
    10. Hver brønn av Ab-perle komplekse plate, Legg 1 µL av eventuelt utvannet antistoffer (tabell 1). Oppføring i brønnen nøkkelen antistoff. Bruker flerkanals pipette, bland hver rad ved pipettering opp og ned 20 ganger. Endre tips mellom rader. Seal Ab-perle komplekse platen godt med en aluminium plate cover og ruge på 4 ° C på en roterende plattform for minst 2 timer.
      Merk: Denne inkubasjon kan fortsette helt klar til å starte trinn 2.4.
  2. Cellen lyse og chromatin fordøyelsen
    1. Arbeider på is, forberede 1 x lyseringsbuffer + 1 x PIC og 1 mL av MNase jeg fortynning buffer (tabell 3) og holde dem på isen.
    2. Hente celle pellets fra deres-80 ° C lagring (eller is, hvis nylagde). Tine hver celle pellet i et vannbad 37 ° C i en 10 s, deretter overføre til is.
    3. Til hver celle pellet umiddelbart legge iskald 1 x lyseringsbuffer + 1 x PIC å en final konsentrasjon av 10.000 celler/20 µL, og bland 10 ganger av pipettering opp og ned, uten å skape bobler. For 70.000 cellene er for eksempel det siste bindet 140 µL.
    4. Arbeider på is, aliquot 20 µL/godt av den resulterende lysates inn i en 96-brønns plate. Dekk platen med en plast sel og ruge på is 20 min. etiketten plate "MNase fordøyelsen" og registrere brønnene til en mal nøkkel. For å sikre en eksakt tidspunkt for chromatin fordøyelsen reaksjonen, går ikke videre til fordøyelsen med mer enn 2 rader med prøver samtidig.
    5. Like før den 20 min lysis er fullført, fortynne MNase jeg enzymet med MNase jeg fortynning buffer, til en siste konsentrasjon av 20 U/µL, og holde det på is.
    6. Arbeider på is, forberede MNase jeg fordøyelsen master mix Tabell 4 og aliquot 20 µL av miksen per hver rad prøver pluss 5 µL døde volum i én rad med en 96-brønns reservoaret plate og holde det på is. To rader, volumet bør være: (20 µL x 2) + 5 µL = 45 µL.
    7. Når lysates ferdig rugende, Fjern MNase fordøyelsen platen fra isen. Bruke en flerkanals pipette, legge til 20 µL av MNase jeg fordøyelsen mestre blanding i hver rad av prøver, og bland 10 ganger av pipettering opp og ned. Endre tips mellom rader. Inkuber ved romtemperatur for nøyaktig 5 min.
    8. Etter 5 min, stoppe reaksjonen, bruker en flerkanals pipette til 6 µL av 250 µM ethylenediaminetetraacetic syre (EDTA) i hver rad av prøver og bland opp og ned et par ganger. Endre tips mellom rader. Etter EDTA, bytte innstillingen for Pipetter 20 µL og mix 10 ganger ved pipettering opp og ned for å sikre en fullstendig stopp av fordøyelsen reaksjonen. Endre tips mellom rader.
    9. Bruker en flerkanals pipette, i hver rad i MNase fordøyd utvalgene, legge til 6 µL av 10 x lyseringsbuffer og bland godt av pipettering opp og ned 10 ganger. Dekk med en plast sel og ruge på isen i 15 min.
  3. Input separasjon og før avregning
    1. Etter 15 min incubation, arbeider på is, svømmebasseng alle brønner for samme celle pellet/mal til en steril, pre kjølt på isen, 1,5 mL tube (pre merket med mal-ID) og bland godt, men langsomt bruker en pipette for å unngå vaskemiddel skummende.
    2. For hver celle pellet/mal, overføring 8 µL av fordøyd chromatin inn i en ny sterilt, 0,5 mL tube (pre merket med mal-ID) og butikk på 4 ° C over natten. Dette vil fungere som input kontroll.
    3. Distribuere gjenværende mengden fordøyd chromatin i 48 µL dele, i en ny 96-brønns plate. Cellen pellet/mal 1 går i brønner A01-A06, celle pellet/mal 2 går inn brønner A07-A12, etc. Registrere brønnene til en mal nøkkel. Etiketten platen "Pre clearing".
    4. Bruker en flerkanals pipette, sammenlegge 120 µL av 1 x IP Buffer + 1 x PIC og 12 µL av vasket Protein A (eller G) magnetiske perler i hver brønn av pre clearing plate fra trinn 2.3.3. Bland hver rad ved pipettering opp og ned 10 ganger. Endre tips mellom rader. Seal platen godt med en aluminium plate cover og ruge på en roterende plattform på 4 ° C i minst 2 timer.
  4. Immunoprecipitation reaksjon
    1. Før du starter denne trinn Sørg for at Ab-perle komplekse platen (trinn 2.1.10) og før clearing plate (trinn 2.3.4) har inkubert for minst 2 h. rask spinn begge platene av sentrifugering for 10 s 200 x g.
    2. Plasser Ab-perle komplekse platen (fra trinn 2.1.10) på en plate magnet og vente 15 s for løsningen å bli klare. Nøye fjerne og slette nedbryting bruker en pipette uten å forstyrre perler. Fjern plate fra platen magneten og holde det på is.
    3. Plasser pre clearing reaksjon platen (fra trinn 2.3.4) på en plate magnet og vente 15 s perler å skille og løsningen å bli klare. Uten å forstyrre perler, nøye overføre nedbryting bruker en pipette tilsvarende fordelt av Ab-perle komplekse plate holdt på isen og bland forsiktig 15 ganger av pipettering opp og ned. Seal platen med en aluminium plate cover og ruge over natten (12-18 h) på 4 ° C på en roterende plattform. Nytt merke platen "IP reaksjon".

3. dag 2: ndCHIP-seq

  1. Vasker og elueringsrør
    1. Angi oppvarming blandebatteri til 65 ° C. På is, forberede en lav-salt vaskebuffer og høy-salt vaskebuffer. Rask spinn IP reaksjon platen fra trinn 2.4.3 for 10 s 200 x g.
    2. Plasser IP reaksjon platen på en plate magnet og vente 15 s for løsningen å bli klare. Bruker en flerkanals pipette, uten å forstyrre perler, nøye fjerne og kast nedbryting. Ta platen av platen magneten og plassere den på is.
    3. I hver rad i eksempler i IP reaksjon platen, kan du legge til 150 µL av iskalde lav-salt vaske bufferen og bland sakte 10 ganger opp og ned for fullt resuspend perler.
    4. Plasser IP reaksjon platen tilbake på plate magneten, venter perler å skille, og bruker en flerkanals pipette, uten å forstyrre perler fjerne og slette nedbryting. Plasser platen tilbake på isen og gjenta 3.1.3 og 3.1.4 totalt 2 vasker.
    5. På is, i hver rad i eksempler på IP reaksjon plate, Legg 150 µL av høy salt vaske bufferen og bland sakte 10 ganger av pipettering opp og ned for fullt resuspend perler.
    6. Plasser IP reaksjon platen tilbake på plate magneten, venter perler å skille, og bruker en flerkanals pipette, uten å forstyrre perler fjerne og slette nedbryting. Plasser IP reaksjon platen på is og chill før en ny 96-brønns plate ved siden av.
    7. I hver rad i eksempler i IP reaksjon platen, kan du legge til 150 µL av høy salt vaske bufferen og bland langsomt 10 ganger av pipettering opp og ned for fullt resuspend perler. Etter rørets, overføre hver rad av prøver til den tilsvarende raden av nye, pre kjølt, 96-brønns plate. Etiketten platen "IP reaksjon". Kast gamle platen.
    8. Plasser den nye IP reaksjon platen på plate magneten og venter perler å skille. Bruker en flerkanals pipette, uten å forstyrre perler, nøye fjerne og kast nedbryting. Holde platen ved romtemperatur.
    9. I hver rad i eksempler i IP reaksjon plate, Legg 30 µL av ChIP elueringsbufferen (EB) og bland sakte 10 ganger av pipettering opp og ned. Pass på å hindre boble formasjon.
    10. Seal platen godt med en PCR cover og ruge i en oppvarming mikser på 65 ° C for 1,5 t med en blande hastighet på 1350 rpm.
    11. Etter 1,5 t inkubasjon Nedspinning IP reaksjon platen på 200 x g for 1 min på 4 ° C. Endre innstillingen for oppvarming blandebatteri til 50 ° C.
    12. Etter spinn, plassere IP reaksjon platen på en plate magnet og vente på løsningen å fjerne. Bruker en flerkanals pipette, uten å forstyrre perler, nøye overføre 30 µL nedbryting av til en ny 96-brønns plate. Bruk ferske tips for hver rad. Merk platen "IP reaksjon", og holde det ved romtemperatur.
  2. Protein fordøyelse
    1. Hente 30% PEG/1 M NaCl magnetiske perle17 (buffer komposisjon tabell) løsning fra 4 ° C kjøleskap og holde det ved romtemperatur for minst 30 min. kritisk: sikre at perle løsningen fullt når romtemperatur før du fortsetter.
    2. Hente inn kontroll prøver fra 4 ° C lagring (trinn 2.3.2) og rask spinn. Måler volum ved å bruke en pipette og legge ultrapure vann til hver input kontroll for et siste bind med 30 µL. overføre input kontroll eksemplene forhåndsvalgt input fordelt (tom wells) i IP reaksjon platen (trinn 3.1.12). Registrere brønnen prøve nøkkel.
    3. Klargjør Protein fordøyelse Master blandingen på is, som vist i tabell 5 og aliquot like volum i én rad med en 96-brønns reservoaret plate.
    4. Bruker en flerkanals pipette, i hver rad i eksempler på IP reaksjon plate, Legg 40 µL av Protein fordøyelse Master blandingen og bland sakte 10 ganger opp og ned. Forsegle platen godt med en PCR cover Nedspinning 200 x g for 1 min og ruge i en oppvarming blandebatteri ved 50 ° C i 30 min satt på 650 rpm. Mens platen er incubating, forberede frisk 70% etanol (EtOH) og holde det ved romtemperatur.
    5. Etter 30 min incubation er fullført, spin IP reaksjon platen på 200 x g for 1 min, 4 ° C. Holde platen ved romtemperatur.
      Merk: Det totale volumet bør være nå ~ 70 µL/godt.
  3. Perle oppryddingen bruker 30% PEG/1 M NaCl magnetiske perle løsning
    1. Aliquot på romtemperatur 30% av PEG/1 M NaCl magnetiske perle løsning i én rad med en ren 96-brønns reservoaret plate (75 µL per prøve x antall rader).
    2. Arbeider i romtemperatur, bruker en flerkanals pipette, Legg 70 µL (1:1 ratio) av 30% PEG/1 M NaCl magnetiske perle løsningen i hver rad i eksempler i IP reaksjon platen og bland 10 ganger av pipettering opp og ned. Endre tips mellom rader. Inkuber platen i 15 min ved romtemperatur.
    3. Plasser platen på plate magneten og ruge i 5 min å tillate perler å skille.
    4. Bruker en pipette, uten å forstyrre perler, nøye fjerne og kast nedbryting. Holde perler.
    5. Mens IP reaksjon platen er fortsatt på plate magneten, bruker en flerkanals pipette, i hver rad i prøvene, legge til 150 µL av romtemperatur 70% EtOH og Inkuber for 30 s. Etter 30 s, med en flerkanals pipette, fjerne og slette nedbryting. Gjenta dette trinnet en gang totalt 2 vasker.
    6. Etter andre EtOH vask, ruge plate magneten "tørre" plate for 3 min. visuelt inspisere plate å sørge for at alle EtOH er fordampet. Hvis ikke, ruge platen i 1 over tørking perler resultatene i en lavere avkastning.
    7. Ta platen av platen magneten og bruker en flerkanals pipette, legge til 35 µL EB (Tabell for materiale). Bland godt av pipettering 10 ganger opp og ned. Endre tips mellom rader. Inkuber ved romtemperatur for 3 min til elute.
    8. Etter inkubasjon plasser IP reaksjon platen tilbake på plate magneten og ruge i 2 minutter. Perlene skal skille og løsningen vil bli klart.
    9. Bruker en flerkanals pipette, uten å forstyrre perler, nøye overføre nedbryting til tilsvarende brønnene av en ny 96-brønns plate.
    10. Forsegle platen med en aluminium plate cover, etiketten "IPed + Input DNA" og lagre på 4 ° C over natten, eller på 20 ° C lang sikt (> 48t) lagring.

4. dag 3: Biblioteket konstruksjon

  1. Slutten reparasjon og fosforylering
    1. For enden reparasjon/fosforylering reaksjonen er IPed + Input plate fra trinn 3.3.10. Etter tining, Nedspinning platen på 200 x g for 1 min på 4 ° C og holde det på is.
    2. Hente fra 20 ° C fryser alle reagenser (unntatt enzymer) kreves for slutten reparasjon/fosforylering reaksjonen (tabell 6) og tiner dem ved romtemperatur, og deretter øyeblikkelig overføre til is.
    3. Arbeider på is, følg tabell 6 for å definere slutten reparasjon/fosforylering Master Mix i et sterilt, 1,5 mL microcentrifuge rør. Etter tillegg av alle ikke-enzymet komponenter, bland godt puls-vortexing og sett røret tilbake på isen.
    4. Hente de relevante enzymene fra kald oppbevaring og transport til benken i en kjølt tube kule rack. Bland hver enzym ved å sveipe rør, rask spinn, og sett den tilbake i kjølt tube kule stativet. Når pipettering enzymet, Sug opp sakte for å sikre en nøyaktig volum overføring. Tillegg, vaskes spissen i master blanding av pipettering opp og ned.
    5. Når enzymer er lagt, tilbake forsiktig puls-vortex master blande 5 ganger å sikre en jevn distribusjon av alle komponenter, og rask spinn og umiddelbart sett røret på isen.
    6. På is, aliquot en passende mengde slutten reparasjon/fosforylering Master Mix i én rad med en ny 96-brønns reservoaret plate; volum som skal aliquoted: (15 µL x antall rader) + 5 µL døde volum. En eksempel beregning for to rader: (15 µL x 2) + 5 µL = 35 µL/godt.
    7. Bruker en flerkanals pipette, Legg 15 µL av slutten reparasjon/fosforylering Master Mix i hver rad av prøver og bland 10 ganger av pipettering opp og ned. Endre tips mellom rader. Forsegle platen med et plastdeksel Nedspinning 200 x g for 1 min på 4 ° C og ruge ved romtemperatur for 30 min.
  2. Perle rydde opp etter slutten reparasjon og fosforylering
    1. 4 ° C kjøleskapet, hente 20% PEG/1 M NaCl magnetiske perle løsning og 30% PEG/1 M NaCl løsning og ruge ved romtemperatur for minst 30 min.
      Merk: 30% PEG/1 M NaCl løsningen ikke inneholde magnetiske perler.
    2. Når begge løsninger når romtemperatur, for hvert utvalg forberede 80 µL av 1:2 blanding av 30% PEG/1 M NaCl og 20% PEG/1 M NaCl magnetiske perle løsninger. Et eksempel på 24 eksempler: 80 µL x 24 = 1,920 µL (640 µL av 30% PEG/1 M NaCl og 1,288 µL av 20% PEG/1 M NaCl magnetiske perle løsninger).
    3. Aliquot perle løsningen bland, like volum, i én rad med en 96-brønns reservoaret plate og holde det ved romtemperatur. Aliquot EB buffer (40 µL per prøve x antall rader) i én rad med en ren 96-brønns reservoaret plate. Et eksempel på to rader: 40 µL x 2 = 80 µL/godt.
    4. Bruker en flerkanals pipette, legge til 75 µL av perle blandingen i trinn 4.2.2 i hver rad av prøver fra trinn 4.1.7 og bland opp og ned 10 ganger. Endre tips mellom rader. Inkuber ved romtemperatur i 15 min. Fortsett med perle opprydding prosedyren som beskrevet i trinn 3.3.3-3.3.10. Dekk platen med en plast sel, rask spinn og plassere den på is. Fortsett med trinn 4.3.
  3. A Tailing reaksjon
    1. Hente fra 20 ° C fryseren alle reagenser (unntatt enzymer) kreves for A Tailing reaksjonen (Tabell 7), tine dem ved romtemperatur og øyeblikkelig overføre til is.
    2. Arbeider på is, følg Tabell 7 sette opp A Tailing Master Mix i et sterilt, 1,5 mL microcentrifuge rør. Følg installasjonsveiledningen generelle enzymatisk brygg som beskrevet i trinn 4.1.4-4.1.6.
    3. Bruker en flerkanals pipette, Legg 15 µL av A Tailing Master blandingen i hver rad av prøver og bland 10 ganger av pipettering opp og ned. Endre tips mellom rader. Forsegle platen med en PCR cover Nedspinning 200 x g for 1 min på 4 ° C og ruge i en thermocycler på 37 ° C i 30 min. Etter inkubasjon, Nedspinning platen på 200 x g for 1 min og holde det ved romtemperatur.
  4. Perle rydde opp etter A Tailing
    1. Utfør trinnene beskrevet i trinn 4.2. Dekk platen med en plast sel, etikett "A-tail + BC", rask spinn, og plassere den på is. Fortsett med trinn 4.5.
  5. Adapter hemorroider
    1. Hente fra 20 ° C fryseren alle reagenser (unntatt enzymer) kreves for kortet ligation reaksjonen (tabell 8), tine dem ved romtemperatur og øyeblikkelig overføre til is.
    2. Hente 10 µM PE kortet (ekstra tabell 1) lagerløsning og fortynne til 0,5 µM ved hjelp av EB. Bland godt puls vortexing. Volumet kreves er 3 µL x antall eksempler. Arbeider på is, aliquot 0,5 µM PE kortet, like volum, i 12 brønner på en ren 96-brønns reservoaret plate. Hold det på is.
    3. Arbeider på is, følg tabell 8 å konfigurere kortet Ligation Master Mix i et sterilt, 1,5 mL microcentrifuge rør. Følg installasjonsveiledningen generelle enzymatisk brygg som beskrevet i trinn 4.1.4-4.1.6. Kontroller at 5 X rask Ligation Buffer er fullt tinte og godt blandet før bruk.
    4. På is, aliquot en passende mengde Adapter Ligation Master Mix i én rad med en ny 96-brønns reservoaret plate. For eksempel beregning for to rader: (23 µL x 2) + 5 µL = 51 µL/godt. Holde platen på is.
    5. Bruke en flerkanals pipette, legge til 2 µL på 0,5 µM sammen slutten (PE) kortet i hver rad med prøver fra trinn 4.4.1 og bland. Endre tips mellom rader.
    6. Bruker en flerkanals pipette, Legg 23 µL av kortet Ligation Master Mix i hver rad av prøver og bland 15 ganger av pipettering opp og ned. Endre tips mellom rader. Seal platen med et metall cover, etiketten "Hemorroider", Nedspinning 200 x g for 1 min på 4 ° C, og ruge ved romtemperatur over natten.
  6. Dag 4: Perle oppryddingen #1 etter kort hemorroider
    1. 4 ° C kjøleskapet, hente 20% PEG/1 M NaCl magnetiske perle løsningen og ruge ved romtemperatur for minst 30 min. Mens løsningen er equilibrating forberede frisk 70% EtOH.
    2. Aliquot 20% PEG/1 M NaCl magnetiske perle løsningen, 55 µL per prøve, i én rad med en 96-brønns reservoaret plate og holde det ved romtemperatur. Et eksempel på to rader: 55 µL x 2 = 110 µL/godt.
    3. Aliquot EB buffer, 50 µL per prøve, i én rad med en ren 96-brønns reservoaret plate. Et eksempel på to rader: 50 µL x 2 = 100 µL/godt.
    4. Bruker en flerkanals pipette, Legg 48 µL av 20% PEG/1 M NaCl magnetiske perle løsningen i hver rad av prøver i Ligation platen fra trinn 4.5.6 og bland opp og ned 10 ganger. Endre tips mellom rader. Inkuber ved romtemperatur i 15 min. Fortsett med perle opprydding prosedyren som beskrevet i trinn 3.3.3-3.3.7.
    5. Ta platen av platen magneten og bruker en flerkanals pipette, legge til 45 µL EB (Tabell for materiale). Bland godt av pipettering 10 ganger opp og ned. Endre tips mellom rader. Inkuber ved romtemperatur for 3 min til elute.
    6. Etter inkubasjon sted IP reaksjon platen tilbake på plate magneten og ruge for 2 min. med en flerkanals pipette, uten å forstyrre perler, nøye overføre nedbryting til tilsvarende brønnene av en ny 96-brønns plate. Etiketten platen "Ligation + 1 BC".
    7. Hver brønn Legg 5 µL 10 x PCR Hi-Fi bufferen og bland godt pipettering opp og ned. Endre tips mellom rader. Dekk platen med en plast sel, rask spinn, og holde det ved romtemperatur.
  7. Perle rydde opp #2 etter kort hemorroider
    1. Utføre perle oppryddingen som beskrevet i delen 4.6 med følgende endringer: legge til 60 µL av 20% PEG/1 M NaCl magnetiske perle løsning hver aktive brønn i Ligation + 1 BC plate (trinn 4.6.7) og elute fra perler med 35 µL EB bufferen. Merk platen "Ligation + 2 BC" og holde det på is.
  8. PCR forsterkning
    1. Hente fra 20 ° C fryseren alle reagenser (unntatt enzymer) kreves for PCR reaksjonen (tabell 9), tine dem ved romtemperatur deretter umiddelbart plassere dem på isen.
    2. Arbeider på is, følg tabell 9 for å sette opp PCR Master Mix i et sterilt, 1,5 mL microcentrifuge rør. Følg de generelle brygge Oppsett instruksjonene som beskrevet i trinn 4.1.4-4.1.5. På is, aliquot en passende mengde PCR Master Mix i én rad med en ny 96-brønns reservoaret plate. Hold det på is. Se trinn 4.5.4 for eksempel beregninger.
    3. Arbeider på is, med en flerkanals pipette, Legg 2 µL av hver unike 12.5 µM PCR omvendt indeksering primer (ekstra tabell 2) i hver brønn i Ligation + 2 BC plate (trinn 4.7.1) og bland langsomt opp og ned. Endre tips mellom rader. Holde platen på is.
    4. Arbeider på is, med en flerkanals pipette, legge til 23 µL av PCR master blandingen i hver rad av prøver fra trinn 4.8.3 og bland 10 ganger av pipettering opp og ned. Forsegle platen med en PCR cover Nedspinning 200 x g for 1 min og ruge i en thermocycler (se Tabell 10 for PCR sykling forhold).
  9. Perle rydde opp etter PCR forsterkning
    1. Etter PCR forsterkning spinne platen på 200 x g for 1 min, 4 ° C. Utføre perle oppryddingen som beskrevet i delen 4.6 med følgende endringer: Legg 51 µL av 20% PEG/1 M NaCl magnetiske perle løsning til hver PCR reaksjon og elute fra perler med 25 µL EB bufferen. Seal platen med en aluminium dekke og spinne ned 200 x g for 1 min. Store eksemplene på 20 ° C.
    2. For å validere konstruert biblioteker, utføre DNA kvantifisering bruker en fluorescens-baserte analysen, visualisere det endelige produktet med en chip-baserte kapillært geleelektroforese analyzer (høy følsomhet analysen) og kjøre berikelse kvantitative PCR (qPCR) (se Representant resultater, validering av ndChIP-seq biblioteket kvalitet av qPCR).

Representative Results

Chromatin fordøyelsen profiler
Optimalisering av MNase fordøyelsen er avgjørende for suksessen til denne protokollen. Det er avgjørende for å generere en fordøyelsen profil dominert av én nucleosome fragment størrelser, mens ikke over fordøyd, å tillate for utvinning av høyere orden nucleosome. En ideell fordøyelsen profil består av et flertall av enkelt nucleosome med en liten brøkdel representerer fragmenter mindre og større enn én nucleosomes. Figur 1 viser eksempler på en ideell, over fordøyd og under-fordøyd størrelse distribusjon profiler. Merk at sub optimal fordøyelse av chromatin vil også bli synlig i profilen til sekvensering biblioteket generert fra IP materialet (figur 2).

Validering av ndChIP-seq biblioteket kvalitet av qPCR
qPCR er en etablert metode for vurdering av kvaliteten på ChIP18,19,20. Når utfører ndChIP-seq på 10 000 celler avkastningen av nukleinsyre etter IP vil være under 1 ng. Derfor er det nødvendig å utføre qPCR etter bibliotek å vurdere relativ anriking av Målrett mot regioner over bakgrunnen. For å gi en bakgrunn anslag, genereres biblioteker konstruert fra MNase fordøyd chromatin (inngang). For hver IP-bibliotek, er to sett med primere nødvendig (se Supplementaltabell 3 for en liste over primere for vanligvis anvendt histone merker). En primer sett bør være spesifikke for en genomisk region som er konsekvent knyttet histone endring av interesse (positiv mål) og et annet område som ikke er merket med histone endring av interesse (negativ mål). Kvaliteten på ChIP-seq biblioteket vil bli vurdert som brett berikelse forhold til inndatabiblioteket. Fold berikelse kan beregnes ved hjelp av følgende ligning som forutsetter eksponentiell forsterkning av genomisk målregion: 2Ctinput-CtIP. Våre custom laget R statistisk programvarepakke, qcQpcr_v1.2, er egnet for qPCR berikelse analyse av lav input innfødt ChIP-seq biblioteker (Kode tilleggsfiler). Figur 3 representerer et qPCR resultat for vellykkede og mislykkede ChIP-seq-biblioteker. Minste forventet fold berikelse verdien for god ndChIP-seq biblioteker er 16 for smale merker, for eksempel H3K4me3 og 7 for bred merker, for eksempel H3K27me3.

Modellering MNase tilgjengelighet
Beregningsorientert analyse av ChIP-seq er komplekse og unike for hver eksperimentelle innstilling. Et sett med retningslinjer etablert av International Human Epigenomic Consortium (IHEC) og The Encyclopedia av DNA elementer (kode) kan brukes til å vurdere kvaliteten på ChIP-seq biblioteker21. Det er viktig å merke seg at sekvensering dybden av bibliotekene påvirker gjenkjenning og oppløsning av beriket regioner20. Antall topper oppdaget økning og nærmer seg et platå som Les dybde øker. Vi anbefaler ndChIP-seq biblioteker som ble sekvensert i samsvar med IHEC anbefalinger fra 50 millioner sammen-leser (25 millioner fragmenter) for smale merker (f.eksH3K4me3) og 100 millioner sammen-leser (50 millioner fragmenter) for bred merker ( f.eks, H3K27me3) og22. Disse sekvensering dypet gir tilstrekkelig sekvens justeringer for påvisning av de viktigste toppene bruker mye brukt ChIP-seq peak innringere, som MACS2 og HOMER, uten å nå metning23,24. En høy kvalitet pattedyr ndChIP-seq biblioteket har en like PCR-sats på < 10% og referanse genomet justering rate > 90% (inkludert duplisert leser). Vellykket ndChIP-seq biblioteker inneholder høyt korrelert gjentak med en betydelig del (> 40%) av justert leser i MACS222 identifisert beriket topper og inspeksjon av justert i en genome nettleseren skal avsløre visuelt synlig enrichments forhold til inndatabiblioteket (Figur 4). I tillegg ndChIP-seq kan brukes til å vurdere nucleosome tetthet ved å benytte en Gaussian blanding distribusjon algoritme (m1 * n(x; Μ 1,σ1) + w2 * n(x; μ2, σ2) = 1) på MACS2 identifisert beriket regioner modell nucleosome tetthet som definert av MNase tilgjengelig grenser. I denne modellen, w1 representerer mono-nucleosome distribusjon vekt og w2 representerer di-nucleosome distribusjon vekt. Hvor w1 er større enn w2, er det dominans av mono-nucleosome og omvendt. Denne analysen krever at biblioteker ble sekvensert i en sammenkoblet-end måte slik at fragment størrelser kan defineres. Vil bruke Gaussian blanding distribusjon algoritmen, identifiseres først statistisk signifikant beriket regioner. Vi foreslår at peak yrke med MACS2 bruker Input som en kontroll og med standardinnstillinger for smale merker og en q verdien cutoff av 0,01 for bred merker. En rekke statistiske pakker ansette en Gaussian blanding distribusjon algoritme er tilgjengelige fra brukte statistiske programvarepakker. Utnytte gjennomsnittlig fragment størrelse, bestemmes av par-end Les grensene for de IPed prøvene, distribusjoner på MACS2 identifisert beriket arrangører, og en Gaussian blanding distribusjon algoritme kan brukes for hver arrangøren bruke R-statistikkpakke Mclust versjon 3.025 til å beregne et vektet distribusjon. I dette programmet anbefaler vi å eliminere arrangører som inneholder mindre enn 30 justert fragmenter fordi under denne terskelen vekten anslag blir upålitelige. En god ndChIP-seq biblioteket genererer en Gaussian blanding distribusjon som består av to hovedkomponenter med mener verdier tilsvarer mono-, di-nucleosome fragment lengder.

Figure 1
Figur 1 : Vurdering av MNase fordøyelsen før biblioteket generasjon. Chip-baserte kapillært geleelektroforese analyzer profiler av en optimal MNase fordøyd (A), under-fordøyd (B) og over fordøyd (C) chromatin. Biologiske gjentak vises som blå, røde og grønne spor. Klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2 : Vurdering av MNase fordøyelsen etter biblioteket generasjon. (A) legge biblioteket bygging profiler optimalt fordøyd inngang (biologiske gjentak, rød, grønn, svart) og IP (biologiske gjentak; cyan, lilla, blå) og (B) sub-optimal inngang (biologiske gjentak, rød, grønn, blå) og IP ( biologiske gjentak; cyan, lilla, oransje) bibliotekene. Klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3 : Legge biblioteket bygging kvantitative PCR kan brukes til å vurdere kvaliteten på ndChIP-seq biblioteker. Fold anriking av H3K4me3 IP biblioteker forhold til input biblioteker beregnes som 2(Ct av input - Ct IP) for positive og negative mål ved hjelp av qcQpcr_v1.2. Klikk her for å se en større versjon av dette tallet.

Figure 4
Figur 4 : Representative ndChIP-seq biblioteket bygget fra 10.000 primære CD34+ ledningen blod celler. Pearson sammenheng H3K4me3 signal (leser per million tilordnet leser) beregnet i arrangører (TSS +/-2Kb) mellom 3 biologiske gjentak, (A) kopiere 1 og 2, (B) replikere 1 og 3, (C) kopiere 2 og 3. (D) UCSC leservisningen av HOXA genet klyngen av krysskoblet ChIP-seq generert fra 1 millioner celler per IP, vellykket ndChIP-seq fra 10.000 celler per IP og mislykket ndChIP-seq fra 10.000 celler per IP. (rød: H3K27me3, grønn: H3K4me3, og svart: inngang). (E) brøkdel av tilordnede innen MACS2 identifisert beriket regioner i H3K4me3 (svart) og H3K27me3 (grå). Klikk her for å se en større versjon av dette tallet.

Buffer sammensetning
A.1. Immunoprecipitation buffer (IP)
20 mM Tris-HCl pH 7.5
2 mM EDTA
150 mM NaCl
0,1% Triton X-100
0,1% Deoxycholate
10 mM natrium Butyrate
A.2. lav Salt vaskebuffer
20 mM Tris-HCl pH 8.0
2 mM EDTA
150 mM NaCl
1% Triton X-100
0,1% SDS
A.3. høy Salt vaskebuffer
20 mM Tris-HCl pH 8.0
2 mM EDTA
500 mM NaCl
1% Triton X-100
0,1% SDS
ChIP elueringsrør buffer A.4.
100 mM NaHCO3
1% SDS
A.5. 1 x lyseringsbuffer-1 mL
0,1% Triton
0,1% Deoxycholate
10 mM natrium Butyrate
A.6. Ab fortynning buffer
0,05% (w/v) Azide
0,05% bredt spekter antimikrobielle (f.eks ProClin 300)
i PBS
A.7. 30% PEG / 1M NaCl magnetiske perle løsning (referanse16)
30% PINNE
1 M NaCl
10 mM Tris HCl pH 7.5
1 mM EDTA
1 mL av vasket super spinn perler
A.8. 20% PEG / 1M NaCl magnetiske perle løsning (referanse16)
30% PINNE
1 M NaCl
10 mM Tris HCl pH 7.5
1 mM EDTA
1 mL av vasket super spinn perler

Tabell 1: ndChIP-seq buffer komposisjon.

Histone modifikasjon Konsentrasjon (µg/µL)
H3K4me3 0.125
H3K4me1 0,25
H3K27me3 0.125
H3K9me3 0.125
H3K36me3 0.125
H3K27ac 0.125

Tabell 2: Antistoff beløpet som kreves for ndChIP-seq.

Reganet Volum (µL)
Ultra ren vann 478
1 M Tris-HCl pH 7.5 10
0,5 M EDTA 10
5 M NaCl 2
Glyserol 500
Totalt volum 1000

Tabell 3: Oppskrift på MNase fortynning buffer.

Reagens Volum (µL)
Ultra ren vann 13
20 mM DTT 1
10 x MNase Buffer 4
20 U/µl Mnase 2
Totalt volum 20

Tabell 4: Oppskrift på MNase Master Mix.

Reagens Volum (µL)
Elueringsbufferen 30
Buffer G2 8
Protease 2
Totalt volum 40

Tabell 5: Oppskrift på DNA rensing Master Mix.

Reagens Volum (µL)
Ultra ren vann 3.3
10 x begrensning Endonuclease Buffer (f.eks NEBuffer) 5
25 mM ATP 2
10 mM dNTPs 2
T4 Polynucleotide Kinase (10 U/µl) 1
T4 DNA utvalg (3 U/µl) 1.5
DNA polymerase jeg, stor (Klenow) Fragment (5 U/µl) 0,2
Totalt volum 15

Tabell 6: Oppskrift på slutten reparasjon Master Mix.

Reagens Volum (µL)
Ultra ren vann 8
10 x begrensning Endonuclease Buffer (f.eks NEBuffer) 5
10 mM dATP 1
Klenow (3 - 5' exo-) 1
Totalt volum 15

Tabell 7: Oppskrift på en Tailing Master Mix.

Reagens Volum (µL)
Ultra ren vann 4.3
5 x rask ligation buffer 12
T4 DNA ligase (2000 U/µl) 6.7
Totalt volum 23

Tabell 8: Oppskrift på kortet Ligation Master Mix.

Reagens Volum (µL)
Ultra ren vann 7
25 uM PCR primer 1.0 2
5 x HF buffer 12
DMSO 1.5
DNA Polymerase 0,5
Totalt volum 23

Tabell 9: Oppskrift på PCR Master Mix.

Temperaturen (° C) Varighet (s) Antall sykluser
98 60 1
98 30
65 15 10
72 15
72 300 1
4 Hold Hold

Tabell 10: PCR Kjør-metoden.

Oligo Sekvens Modifisering
PE_adapter 1 5'-/ 5Phos/GAT CGG AAG AGC GGT TCA GCA GGA ATG CCG AG -3 " 5 modifikasjon: fosforylering
PE_adapter 2 5' - ACA CTC TTT CCC TAC ACG ACG CTC TTC CGA TC * T - 3 3' modifikasjon: * T er en phosphorothioate bånd

Supplerende tabell 1: Oligo sekvenser for generering av PE-kortet.

Primer navn Sekvens Indeks IndexRevC (som skal brukes for sekvensering)
PCR omvendt indeksering primer 1 CAAGCAGAAGACGGCATACGAGATCGTGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CGTGAT atcacg
PCR omvendt indeksering primer 2 CAAGCAGAAGACGGCATACGAGATCTGATCCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CTGATC gatcag
PCR omvendt indeksering primer 3 CAAGCAGAAGACGGCATACGAGATGGGGTTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GGGGTT aacccc
PCR omvendt indeksering primer 4 CAAGCAGAAGACGGCATACGAGATCTGGGTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CTGGGT acccag
PCR omvendt indeksering primer 5 CAAGCAGAAGACGGCATACGAGATAGCGCTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AGCGCT agcgct
PCR omvendt indeksering primer 6 CAAGCAGAAGACGGCATACGAGATCTTTTGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CTTTTG caaaag
PCR omvendt indeksering primer 7 CAAGCAGAAGACGGCATACGAGATTGTTGGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT TGTTGG ccaaca
PCR omvendt indeksering primer 8 CAAGCAGAAGACGGCATACGAGATAGCTAGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AGCTAG ctagct
PCR omvendt indeksering primer 9 CAAGCAGAAGACGGCATACGAGATAGCATCCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AGCATC gatgct
PCR omvendt indeksering primer 10 CAAGCAGAAGACGGCATACGAGATCGATTACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CGATTA taatcg
PCR omvendt indeksering primer 11 CAAGCAGAAGACGGCATACGAGATCATTCACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CATTCA tgaatg
PCR omvendt indeksering primer 12 CAAGCAGAAGACGGCATACGAGATGGAACTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GGAACT agttcc
PCR omvendt indeksering primer 13 CAAGCAGAAGACGGCATACGAGATACATCGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT ACATCG cgatgt
PCR omvendt indeksering primer 14 CAAGCAGAAGACGGCATACGAGATAAGCTACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AAGCTA tagctt
PCR omvendt indeksering primer 15 CAAGCAGAAGACGGCATACGAGATCAAGTTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CAAGTT aacttg
PCR omvendt indeksering primer 16 CAAGCAGAAGACGGCATACGAGATGCCGGTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GCCGGT accggc
PCR omvendt indeksering primer 17 CAAGCAGAAGACGGCATACGAGATCGGCCTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CGGCCT aggccg
PCR omvendt indeksering primer 18 CAAGCAGAAGACGGCATACGAGATTAGTTGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT TAGTTG caacta
PCR omvendt indeksering primer 19 CAAGCAGAAGACGGCATACGAGATGCGTGGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GCGTGG ccacgc
PCR omvendt indeksering primer 20 CAAGCAGAAGACGGCATACGAGATGTATAGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GTATAG ctatac
PCR omvendt indeksering primer (21) CAAGCAGAAGACGGCATACGAGATCCTTGCCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CCTTGC gcaagg
PCR omvendt indeksering primer 22 CAAGCAGAAGACGGCATACGAGATGCTGTACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GCTGTA tacagc
PCR omvendt indeksering primer 23 CAAGCAGAAGACGGCATACGAGATATGGCACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT ATGGCA tgccat
PCR omvendt indeksering primer 24 CAAGCAGAAGACGGCATACGAGATTGACATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT TGACAT atgtca

Supplerende tabell 2: PCR omvendt indeksering primer sekvenser.

Primere Sekvens
ZNF333_genic_H3K9me3_F 5-AGCCTTCAATCAGCCATCATCCCT-3 "
ZNF333_genic_H3K9me3_R 5-TCTGGTATGGGTTCGCAGATGTGT-3 "
HOXA9-10_F 5-ACTGAAGTAATGAAGGCAGTGTCGT-3 "
HOXA9-10_R 5-GCAGCAYCAGAACTGGTCGGTG-3 "
GAPDH_genic_H3K36me3_F 5-AGGCAACTAGGATGGTGTGG-3 "
GAPDH_genic_H3K36me3_R 5-TTGATTTTGGAGGGATCTCG-3 "
GAPDH-F 5-TACTAGCGGTTTTACGGGCG-3 "
GAPDH-R 5-TCGAACAGGAGGAGCAGAGAGCGA-3 "
Histone modifikasjon Positiv mål Negativt mål
H3K4me3 GAPDH HOXA9-10
H3K4me1 GAPDH_genic ZNF333
H3K27me3 HOXA9-10 ZNF333
H3K27ac GAPDH ZNF333
H3K9me3 ZNF333 HOXA9-10
H3K36me3 GAPDH_genic ZNF333

Supplerende tabell 3: En liste over primere for vanligvis anvendt histone merker (H3K4me3, H3K4me1, H3K27me3, H3K27ac, H3K9me3 og H3K36me3).

Ekstra fil 1: ndChIP-seq regnearket. Klikk her for å laste ned denne filen.

Ekstra filer: qcQpcr_v1.2. R statistisk programvarepakke for qPCR berikelse analyse av lav input innfødt ChIP-seq biblioteker. Klikk her for å laste ned denne filen.

Discussion

Gitt kombinasjon natur chromatin endring og nucleosome plassering i transcriptional regulering, er en metode som gjør samtidige målinger av disse funksjonene sannsynlig å gi ny innsikt i epigenetic regulering. NdChIP-seq protokollen presenteres her er en innfødt ChIP-seq protokollen optimert for å aktivere samtidig avhør av histone modifikasjon og nucleosome tetthet i sjeldne primære celler9,10. ndChIP-seq benytter enzymatisk fordøyelsen av chromatin som, når kombinert sammen-end massivt parallelle sekvenser og Gaussian blanding distribusjon modell, tillater undersøkelse histone endringene på én nucleosome nivå og deconvolution epigenomic profiler drevet av heterogenitet i en populasjon. Bruker denne protokollen, har vi tidligere rapportert en unik fordeling av immuno-igangsatte fragment størrelser, bestemmes av par-end lese grenser, forbundet med spesifikke chromatin stater definert av ChromHMM10,24.

Kvaliteten på et ndChIP-seq-bibliotek, avhenger av flere faktorer, som antistoff spesifisitet og følsomhet, optimale MNase fordøyelsen forhold og kvaliteten på chromatin. Spesifisitet av antistoffer brukes er avgjørende i å produsere vellykket ndChIP-seq-biblioteket. Et ideelt antistoff viser høy affinitet mot av interesse med liten kryssreaksjon med andre epitopes. Er det like viktig å velge magnetiske perler med det høyeste affinitet antistoffer valgfrihet.

MNase fordøyelsen er en kritisk og og konsentrasjon-tidskritisk reaksjon i denne protokollen. Derfor, ved behandling av flere eksempler, er det viktig at hver reaksjon er ruges i et tilsvarende periode (se trinn 2.2). Kvaliteten på chromatin er en annen faktor som betydelig effekter utfallet av ndChIP-seq. fragmentert chromatin fører til en sub-optimale MNase fordøyelsen profil og resultater i biblioteker med et svakt signal til støyforhold. Primære prøvene med lav celle levedyktighet eller degradert chromatin, som formalin-fast parafin-embedded (FFPE) vev ikke anbefales for denne protokollen.

Tillegg av et bilde under chromatin utvinning reduserer uønsket (dvs., tilfeldige) chromatin fragmentering og bevarer integriteten til histone haler. Som sådan, må bilde legges til lysis buffer og immunoprecipitation buffer bare tidligere å bruke. Mens velge celler via flowcytometri, Velg for levedyktige cellers og sikre er celler sortert på en lav flow rate å øke nøyaktigheten av celle nummer anslaget og levedyktigheten til cellene. Unngå sortering celler direkte i lyseringsbuffer. Skjede bufferen vil utvanne lyseringsbuffer og forhindrer effektiv permeabilization i cellemembranen til MNase. Avhengig av typen celler eller organisme, kan titrering av MNase være nødvendig å få optimal fordøyelse.

ndChIP-seq på pattedyrceller krever en minimum sekvensering dybde på 50 millioner sammen-leser (25 millioner fragmenter) for smale merker og 100 millioner sammen-leser (50 millioner fragmenter) for bred merker og innspill. Gaussian blanding distribusjon algoritmen fungerer ikke optimalt på biblioteker som har blitt sekvensert til et dyp betydelig under denne anbefalingen. ndChIP-seq ville ikke inndele arrangører med litt separasjon mellom vektet distribusjon verdien for mono - og di-nucleosome fragment lengder i mono - eller di-nucleosome dominerte arrangører. Disse arrangører må derfor fjernes i påfølgende analyse. Biologiske gjentak kan genereres for å øke tilliten spådde distribusjonene og identifisere tekniske variasjon i MNase fordøyelsen og biblioteket konstruksjonen.

I motsetning til tidligere iterasjoner av innfødte ChIP-seq-protokoller gir ndChIP-seq midler til å undersøke kombinasjon effekten av chromatin struktur og histone endring ved å benytte fragment størrelse innlegget immunoprecipitation å integrere nucleosome tetthet, avhengig av MNase tilgjengelighet, med histone endring mål. Bruk av ndChIP-seq til primære celler og vev vil gi romanen innsikt i integrerende typen epigenetic regulering og tillate identifikasjon av epigenetic signaturer på grunn av heterogenitet i befolkningen.

Disclosures

Forfatterne erklærer at de har ingen konkurrerende økonomiske interesser.

Acknowledgements

Al ble støttet av kanadiske Graduate stipend fra Canadian institutter for helseforskning. Dette arbeidet ble støttet av tilskudd fra Genova British Columbia og den kanadiske institutter for helseforskning (CIHR-120589) som en del av den kanadiske Epigenetics, miljø og helse Consortium TFI og Terry Fox Research Institute Program Prosjektet Grant #TFF-122869 M.H. og en Terry Fox Research Institute nye etterforsker prisen (Grant # 1039) til M.H.

Materials

Name Company Catalog Number Comments
1M Tris-HCl –pH 7.5 Thermo Scientific 15567-027
1M Tris-HCl –pH 8 Thermo Scientific 15568-025
0.5M EDTA Thermo Scientific AM9260G
5M NaCl Sigma 1001385276
Triton X-100 Sigma 1001412354
Sodium-Deoxycholate Sigma 1001437582
SDS Thermo Scientific 15525-017
Sodium-Bicarbonate Fisher Scientific S233-500
100% EtOH NA NA
V-bottom 96 well plate (AB 1400) Thermo Scientific AB-1400-L
Gilson P2 pipetman Mandel F144801
Gilson P10 pipetman Mandel F144802
Gilson P20 pipetman Mandel F123600
Gilson P100 pipetman Mandel F123615
Gilson P200 pipetman Mandel F123601
Gilson P1000 pipetman Mandel F123603
Micrococcal Nuclease  NEB M0247S
Thermo Mixer C (Heating block mixer) Eppendorf 5382000023
Multi 12-channel Pippet P20 Rainin 17013803
Multi 12-channel Pippet P200 Rainin 17013805
1.5 ml LoBind tube Eppendorf 22431021
0.5 ml LoBind tube Eppendorf 22431005
Plastic Plate Cover Edge Bio 48461
PCR cover Bio Rad MSD-1001
Aluminum Plate Cover Bio Rad MSF-1001
Elution buffer (EB buffer) Qiagen 19086
1M DTT Sigma 646563
Eppendorf 5810R centrifuge  Eppendorf 22625004
Ultrapure water Thermo Scientific 10977-015
Protein G dynabeads Thermo Scientific 10001D
Protein A dynabeads Thermo Scientific 10001D
Protease inhibitor Cocktail Calbiochem 539134
Rotating platform Mandel 1b109-12052010
Plate magnet Alpaqua 2523
Domed 12-cap strip Bio Rad TCS1201
Buffer G2 Qiagen 1014636
Protease Qiagen 19155
Tube Magnet (DynaMag-2) Thermo Scientific 12321D
Tube Magnet (DynaMag-2) LabCore 730-006
V shape Plastic reservoir Mandel S0100A
Vortex Mandel C1801
Mini Fuge Mettler Toledo XS2035
Analytical scale Mandel LB109-12052010
Quick Ligation Reaction Buffer, 5X NEB B6058S
DNA Polymerase I, Large (Klenow) Fragment NEB M0210S
Klenow Fragment (3'-5' exo) NEB M0212S
T4 DNA Polymerase NEB M0203S
T4 Polynucleotide Kinase NEB M0201S
Deoxynucleotide Solution mix, 10mM NEB N0447S
dATP Solution 10mM NEB N0440S
Quick T4 DNA Ligase NEB M0202T
Adenosine 5'-Triphosphate (ATP), 25mM NEB P0756S
DNA Polymerase Thermo Scientific F549L
NEBuffer 2 NEB B7002S
Hank's buffered salt solution Thermo Scientific 14025076
Fetal bovine serum  Thermo Scientific A3160702
phosphate buffer saline  Thermo Scientific 10010023
H3K4me3 Cell Signaling 9751S
H3K4me1 Diagenode C15410037
H3K27me3 Diagenode pAb-069-050
H3K36me3 Abcam ab9050
H3K9me3 Diagenode C15410056
SeraMag  super-paramagnetic beads

DOWNLOAD MATERIALS LIST

References

  1. Simpson, R. T. Nucleosome Positioning: Occurrence, Mechanisms, and Functional Consequences. Prog. Nucleic Acid Res. Mol. Biol. 40, Issue C 143-184 (1991).
  2. Kornberg, R. D., Lorch, Y. Twenty-five years of the nucleosome, fundmamental particle of the eukaryotic chromosome. Cell. 98, 285-294 (1999).
  3. Schones, D. E., et al. Dynamic regulation of nucleosome positioning in the human genome. Cell. 132, (5), 887-898 (2008).
  4. Segal, E., et al. A genomic code for nucleosome positioning. Nature. 442, (7104), 772-778 (2006).
  5. Shiio, Y., Eisenman, R. N. Histone sumoylation is associated with transcriptional repression. PNAS. 100, (23), 13225-13230 (2003).
  6. Li, L., Lorzadeh, A., Hirst, M. Regulatory variation: An emerging vantage point for cancer biology. Wiley Interdiscip. Rev. Syst. Biol. Med. 6, (1), 37-59 (2014).
  7. Jiang, J., et al. Investigation of the acetylation mechanism by GCN5 histone acetyltransferase. PLoS ONE. 7, (5), (2012).
  8. Kouzarides, T. Histone methylation in transcriptional control. Curr. Opin. Genet. Dev. 12, (2), 198-209 (2002).
  9. Brind'Amour, J., Liu, S., Hudson, M., Chen, C., Karimi, M. M., Lorincz, M. C. An ultra-low-input native ChIP-seq protocol for genome-wide profiling of rare cell populations. Nat. Commun. 6, 6033 (2015).
  10. Lorzadeh, A., et al. Nucleosome Density ChIP-Seq Identifies Distinct Chromatin Modification Signatures Associated with MNase Accessibility. Cell Rep. 17, (8), 2112-2124 (2016).
  11. Noll, M., Kornberg, R. D. Action of micrococcal nuclease on chromatin and the location of histone H1. J. Mol. Biol. 109, (3), 393-404 (1977).
  12. Skene, P. J., Henikoff, S. A simple method for generating high-resolution maps of genome wide protein binding. eLife. 4, 09225 (2015).
  13. Brogaard, K., Xi, L., Wang, J. -P., Widom, J. A map of nucleosome positions in yeast at base-pair resolution. Nature. (2012).
  14. Cui, K., Zhao, K. Genome-wide approaches to determining nucleosome occupancy in metazoans using MNase-Seq. Methods Mol. Biol. 833, 413-419 (2012).
  15. Mieczkowski, J., et al. MNase titration reveals differences between nucleosome occupancy and chromatin accessibility. Nat. Commun. 7, 11485 (2016).
  16. Basu, S., Campbell, H. M., Dittel, B. N., Ray, A. Purification of Specific Cell Population by Fluorescence Activated Cell Sorting (FACS). JOVE. (41), (2010).
  17. Rohland, N., Reich, D. Cost-effective, high-throughput DNA sequencing libraries for multiplexed target capture. Genome Res. 22, (5), 939-946 (2012).
  18. Zheng, Y., Josefowicz, S. Z., Kas, A., Chu, T. T., Gavin, M. A., Rudensky, A. Y. Genome-wide analysis of Foxp3 target genes in developing and mature regulatory T cells. Nature. 445, (7130), 936-940 (2007).
  19. Krishnakumar, R., Gamble, M. J., Frizzell, K. M., Berrocal, J. G., Kininis, M., Kraus, W. L. Reciprocal Binding of PARP-1 and Histone H1 at Promoters Specifies Transcriptional Outcomes. Science. 319, (5864), 819-821 (2008).
  20. Mendenhall, E. M., et al. Locus-specific editing of histone modifications at endogenous enhancers. Nat. Biotechnol. 31, (12), 1133-1136 (2013).
  21. Landt, S. G., et al. ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia. Genome Res. 22, (9), 1813-1831 (2012).
  22. Reference Epigenome Standards - IHEC. Available from: http://ihec-epigenomes.org/research/reference-epigenome-standards/ (2017).
  23. Heinz, S., et al. Simple Combinations of Lineage-Determining Transcription Factors Prime cis-Regulatory Elements Required for Macrophage and B Cell Identities. Mol. Cell. 38, (4), 576-589 (2010).
  24. Feng, J., Liu, T., Qin, B., Zhang, Y., Liu, X. S. Identifying ChIP-seq enrichment using MACS. Nat. Protoc. 7, (9), 1728-1740 (2012).
  25. Fraley, C., Raftery, A. E. MCLUST: Software for Model-Based Cluster Analysis. J. Classif. 16, (2), 297-306 (1999).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics