Generatie van inheemse chromatine Immunoprecipitation Sequencing bibliotheken nucleosoom dichtheid p.a.

Genetics
 

Summary

We presenteren een gemodificeerde inheemse chromatine immunoprecipitation sequencing (ChIP-seq) methodologie voor de generatie van reeks datasets geschikt voor een nucleosoom dichtheid ChIP-seq analytisch kader integreren toegankelijkheid micrococcal nuclease (MNase) met Histon wijziging metingen.

Cite this Article

Copy Citation | Download Citations

Lorzadeh, A., Lopez Gutierrez, R., Jackson, L., Moksa, M., Hirst, M. Generation of Native Chromatin Immunoprecipitation Sequencing Libraries for Nucleosome Density Analysis. J. Vis. Exp. (130), e56085, doi:10.3791/56085 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

We presenteren een gemodificeerde inheemse chromatine immunoprecipitation sequencing (ChIP-seq) experimentele protocol compatibel met een Gaussiaans mengsel distributie gebaseerd analyse methodologie (nucleosoom dichtheid ChIP-seq; ndChIP-seq) waarmee de generatie gecombineerde meting van Histon wijziging genoom-brede toegankelijkheid micrococcal nuclease (MNase). Nucleosoom positie en lokale dichtheid en de posttranslationele wijziging van hun Histon subeenheden, onderling overleg te regelen valt bestuurlijk gezien onder lokale transcriptie. Combinatorische metingen van nucleosoom toegankelijkheid met Histon wijziging gegenereerd door ndChIP-seq zorgt voor de gelijktijdige ondervraging van deze functies. De ndChIP-seq-methodologie is van toepassing op kleine aantallen van primaire cellen niet toegankelijk zijn voor de dwarsbinding gebaseerde ChIP-seq-protocollen. Tezamen, waardoor ndChIP-seq de meting van Histon wijziging in combinatie met lokale nucleosoom dichtheid te verkrijgen van nieuwe inzichten in gedeelde mechanismen die RNA transcriptie binnen zeldzame primaire cel populaties te regelen.

Introduction

De eukaryotische genoom is verpakt in chromatine via herhalende nucleosoom structuren, die bestaan uit twee exemplaren van vier Histon eiwitten (bijvoorbeeldH2A, H2B, H3 en H4) afgebakend door 146 basenparen van DNA1,2. Chromatine remodelleert complexen nucleosoom positie binnen de grenzen van de promotor van het gen bepalen en deel te nemen in de regulatie van de genexpressie door een wijziging van de toegankelijkheid van het DNA transcriptiefactoren en de RNA-polymerase machines3, 4.

Amino terminal staarten van histones binnen de nucleosoom zijn onderworpen aan verschillende covalente wijzigingen, met inbegrip van acetylation, methylering fosforylering, ubiquitylation, sumoylation, formylering en hydroxylatie van specifieke aminozuren5 , 6 , 7 , 8. posities en graden van deze wijzigingen vereisen een chromatine staat die invloed hebben op de structuur en controle toegang chromatine van de moleculaire complexen waarmee activering van transcriptie7. Gezien het feit dat beide nucleosoom dichtheid en Histon wijziging een rol spelen in het lokaal beheer van gene transcriptie, ontwikkelden we een inheemse ChIP aanpak waarmee de gelijktijdige meting van nucleosoom dichtheid en Histon wijziging9, 10.

Native ChIP-seq profiteert van de nuclease micrococci endonuclease (MNase) te verteren intact chromatine in zijn geboortestaat binnen de kern11,12, een eigenschap die heeft zijn leveraged om kaart nucleosoom positionering13 , 14 , 15. nucleosoom dichtheid ChIP-seq (ndChIP-seq) maakt gebruik van de eigenschap van preferentiële toegang voor MNase te openen van de regio's van de chromatine voor het genereren van de metingen die MNase toegankelijkheid met Histon wijziging10 combineren. ndChIP-seq is geschikt voor de profilering van Histon modificaties in zeldzame primaire cellen, weefsels en gekweekte cellen. Hier presenteren we een gedetailleerd protocol waarmee de generatie van reeks datasets geschikt voor een eerder beschreven analytische kader werk10 die fragment grootte post immunoprecipitation integreert, bepaald door gekoppeld-end grenzen, om te lezen Tegelijkertijd onderzoeken MNase toegankelijkheid met Histon wijziging metingen. Eerder, de toepassing van dit protocol op 10.000 primaire menselijke navelstrengbloed afgeleid CD34+ cellen en menselijke embryonale stamcellen geopenbaard unieke relaties tussen structuur en histone modificaties van chromatine binnen deze cel typen10 . Gezien de mogelijkheid om tegelijk meten nucleosoom toegankelijkheid en Histon wijziging, ndChIP-seq staat is onthullend epigenomic functies in een celpopulatie op niveau één nucleosoom, en oplossen van heterogene handtekeningen in hun bestanddelen. Een voorbeeld van de verkenning van heterogene cellulaire bevolking door ndChIP-seq is onderzoek van de initiatiefnemers van het tweewaardig, waar zowel H3K4me3, een actieve mark en H3K27me3, een repressieve merk, zijn huidige10.

Protocol

Opmerking: De minimale input voor dit protocol is 10.000 cellen per één immuno-neerslag (IP) reactie. De meegeleverde experimentele werkblad uitprinten en gebruiken als leidraad om uit het experiment te plannen. Incubations bij kamertemperatuur worden verondersteld te zijn van ~ 22 ° C. Alle van de recepten van de buffer zijn opgenomen in tabel 1. Alle van de buffers moet worden opgeslagen bij 4 ° C en gehouden op het ijs tijdens de procedure, tenzij anders vermeld.

1. cel voorbereiding

  1. Gekweekte cellen
    1. Spoel de cellen met 1 mL fosfaat buffer zoutoplossing (PBS), en nauwkeurig bepalen van de concentratie van de cel met behulp van een hemocytometer. Als er meer dan één miljoen cellen, Verhoog het volume van PBS.
    2. Gebaseerd op het aantal cellen, aliquoot een equivalent van 70.000 man-100.000 cellen in een steriele 1,5 mL tube, en spin down op 500 x g voor 6 min bij 4 ° C. Met behulp van een precisiepipet, langzaam verwijderen en verwijder het supernatant (zonder verstoring van de cel pellet) en resuspendeer de pellet in ijskoude lysis-buffermengsel + 1 x proteaseinhibitor cocktail (PIC) tot een concentratie van 1000 cellen / µL. Meng goed door pipetteren boven en beneden de 20-30 tijden. Het is essentieel dat de cel klontjes zijn verstoord. Probeer niet te maken van de bubbels.
    3. Ga direct naar dag 1 (sectie 2) van het ndChIP-seq-protocol of flash bevriezen de cel pellet in vloeibare stikstof en winkel bij-80 ° C.
  2. Gesorteerde cellen
    1. 70.000-100.000 gesorteerde16 cellen in een buis 1,5 mL met 350 µL van Henks gebufferde zoutoplossing (HBSS), of PBS + 2% foetale runderserum (FBS) verzamelen.
    2. Spin down elke cel aliquoot bij 500 x g gedurende 6 min bij 4 ° C. Met behulp van een precisiepipet, langzaam de bovendrijvende vloeistof verwijderen (zonder verstoring van de cel pellet) en resuspendeer in ijskoude lysis-buffermengsel + 1 x PIC naar een eindconcentratie van 1000 cellen / µL. Meng goed in lysis-buffermengsel door omhoog en omlaag pipetteren 20 - 30 keer. Te zorgen dat de cel klontjes zijn verstoord. Probeer niet te maken van de bubbels.
    3. Ga direct naar dag 1 (sectie 2) van het ndChIP-seq-protocol, of flash bevriezen de cel pellet in vloeibare stikstof en winkel bij-80 ° C.

2. dag 1: ndChIP-seq

  1. Voorbereiding van het antilichaam-kraal-complex
    1. Een waterbad 37 ° C en een ijsemmer voorbereiden. Werkt op ijs, bereiden 1 x IP buffer/1 x PIC en 1 x antilichaam (Ab) verdunning buffer, en houd ze op het ijs. Ophalen eiwit A (of G) magnetische kralen (Zie bespreking voor selectiecriteria) uit de opslag van de 4 ° C, en meng heel goed door zachte puls-vortexing. Houd het op ijs.
      Noot: Pulse-vortexing betekent vortexing is gestopt met telkens een volledige draaikolk wordt gevormd in de buis.
    2. Pipetteer 24 µL van eiwit A (of G) magnetische kralen per IP-reactie in een nieuwe 2 mL-buis. Opnemen van het volume van kralen en houd de buis op ijs. Voor bijvoorbeeld voor 7 IPs, gebruik µL van de 24 x 7 = 168 µL.
    3. Plaats de buis op de buis magneet en wacht op de oplossing tot duidelijk aangeeft kraal scheiding. Zonder verstoring van de kralen, verwijder de bovendrijvende vloeistof met behulp van een precisiepipet voorzichtig en negeren. Neem de buis uit de buis magneet en plaats het op het ijs.
    4. Voeg een gelijk volume (dat wil zeggen, aanvankelijke omvang van kralen) ijskoude IP-buffer + 1 x PIC mengen. Meng door pipetteren omhoog en omlaag. Doen niet vortex.
    5. Plaats de IP-buffer + 1 x PIC + kralen terug op de buis magneet en wacht op de oplossing tot duidelijk aangeeft kraal scheiding. Zonder verstoring van de kralen, verwijder de bovendrijvende vloeistof met behulp van een precisiepipet voorzichtig en negeren. Herhaal koude IP-buffer + 1 X PIC wassen twee meer tijden voor een totaal van 3 wasbeurten.
    6. Na de definitieve wash, resuspendeer de kralen in een gelijk volume (dat wil zeggen, aanvankelijke omvang van kralen) ijskoude IP-buffer + 1 x PIC mengen. Meng door pipetteren omhoog en omlaag. Doen niet vortex. Houd de buis op ijs.
    7. Op het ijs, giet 10 mL van de IP-buffer + PIC in een 25 mL V-vormige reservoir. Met behulp van een meerkanaalspipet, toevoegen 130 µL van ijskoude IP-buffer + 1 x PIC mix in individuele putjes van een schone V-bodem 96-wells plaat. Vul een goed per IP. Label van de plaat als "Ab-kraal complex".
    8. Voeg 12 µL van de gewassen eiwit A (of G) magnetische kralen in elk putje met IP-buffer + PIC, en meng door pipetteren omhoog en omlaag. Houd de resterende gewassen kralen op ijs.
    9. Verkrijgen gevalideerde antilichamen van hun gekoelde opslag en dooi op ijs, indien nodig. Werkt op ijs, Verdun de antilichamen met 1 x Ab verdunning buffer naar de concentraties in tabel 2aangegeven.
    10. Aan elk putje van de complexe Ab-grondplaat, voeg 1 µL van het juiste, verdunde antilichaam (tabel 1). Het opnemen van de put naar de antilichaam-sleutel. Meng met meerkanaalspipet, elke rij door pipetteren op en neer 20 keer. Tips tussen rijen wijzigen Zegel van de complexe Ab-grondplaat zeer goed met een aluminium plaat cover en Incubeer bij 4 ° C op een roterend platform voor ten minste 2 uur.
      Opmerking: Deze incubatie kunt doorgaan met installeren totdat u om te beginnen met stap 2.4.
  2. Cel lysis en chromatine spijsvertering
    1. Op ijs, bereidt 1 x lysis-buffermengsel + 1 x PIC en 1 mL MNase ik verdunning buffer (tabel 3) en houd ze op het ijs.
    2. De cel pellets ophalen uit de opslag-80 ° C (of van ijs, als vers bereid). Ontdooi de pellet van elke cel in een waterbad 37 ° C voor een 10 s, dan is overdracht aan ijs.
    3. Aan elke cel pellet onmiddellijk toevoegen ijskoude 1 x lysis-buffermengsel + 1 x PIC tot een uiteindelijke concentratie van 10.000 cellen/20 µL, en meng 10 keer door pipetteren op en neer, zonder bubbels. Bijvoorbeeld, voor 70.000 cellen is het eindvolume 140 µL.
    4. Werken op het ijs, aliquoot 20 µL per putje van de resulterende lysates in een 96-wells-plaat. De afdekplaat met een kunststof afdichting en incubeer op ijs gedurende 20 minuten Label de plaat "MNase spijsvertering" en de putjes aan een sjabloon sleutel opnemen. Om te verzekeren van een exacte timing van de chromatine spijsvertering reactie, ga niet verder naar de spijsvertering met meer dan 2 rijen van monsters tegelijk.
    5. Net voordat de lysis van de 20 min voltooid is, Verdun de MNase ik enzym met MNase ik verdunning van de buffer, om een eindconcentratie van 20 U/µL, en bewaar deze op ijs.
    6. Op ijs, bereidt de MNase ik spijsvertering master mix volgens tabel 4 en aliquoot 20 µL van het mengsel per elke rij monsters plus 5 µL dood volume in één rij van een reservoir van de 96-wells-plaat en houd het op ijs. Voor twee rijen, moet het volume: (20 µL x 2) + 5 µL = 45 µL.
    7. Nadat de lysates broeden, verwijder de MNase spijsvertering plaat uit ijs. Met behulp van een meerkanaalspipet, Voeg 20 µL van MNase ik spijsvertering master mix in elke rij van monsters, en meng 10 keer door pipetteren omhoog en omlaag. Tips tussen rijen wijzigen Incubeer bij kamertemperatuur gedurende precies 5 minuten.
    8. Na 5 min, zet de reactie stop, gebruik van een meerkanaalspipet toevoegen 6 µL 250 µM ethyleendiamminetetra azijnzuuroplossing (NA2EDTA) in elke rij van monsters en meng omhoog en omlaag een paar keer. Tips tussen rijen wijzigen Na toevoeging van EDTA, schakel over de instelling van de pipet naar 20 µL en mix 10 keer door pipetteren op en neer om zich te verzekeren van een volledige stop van de reactie van de spijsvertering. Tips tussen rijen wijzigen
    9. Met behulp van een meerkanaalspipet, aan elke rij van de MNase verteerd monsters, toevoegen 6 µL van 10 x lysis-buffermengsel en meng goed door pipetteren op en neer 10 keer. Bedek met een kunststof afdichting en incubeer op ijs gedurende 15 minuten.
  3. Input scheiding en pre-ontruimt
    1. Na de 15 minuten incubatie, werken op het ijs, zwembad alle putjes voor hetzelfde pellet/sjabloon cel tot een steriele, vooraf gekoeld op ijs, 1,5 mL tube (vooraf aangeduid met de sjabloon-ID) en mix grondig maar langzaam met behulp van een precisiepipet om te voorkomen dat wasmiddel schuimvorming.
    2. Voor elke cel pellet/sjabloon, overdracht van 8 µL van het verteerd chromatine in een nieuwe steriele, 0,5 mL tube (vooraf aangeduid met de sjabloon-ID) en bewaren bij 4 ° C's nachts. Dit zal dienen als de invoercontrole.
    3. Het verdelen van het resterende volume van de verteerd chromatine in 48 µL aliquots, over een nieuwe 96-wells-plaat. Cel pellet/sjabloon 1 gaat in putten A01-A06, cel pellet/sjabloon 2 gaat in putten A07-A12, etc. De putjes aan een sjabloon sleutel opnemen. Het label van de plaat "Pre-ontruimt".
    4. Met behulp van een meerkanaalspipet, voeg 120 µL van 1 x IP-Buffer + 1 x PIC en 12 µL van gewassen eiwit A (of G) magnetische kralen in elk putje van de plaat van de pre-ontruimt uit stap 2.3.3. Meng elke rij door pipetteren op en neer 10 keer. Tips tussen rijen wijzigen Afdichting van de plaat zeer goed met een aluminium plaat cover en uit te broeden op een roterend platform bij 4 ° C voor een minimum van 2 h.
  4. Immunoprecipitation reactie
    1. Voordat u deze stap ervoor te zorgen dat de Ab-complexe grondplaat (stap 2.1.10) en de pre-ontruimt plaat (stap 2.3.4) voor ten minste 2 h. snel draaien beide platen door centrifugeren voor 10 hebben geïncubeerd bij 200 x g s.
    2. Plaats de Ab-complexe grondplaat (uit stap 2.1.10) op een plaat magneet en wacht 15 s voor de oplossing van duidelijk geworden. Verwijder voorzichtig en verwijder het supernatant met behulp van een precisiepipet zonder verstoring van de kralen. Verwijderen de plaat uit de plaat magneet en bewaar deze op ijs.
    3. Plaats van de pre-ontruimt reactie plaat (uit stap 2.3.4) op een plaat magneet en wacht 15 s voor de kralen te scheiden en voor de oplossing van duidelijk geworden. Zonder verstoring van de kralen, zorgvuldig overbrengen de bovendrijvende vloeistof met behulp van een precisiepipet in de overeenkomstige putjes van de Ab-parel complexe plaat op ijs en meng zachtjes 15 keer gehouden op en neer waarbij eveneens. Zegel de plaat goed met een aluminium plaat van dekking en incubeer overnachting (12-18 h) bij 4 ° C op een draaiend platform. Opnieuw het label van de plaat "IP-reactie".

3. dag 2: ndCHIP-seq

  1. Wast en elutie
    1. De verwarming mixer ingesteld op 65 ° C. Voorbereiden op het ijs, een lage-zout was buffer en hoge-zout was buffer. Snelle spin de IP-reactie plaat uit stap 2.4.3 voor 10 s bij 200 x g.
    2. Plaats de plaat IP-reactie op een plaat magneet en wacht 15 s voor de oplossing van duidelijk geworden. Met behulp van een meerkanaalspipet, zonder verstoring van de kralen, zorgvuldig verwijderen en verwijder het supernatant. Neem de plaat uit de magneet plaat en plaats het op het ijs.
    3. Elke rij van de monsters in de IP-reactie plaat, toevoegt 150 µL ijskoude laag-zout wassen buffer en meng langzaam 10 keer op en neer om volledig resuspendeer de kralen.
    4. Plaats de IP-reactie plaat terug op de plaat magneet, wacht tot de parels om te scheiden, en met behulp van een meerkanaalspipet, zonder verstoring van de kralen verwijderen en verwijder het supernatant. Plaats de plaat terug op ijs en herhaal stap 3.1.3 en 3.1.4 voor een totaal van 2 wasbeurten.
    5. Op het ijs, aan elke rij voor samples in de IP-reactie plaat, toevoegt 150 µL van het hoge zout wassen buffer en meng langzaam 10 keer door pipetteren omhoog en omlaag om volledig resuspendeer de kralen.
    6. Plaats de IP-reactie plaat terug op de plaat magneet, wacht tot de parels om te scheiden, en met behulp van een meerkanaalspipet, zonder verstoring van de kralen verwijderen en verwijder het supernatant. Plaats de plaat IP-reactie op ijs en vooraf chill een nieuwe 96-wells-plaat ernaast.
    7. Elke rij van de monsters in de IP-reactie plaat, toevoegt 150 µL van het hoge zout wassen buffer en meng langzaam 10 keer door pipetteren omhoog en omlaag om volledig resuspendeer de kralen. Na resuspensie, wordt elke rij van monsters overbrengen door de corresponderende rij van de nieuwe, vooraf gekoeld, 96-wells-plaat. Het label van de plaat "IP-reactie". Gooi de oude plaat.
    8. Plaats de nieuwe plaat van de IP-reactie op de plaat magneet en wacht op de parels om te scheiden. Met behulp van een meerkanaalspipet, zonder verstoring van de kralen, zorgvuldig verwijderen en verwijder het supernatant. Houd de plaat bij kamertemperatuur.
    9. Aan elke rij voor samples in de IP-reactie plaat, Voeg 30 µL van de ChIP elutie buffer (EB) en meng langzaam 10 keer op en neer waarbij eveneens. Zorg ervoor dat luchtbel vorming te voorkomen.
    10. Afdichting van de plaat goed met een PCR-cover en broeden in een mixer van de verwarming bij 65 ° C gedurende 1,5 uur met een mengen snelheid van 1.350 rpm.
    11. Na een incubatieperiode van 1,5 h, spin down de IP-reactie plaat bij 200 x g gedurende 1 minuut bij 4 ° C. Wijzig de instelling van de mixer verwarming tot 50 ° C.
    12. Na de spin, plaatst u de IP-reactie plaat op een plaat magneet en wacht op de oplossing om te wissen. Met behulp van een meerkanaalspipet, zonder verstoring van de kralen, zorgvuldig Pipetteer 30 µL van de bovendrijvende substantie in een nieuwe 96-wells-plaat. Gebruik verse tips voor elke rij. Label van de plaat "IP-reactie" en houd deze bij kamertemperatuur.
  2. Vertering van eiwitten
    1. 30% PEG/1 M NaCl magnetische kraal17 (tabel van de samenstelling van de buffer) oplossing ophalen uit de koelkast 4 ° C en houd het bij kamertemperatuur gedurende ten minste 30 minuten kritische: zorgen dat de kraal oplossing volledig terechtkomt bij kamertemperatuur voordat u verdergaat.
    2. Invoercontrole monsters ophalen van 4 ° C-opslag (stap 2.3.2) en snelle spin. Meet het volume met behulp van een precisiepipet en voeg ultrazuiver water aan elk besturingselement voor tekstinvoer voor een eindvolume van 30 µL. de invoercontrole monsters overbrengen in de vooraf geselecteerde input putten (lege wells) in de IP-reactie plaat (stap 3.1.12). Het opnemen van de put naar de sleutel van het monster.
    3. Voorbereiden op het ijs, de eiwit spijsvertering Master Mix zoals aangegeven in tabel 5 en volume van de hoeveelheid gelijk in een rij van een reservoir van de 96-wells-plaat.
    4. Met behulp van een meerkanaalspipet, aan elke rij voor samples in de IP-reactie plaat, voeg 40 µL van het eiwit spijsvertering Master Mix en meng langzaam 10 keer op en neer. Afdichting van de plaat goed met een PCR-cover, spin down bij 200 x g gedurende 1 minuut en broeden in een mixer van de verwarming bij 50 ° C gedurende 30 minuten vastgesteldop 650 rpm. Terwijl de plaat is aan het broeden, bereiden van verse 70% ethanol (EtOH) en houden het bij kamertemperatuur.
    5. Na de incubatie 30 min voltooid is, draai de IP-reactie plaat bij 200 x g gedurende 1 min, 4 ° C. Houd de plaat bij kamertemperatuur.
      Opmerking: Het totale volume moet nu ~ 70 µL per putje.
  3. Kraal-opschonen met 30% PEG/1 M NaCl magnetische kraal oplossing
    1. Aliquot de kamertemperatuur 30% van PEG/1 M NaCl magnetische bead oplossing in één rij van een reservoir schoon 96-wells-plaat (75 µL per monster x aantal rijen).
    2. Werken bij kamertemperatuur, met behulp van een meerkanaalspipet, 70 µL (1:1 verhouding) van de 30%-PEG/1 M NaCl magnetische kraal-oplossing toevoegen aan elke rij voor samples in de IP-reactie plaat en meng 10 keer door pipetteren omhoog en omlaag. Tips tussen rijen wijzigen Laat de plaat gedurende 15 minuten bij kamertemperatuur inwerken.
    3. Plaats de plaat op de plaat magneet en incubeer gedurende 5 min om de parels te scheiden.
    4. Met behulp van een precisiepipet, zonder verstoring van de kralen, zorgvuldig verwijderen en verwijder het supernatant. Houd de kralen.
    5. Terwijl de IP-reactie plaat is nog steeds op de plaat magneet, met behulp van een meerkanaalspipet, aan elke rij van monsters, 150 µL van kamertemperatuur 70% toevoegen EtOH en incubeer 30 s. Na 30 s, met behulp van een meerkanaalspipet, verwijderen en verwijder het supernatant. Herhaal deze stap nog een keer voor een totaal van 2 wasbeurten.
    6. Na de tweede EtOH wash, Incubeer de 'droge' plaat op de plaat magneet voor 3 min. visueel inspecteren de plaat om ervoor te zorgen dat alle de EtOH is verdampt. Als dat niet het geval is, Incubeer de plaat voor 1 min. over het drogen van de resultaten van de kralen in een lagere opbrengst.
    7. De plaat uit de plaat magneet en met behulp van een meerkanaalspipet, toegevoegd 35 µL EB (Tabel van materialen). Meng goed door pipetteren 10 keer op en neer. Tips tussen rijen wijzigen Incubeer bij kamertemperatuur gedurende 3 minuten aan Elueer.
    8. Na incubatie, plaatst u de IP-reactie plaat terug op de plaat magneet en incubeer gedurende 2 min. De kralen moeten scheiden en de oplossing zal duidelijk geworden.
    9. Met behulp van een meerkanaalspipet, zonder verstoring van de kralen, zorgvuldig Pipetteer het supernatant in de overeenkomstige putjes van een nieuwe 96-wells-plaat.
    10. Afdichting van de plaat met een aluminium plaat cover, label "IPed + Input DNA" en opslaan bij 4 ° C's nachts of bij-20 ° C voor de lange termijn (> 48 h) opslag.

4. dag 3: Bibliotheek bouw

  1. Einde reparatie en fosforylatie
    1. De ingang voor het einde reparatie/fosforylatie reactie is het IPed + plaat uit stap 3.3.10 invoeren. Na het ontdooien, draai de plaat naar beneden bij 200 x g gedurende 1 minuut bij 4 ° C en bewaar deze op ijs.
    2. Ophalen van-20 ° C vriezer alle van de reagentia (met uitzondering van enzymen) vereist voor het einde reparatie/fosforylatie reactie (tabel 6) en ze ontdooien op kamertemperatuur, dan onmiddellijk overdracht om het ijs.
    3. Werkt op ijs, volg tabel 6 het einde reparatie/fosforylatie Master Mix in een steriele, 1,5 mL microcentrifuge buis instellen. Na de toevoeging van alle onderdelen van de niet-enzym, meng goed door puls-vortexing en plaats de buis terug op het ijs.
    4. Ophalen de relevante enzymen uit de koude opslag en het vervoer naar de Bank in een gekoeld buis cool rack. Meng elk enzym door flicking de buis, de snelle rotatie en plaats deze terug in het gekoeld buis cool rek. Wanneer het enzym pipetteren, gecombineerd langzaam te verzekeren van een overdracht van nauwkeurige volume. Na de toevoeging, door de tip in de master mix door pipetteren omhoog en omlaag te wassen.
    5. Zodra de enzymen worden toegevoegd, back voorzichtig-puls-vortex de master mix 5 keer te verzekeren van een gelijke verdeling van alle onderdelen, dan snelle rotatie en onmiddellijk de buis op ijs.
    6. Op het ijs, hoeveelheid een passende omvang van de einde reparatie/fosforylatie Master Mix in een rij van een nieuwe reservoir van de 96-wells-plaat; volume als aliquoted: (15 µL x aantal rijen) + 5 µL dood volume. Een voorbeeld berekening voor twee rijen: (15 µL x 2) + 5 µL = 35 µL per putje.
    7. Met behulp van een meerkanaalspipet, 15 µL van het einde reparatie/fosforylatie Master Mix toevoegen aan elke rij van monsters en meng 10 keer door pipetteren omhoog en omlaag. Tips tussen rijen wijzigen Afdichting van de plaat met een plastic cover, spin down bij 200 x g gedurende 1 minuut bij 4 ° C en Incubeer bij kamertemperatuur gedurende 30 minuten.
  2. Kraal-opschonen na einde reparatie en fosforylatie
    1. Uit de koelkast 4 ° C, haal de 20% PEG/1 M NaCl magnetische kraal oplossing en 30% PEG/1 M NaCl-oplossing en Incubeer bij kamertemperatuur gedurende ten minste 30 minuten.
      Opmerking: De 30%-PEG/1 M NaCl-oplossing niet bevatten magnetische kralen.
    2. Nadat beide oplossingen kamertemperatuur bereiken, voor elk monster bereiden 80 µL van 1:2 mix van 30% PEG/1 M NaCl en 20% PEG/1 M NaCl magnetische kraal oplossingen. Een voorbeeld voor 24 monsters: 80 µL x 24 = 1,920 µL (640 µL van 30% PEG/1 M NaCl en 1288 µL van 20% PEG/1 M NaCl magnetische kraal oplossingen).
    3. Aliquot de kraal oplossing mengen, gelijk volume, in een rij van een reservoir van de 96-wells-plaat en bewaar deze bij kamertemperatuur. Aliquot EB buffer (40 µL per monster x aantal rijen) in één rij van een reservoir schoon 96-wells-plaat. Een voorbeeld van twee rijen: 40 µL x 2 = 80 µL per putje.
    4. Met behulp van een meerkanaalspipet, voeg 75 µL van de kraal mix, bereid 4.2.2 binnenstapt in elke rij van monsters uit stap 4.1.7 en meng op en neer 10 keer. Tips tussen rijen wijzigen Incubeer bij kamertemperatuur gedurende 15 minuten doorgaan met de kraal sanering procedure zoals beschreven in stappen 3.3.3-3.3.10. De afdekplaat met een kunststof afdichting, snelle rotatie en plaats deze op het ijs. Ga verder met stap 4.3.
  3. A-Tailing reactie
    1. Ophalen uit de diepvries van-20 ° C alle van de reagentia (met uitzondering van enzymen) voor de A-Tailing reactie (tabel 7 vereiste), ze ontdooien op kamertemperatuur dan onmiddellijk overdracht om het ijs.
    2. Werkt op ijs, volg tabel 7 instellen van de A-Tailing Master Mix in een steriele, 1,5 mL microcentrifuge buis. Volg de instellingsaanwijzingen algemene enzymatische brouwsel zoals beschreven in stappen 4.1.4-4.1.6.
    3. Met behulp van een meerkanaalspipet, 15 µL van de A-Tailing Master Mix toevoegen aan elke rij van monsters en meng 10 keer door pipetteren omhoog en omlaag. Tips tussen rijen wijzigen Afdichting van de plaat met een PCR-cover, spin down bij 200 x g gedurende 1 minuut bij 4 ° C, en broeden in een thermocycler bij 37 ° C gedurende 30 minuten. Na de incubatie, draai de plaat naar beneden bij 200 x g gedurende 1 minuut en bewaar deze bij kamertemperatuur.
  4. Kraal-opschonen na A-Tailing
    1. Voer de stappen uit die worden beschreven in stap 4.2. De afdekplaat met een kunststof afdichting, label "A-staart + BC", snelle spin, en plaats deze op het ijs. Ga verder met stap 4.5.
  5. Adapter afbinding
    1. Ophalen uit de diepvries van-20 ° C alle van de reagentia (met uitzondering van enzymen) voor de adapter afbinding reactie (tabel 8 vereiste), ze ontdooien op kamertemperatuur dan onmiddellijk overdracht om het ijs.
    2. Ophalen van 10 µM PE adapter (aanvullende tabel 1) stockoplossing en Verdun tot 0,5 µM met EB. Meng goed door pulse vortexing. Het gebruikte volume is 3 µL x aantal monsters. Werken op het ijs, aliquoot de 0,5 µM PE-adapter, gelijk volume, in 12 putjes van een reservoir schoon 96-wells-plaat. Houd het op ijs.
    3. Werkt op ijs, volg tabel 8 de Adapter afbinding Master Mix in een steriele, 1,5 mL microcentrifuge buis instellen. Volg de instellingsaanwijzingen algemene enzymatische brouwsel zoals beschreven in stappen 4.1.4-4.1.6. Zorg ervoor dat de 5 X snelle Afbinding Buffer volledig ontdooide en heel goed gemengd vóór gebruik.
    4. Op het ijs, hoeveelheid een passende omvang van de Adapter afbinding Master Mix in een rij van een nieuwe reservoir van de 96-wells-plaat. Bijvoorbeeld een berekening voor twee rijen: (23 µL x 2) + 5 µL = 51 µL per putje. Houd de plaat op ijs.
    5. Met behulp van een meerkanaalspipet, voeg 2 µL van de 0,5 µM gekoppeld einde (PE) Adapter in elke rij van monsters van stap 4.4.1 en mix. Tips tussen rijen wijzigen
    6. Met behulp van een meerkanaalspipet, 23 µL van de Adapter afbinding Master Mix toevoegen aan elke rij van monsters en meng 15 keer door pipetteren omhoog en omlaag. Tips tussen rijen wijzigen Afdichting van de plaat met een metalen deksel, label "Afbinding", spin down op 200 x g voor 1 min bij 4 ° C, en na een nacht bebroeden bij kamertemperatuur.
  6. Dag 4: Bead-opschonen #1 na adapter afbinding
    1. Uit de koelkast 4 ° C, ophalen van de 20%-PEG/1 M NaCl magnetische kraal-oplossing en Incubeer bij kamertemperatuur gedurende ten minste 30 minuten. Terwijl de oplossing is zo bereiden verse 70% EtOH.
    2. Aliquot de 20%-PEG/1 M NaCl magnetische kraal-oplossing, 55 µL per monster, in een rij van een 96-Wells-reservoir plaat en houd het bij kamertemperatuur. Een voorbeeld van twee rijen: 55 µL x 2 = 110 µL per putje.
    3. Aliquot EB buffer, 50 µL per monster, in een rij van een reservoir schoon 96-wells-plaat. Een voorbeeld van twee rijen: 50 µL x 2 = 100 µL per putje.
    4. Met behulp van een meerkanaalspipet, voeg 48 µL van de 20%-PEG/1 M NaCl magnetische kraal-oplossing in elke rij voor samples in de afbinding plaat uit stap 4.5.6 en meng op en neer 10 keer. Tips tussen rijen wijzigen Incubeer bij kamertemperatuur gedurende 15 minuten doorgaan met de kraal sanering procedure zoals beschreven in stappen 3.3.3-3.3.7.
    5. De plaat uit de plaat magneet en met behulp van een meerkanaalspipet, toegevoegd 45 µL EB (Tabel van materialen). Meng goed door pipetteren 10 keer op en neer. Tips tussen rijen wijzigen Incubeer bij kamertemperatuur gedurende 3 minuten aan Elueer.
    6. Na incubatie, plaatst u de IP-reactie plaat terug op de plaat magneet en incubeer gedurende 2 min. met behulp van een meerkanaalspipet, zonder verstoring van de kralen, Breng zorgvuldig de bovendrijvende substantie in de overeenkomstige putjes van een nieuwe 96-wells-plaat. Het label van de plaat "Afbinding + 1 BC".
    7. Aan elk putje Voeg 5 µL van 10 x PCR HiFi buffer en meng goed door pipetteren omhoog en omlaag. Tips tussen rijen wijzigen De afdekplaat met een kunststof afdichting, snelle draai, en bewaar deze bij kamertemperatuur.
  7. Kraal-opschonen #2 na adapter afbinding
    1. Kraal-opschonen uitvoeren zoals beschreven in paragraaf 4.6 met de volgende wijzigingen: Voeg 60 µL van 20% PEG/1 M NaCl magnetische kraal-oplossing aan elk actief putje in de afbinding + 1 BC plaat (stap 4.6.7) en elueer van de kralen met behulp van 35 µL van EB buffer. Label van de plaat "Afbinding + 2 BC" en bewaar deze op ijs.
  8. PCR versterking
    1. Ophalen uit de diepvries van-20 ° C alle reagentia (met uitzondering van enzymen) die nodig zijn voor de PCR-reactie (tabel 9), ze ontdooien op kamertemperatuur dan onmiddellijk plaats ze op het ijs.
    2. Werkt op ijs, volg tabel 9 de PCR Master Mix in een steriele, 1,5 mL microcentrifuge buis instellen. Volg de algemene brouwsel set-up instructies zoals beschreven in stappen 4.1.4-4.1.5. Op het ijs, hoeveelheid een passende omvang van de meester van de PCR-Mix in één rij van een nieuwe reservoir van de 96-wells-plaat. Houd het op ijs. Zie stap 4.5.4 voor voorbeeld berekeningen.
    3. Werken op het ijs, met behulp van een meerkanaalspipet, voeg 2 µL van elke unieke 12,5 µM PCR omgekeerde indexeren primer (aanvullende tabel 2) in elk putje in de afbinding + 2 BC plaat (stap 4.7.1) en meng langzaam op en neer. Tips tussen rijen wijzigen Houd de plaat op ijs.
    4. Werken op het ijs, met behulp van een meerkanaalspipet, 23 µL van het PCR master mix in elke rij van monsters van toevoegen stap 4.8.3 en mix 10 keer door pipetteren omhoog en omlaag. Afdichting van de plaat met een PCR-cover, draai het naar beneden bij 200 x g gedurende 1 minuut en broeden in een thermocycler (Zie tabel 10 voor PCR fietsen voorwaarden).
  9. Kraal-opschonen na PCR versterking
    1. Na PCR versterking spin de plaat bij 200 x g gedurende 1 min, 4 ° C. De kraal clean-up uit te voeren zoals beschreven in paragraaf 4.6 met de volgende wijzigingen: 51 µL van 20% PEG/1 M NaCl magnetische kraal-oplossing toevoegen aan elke PCR-reactie en elueer van de kralen met behulp van 25 µL van EB buffer. Afdichting van de plaat met een aluminium bekleding en spin down bij 200 x g voor 1 min. winkel de monsters bij-20 ° C.
    2. Om te valideren gebouwd Bibliotheken, uitvoeren van DNA kwantificering met behulp van een fluorescentie gebaseerde assay, visualiseren van het eindproduct met behulp van een chip gebaseerde capillaire elektroforese analyzer (hoge gevoeligheid assay) en uitvoeren van verrijking kwantitatieve PCR (qPCR) (Zie Vertegenwoordiger resultaten, validatie van ndChIP-seq bibliotheek kwaliteit door qPCR).

Representative Results

Chromatine spijsvertering profielen
Optimalisatie van de MNase spijsvertering is essentieel voor het succes van dit protocol. Het is van cruciaal belang voor het genereren van een profiel van de spijsvertering gedomineerd door één nucleosoom fragment maten, terwijl niet overdreven verteerd, met het oog op herstel van hogere orde nucleosoom fragmenten. Een ideale spijsvertering-profiel bestaat uit een meerderheid van één nucleosoom fragmenten met een klein deel vertegenwoordigen van de fragmenten kleiner en groter dan één nucleosomes. Figuur 1 toont voorbeelden van een ideale, overdreven verteerd en onder-verteerd grootte distributie profielen. Merk op dat de sub-optimale vertering van chromatine ook in het profiel van de bibliotheek van de sequencing gegenereerd op basis van het IP-materiaal (Figuur 2 blijken zal).

Validatie van ndChIP-seq bibliotheek kwaliteit door qPCR
qPCR is een gevestigde methode voor de beoordeling van de kwaliteit van de ChIP18,19,20. Wanneer de opbrengst van de nucleïnezuur ndChIP-seq uitvoeren op 10.000 cellen na IP zal minder dan 1 ng. Daarom is het essentieel om uit te voeren qPCR na de bouw van de bibliotheek te beoordelen van de relatieve verrijking van doelregio's op achtergrond. Om een schatting van de achtergrond, worden opgebouwd uit de MNase verteerd chromatine (Input) bibliotheken gegenereerd. Voor elk IP-bibliotheek, zijn twee reeksen inleidingen nodig (Zie Supplementaltabel 3 voor een overzicht van de inleidingen voor veelgebruikte Histon marks). Een set van de primer moet specifiek voor een genomic dat is consequent gekoppeld aan de Histon wijziging van belang (positieve doelstelling) en een andere regio die niet is gemarkeerd met de Histon modificatie van belang (negatieve target). De kwaliteit van de ChIP-seq-bibliotheek zal worden beoordeeld als verrijking met betrekking tot invoer bibliotheek vouwen. Vouw verrijking kan worden berekend met de volgende vergelijking die wordt ervan uitgegaan dat de exponentiële versterking van de target genomic regio: 2Ctingang-CtIP. Onze aangepaste maakte R statistische softwarepakket, qcQpcr_v1.2, is geschikt voor qPCR analyse van de verrijking van lage input inheemse ChIP-seq bibliotheken (Aanvullende codebestanden). Figuur 3 is een qPCR resultaat voor geslaagde en mislukte ChIP-seq-bibliotheken. De minimale verwachte vouw verrijking waarde voor goede kwaliteit ndChIP-seq bibliotheken zijn 16 voor smalle marks, zoals H3K4me3 en 7 voor brede tekens, bijvoorbeeld H3K27me3.

Modellering van MNase toegankelijkheid
Computationele analyse van ChIP-seq is complex en unieke voor elke experimentele instelling. Een set van richtsnoeren die zijn vastgelegd door de International menselijke Epigenomic Consortium (IHEC) en de encyclopedie van DNA elementen (CODEER) kan worden gebruikt om te beoordelen van de kwaliteit van de ChIP-seq bibliotheken21. Het is belangrijk op te merken dat de diepte van de volgorde van de bibliotheken de detectie en oplossing van verrijkte regio's20 beïnvloedt. Het aantal pieken verhoging gedetecteerd en benaderingen van een plateau als Lees diepte toeneemt. We raden ndChIP-seq bibliotheken worden sequenced overeenkomstig de aanbevelingen van de IHEC van 50 miljoen gekoppeld-leest (25 miljoen fragmenten) voor smalle marks (bijvoorbeeldH3K4me3) en 100 miljoen gekoppeld-leest (50 miljoen fragmenten) voor brede marks ( bijvoorbeeld, H3K27me3) en de inbreng van22. Deze diepten sequencing bieden voldoende reeks aanpassingen voor de detectie van de meest significante pieken met wijd gebruikt ChIP-seq piek bellers, zoals MACS2 en HOMER, zonder verzadiging23,24te bereiken. Een hoge kwaliteit zoogdieren ndChIP-seq bibliotheek heeft een dubbele tarief van PCR van < 10% en verwijzing genoom uitlijning tarief van > 90% (inclusief gedupliceerde leest). Succesvolle ndChIP-seq bibliotheken bevat sterk gecorreleerde replicatieonderzoeken met een aanzienlijk deel (> 40%) van uitgelijnde leest binnen MACS222 geïdentificeerd verrijkt pieken en inspectie van uitgelijnde leest op een genoom browser moet visueel blijkt detecteerbare verrijking ten opzichte van de invoer bibliotheek (Figuur 4). Bovendien ndChIP-seq kan worden gebruikt om te beoordelen nucleosoom dichtheid met behulp van een algoritme van Gauss mengsel distributie (w1 * n(x; Μ 1,σ1) + w2 * n(x, μ2, σ2) = 1) verrijkt regio's model nucleosoom dichtheid bij MACS2 geïdentificeerd zoals gedefinieerd door MNase toegankelijk grenzen. In dit model w1 staat voor mono-nucleosoom distributie gewicht en w2 vertegenwoordigt di-nucleosoom distributie gewicht. Waar w1 groter dan w2 is, is daar de dominantie van mono-nucleosoom fragmenten en vice versa. Deze analyse vereist dat bibliotheken worden sequenced in een gekoppeld-end mode zodat fragment grootte kunnen worden gedefinieerd. Oog op de toepassing van het algoritme van Gauss mengsel distributie, zijn statistisch significant verrijkt gebieden voor het eerst geïdentificeerd. Wij stellen voor bellen van de piek met MACS2 met behulp van Input als een controle en met standaardinstellingen voor smalle merken en een q waarde cutoff van 0,01 voor brede marks. Een aantal statistische pakketten met een mengsel van Gaussiaanse distributie algoritme zijn verkrijgbaar bij gebruikte statistische softwarepakketten. Met behulp van gemiddelde fragment grootte, bepaald door gekoppeld-einde Lees grenzen van de IPed monsters, distributies op MACS2 geïdentificeerd verrijkt initiatiefnemers, en een mengsel van Gaussiaanse distributie algoritme kan worden toegepast op elke promotor met behulp van de R-statistisch pakket Mclust versie 3.025 voor het berekenen van een gewogen distributie. In deze toepassing, is het raadzaam de elimineren van initiatiefnemers met minder dan 30 uitgelijnde fragmenten omdat deze drempel het resulterende gewicht schattingen onbetrouwbaar geworden. Een goede kwaliteit ndChIP-seq bibliotheek genereert een mengsel van de Gaussiaanse distributie die bestaan uit twee belangrijke componenten met gemiddelde waarden die overeenkomen met mono-, di-nucleosoom fragment lengtes.

Figure 1
Figuur 1 : Beoordeling van de MNase spijsvertering voordat bibliotheek generatie. Capillaire elektroforese chip gebaseerde analyzer profielen voor een optimale MNase verteerd (A), onder-verteerd (B) en overdreven verteerd (C) chromatine. Biologische replicatieonderzoeken worden weergegeven als blauwe, rode en groene sporen. Klik hier voor een grotere versie van dit cijfer.

Figure 2
Figuur 2 : Beoordeling van de MNase spijsvertering na bibliotheek generatie. (A) Post bibliotheek bouw profielen van optimaal verteerd input (biologische replicatieonderzoeken; rood, groen, zwart) en IP (biologische replicatieonderzoeken; cyaan, paarse, blauwe) en (B) suboptimale input (biologische replicatieonderzoeken; rood, groen, blauw) en IP ( biologische replicatieonderzoeken; cyaan, paarse, oranje) bibliotheken. Klik hier voor een grotere versie van dit cijfer.

Figure 3
Figuur 3 : Bibliotheek bouw kwantitatieve PCR kan worden gebruikt voor het beoordelen van de kwaliteit van ndChIP-seq bibliotheken boekt. Vouw verrijking van H3K4me3 IP-bibliotheken met betrekking tot invoer bibliotheken wordt berekend als de 2(Ct van input - Ct van IP) voor positieve en negatieve doelen met behulp van qcQpcr_v1.2. Klik hier voor een grotere versie van dit cijfer.

Figure 4
Figuur 4 : Representatief ndChIP-seq bibliotheek opgebouwd uit 10.000 primaire CD34+ aansluitsnoer bloedcellen. Pearson correlatie van H3K4me3 signaal (leest per miljoen toegewezen leest) berekend in de initiatiefnemers (TSS +/-2Kb) tussen 3 biologische replicatieonderzoeken, (A) repliceren 1 en 2, (B) repliceren 1 en 3, (C) repliceren 2 en 3. (D) UCSC browserweergave van het HOXA gene cluster van kruislings gekoppelde ChIP-seq gegenereerd op basis van 1 miljoen cellen per IP, succesvolle ndChIP-seq van 10.000 cellen per IP en mislukte ndChIP-seq van 10.000 cellen per IP. (rode: H3K27me3, groen: H3K4me3, en zwarte: Input). (E) breuk van toegewezen luidt binnen MACS2 geïdentificeerd verrijkt regio's van de H3K4me3 (zwart) en H3K27me3 (grijs). Klik hier voor een grotere versie van dit cijfer.

Samenstelling van de buffer
A.1. Immunoprecipitation buffer (IP)
20 mM Tris-HCl, pH 7.5
2 mM EDTA
150 mM NaCl
0,1% Triton X-100
0,1% Deoxycholate
10 mM natrium butyraat
A.2. Low zout was buffer
20 mM Tris-HCl pH 8,0
2 mM EDTA
150 mM NaCl
1% Triton X-100
0,1% SDS
Hoge zout was buffer A.3.
20 mM Tris-HCl pH 8,0
2 mM EDTA
500 mM NaCl
1% Triton X-100
0,1% SDS
ChIP elutie buffer A.4.
100 mM NaHCO3
1% SDS
A.5. 1 x Lysis-buffermengsel – 1 mL
0,1% Triton
0,1% Deoxycholate
10 mM natrium butyraat
A.6. Ab verdunning buffer
0,05% (m/v) Azide
0,05% breed spectrum antimicrobiële (b.v. ProClin 300)
in PBS
A.7. 30% PEG / 1M NaCl-oplossing met magnetische kraal (referentie16)
30% PEG
1 M NaCl
10 mM Tris HCl, pH 7.5
1 mM EDTA
1 mL van gewassen Super paramagnetisch kralen
A.8. 20% PEG / 1M NaCl-oplossing met magnetische kraal (referentie16)
30% PEG
1 M NaCl
10 mM Tris HCl, pH 7.5
1 mM EDTA
1 mL van gewassen Super paramagnetisch kralen

Tabel 1: ndChIP-seq buffer samenstelling.

Histon wijziging Concentratie (µg/µL)
H3K4me3 0,125
H3K4me1 0,25
H3K27me3 0,125
H3K9me3 0,125
H3K36me3 0,125
H3K27ac 0,125

Tabel 2: Antilichaam bedrag dat vereist is voor ndChIP-seq.

Reganet Volume (µL)
Ultra puur Water 478
1 M Tris-HCl pH 7.5 10
0.5 EDTA M 10
5 M NaCl 2
Glycerol 500
Totaal Volume 1.000

Tabel 3: Recept voor MNase verdunning buffer.

Reagens Volume (µL)
Ultra puur Water 13
20 mM DTT 1
10 x MNase Buffer 4
20 U/µl Mnase 2
Totaal Volume 20

Tabel 4: Recept voor MNase Master Mix.

Reagens Volume (µL)
Elutie Buffer 30
Buffer G2 8
Protease 2
Totaal Volume 40

Tabel 5: Recept voor DNA zuivering Master Mix.

Reagens Volume (µL)
Ultra puur Water 3.3
10 x beperking Endonuclease Buffer (bijvoorbeeld NEBuffer) 5
25 mM ATP 2
10 mM dNTPs 2
T4 Polynucleotide Kinase (10 U/µl) 1
T4 DNA polymerase (3 U/µl) 1.5
DNA-polymerase I, Large (Klenow) Fragment (5 U/µl) 0.2
Totaal Volume 15

Tabel 6: Recept voor einde reparatie Master Mix.

Reagens Volume (µL)
Ultra puur Water 8
10 x beperking Endonuclease Buffer (bijvoorbeeld NEBuffer) 5
10 mM dATP 1
Klenow (3' - 5' exo-) 1
Totaal Volume 15

Tabel 7: Recept voor A-Tailing Master Mix.

Reagens Volume (µL)
Ultra puur Water 4.3
5 x snelle Afbinding buffer 12
T4 DNA ligase (2000 U/µl) 6.7
Totaal Volume 23

Tabel 8: Recept voor Adapter afbinding Master Mix.

Reagens Volume (µL)
Ultra puur Water 7
25 uM PCR primer 1.0 2
5 x HF buffer 12
DMSO 1.5
DNA-Polymerase 0,5
Totaal Volume 23

Tabel 9: Recept voor PCR Master Mix.

Tempratuur (° C) Duur (s) Aantal cycli
98 60 1
98 30
65 15 10
72 15
72 300 1
4 Houd Houd

Tabel 10: PCR de methode run.

Oligo Volgorde Wijziging
PE_adapter 1 5'-/ 5Phos/GAT CGG AAG AGC GGT TCA GCA GGA ATG CCG AG -3 ' 5' wijziging: fosforylatie
PE_adapter 2 5' - ACA CTC TTT CCC TAC ACG ACG CTC TTC CGA TC * T - 3' 3' wijziging: * T is een phosphorothioate band

Aanvullende tabel 1: Oligo reeksen voor generatie van PE adapter.

De naam van de primer Volgorde Index IndexRevC (om te worden gebruikt voor het rangschikken)
Omgekeerde PCR indexing primer 1 CAAGCAGAAGACGGCATACGAGATCGTGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CGTGAT atcacg
Omgekeerde PCR indexing primer 2 CAAGCAGAAGACGGCATACGAGATCTGATCCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CTGATC gatcag
Omgekeerde PCR indexing primer 3 CAAGCAGAAGACGGCATACGAGATGGGGTTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GGGGTT aacccc
Omgekeerde PCR indexing primer 4 CAAGCAGAAGACGGCATACGAGATCTGGGTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CTGGGT acccag
Omgekeerde PCR indexing primer 5 CAAGCAGAAGACGGCATACGAGATAGCGCTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AGCGCT agcgct
Omgekeerde PCR indexing primer 6 CAAGCAGAAGACGGCATACGAGATCTTTTGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CTTTTG caaaag
Omgekeerde PCR indexing primer 7 CAAGCAGAAGACGGCATACGAGATTGTTGGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT TGTTGG ccaaca
Omgekeerde PCR indexing primer 8 CAAGCAGAAGACGGCATACGAGATAGCTAGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AGCTAG ctagct
Omgekeerde PCR indexing primer 9 CAAGCAGAAGACGGCATACGAGATAGCATCCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AGCATC gatgct
Omgekeerde PCR indexing primer 10 CAAGCAGAAGACGGCATACGAGATCGATTACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CGATTA taatcg
Omgekeerde PCR indexing primer 11 CAAGCAGAAGACGGCATACGAGATCATTCACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CATTCA tgaatg
Omgekeerde PCR indexing primer 12 CAAGCAGAAGACGGCATACGAGATGGAACTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GGAACT agttcc
Omgekeerde PCR indexing primer 13 CAAGCAGAAGACGGCATACGAGATACATCGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT ACATCG cgatgt
Omgekeerde PCR indexing primer 14 CAAGCAGAAGACGGCATACGAGATAAGCTACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AAGCTA tagctt
Omgekeerde PCR indexing primer 15 CAAGCAGAAGACGGCATACGAGATCAAGTTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CAAGTT aacttg
Omgekeerde PCR indexing primer 16 CAAGCAGAAGACGGCATACGAGATGCCGGTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GCCGGT accggc
Omgekeerde PCR indexing primer 17 CAAGCAGAAGACGGCATACGAGATCGGCCTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CGGCCT aggccg
Omgekeerde PCR indexing primer 18 CAAGCAGAAGACGGCATACGAGATTAGTTGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT TAGTTG caacta
Omgekeerde PCR indexing primer 19 CAAGCAGAAGACGGCATACGAGATGCGTGGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GCGTGG ccacgc
Omgekeerde PCR indexing primer 20 CAAGCAGAAGACGGCATACGAGATGTATAGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GTATAG ctatac
Omgekeerde PCR indexing primer 21 CAAGCAGAAGACGGCATACGAGATCCTTGCCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CCTTGC gcaagg
Omgekeerde PCR indexing primer 22 CAAGCAGAAGACGGCATACGAGATGCTGTACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GCTGTA tacagc
Omgekeerde PCR indexing primer 23 CAAGCAGAAGACGGCATACGAGATATGGCACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT ATGGCA tgccat
Omgekeerde PCR indexing primer 24 CAAGCAGAAGACGGCATACGAGATTGACATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT TGACAT atgtca

Aanvullende tabel 2: PCR reverse indexeren primer sequenties.

Inleidingen Volgorde
ZNF333_genic_H3K9me3_F 5'-AGCCTTCAATCAGCCATCATCCCT-3'
ZNF333_genic_H3K9me3_R 5'-TCTGGTATGGGTTCGCAGATGTGT-3'
HOXA9-10_F 5'-ACTGAAGTAATGAAGGCAGTGTCGT-3'
HOXA9-10_R 5'-GCAGCAYCAGAACTGGTCGGTG-3'
GAPDH_genic_H3K36me3_F 5'-AGGCAACTAGGATGGTGTGG-3'
GAPDH_genic_H3K36me3_R 5'-TTGATTTTGGAGGGATCTCG-3'
GAPDH-F 5'-TACTAGCGGTTTTACGGGCG-3'
GAPDH-R 5'-TCGAACAGGAGGAGCAGAGAGCGA-3'
Histon wijziging Positieve Target Negatieve Target
H3K4me3 GAPDH HOXA9-10
H3K4me1 GAPDH_genic ZNF333
H3K27me3 HOXA9-10 ZNF333
H3K27ac GAPDH ZNF333
H3K9me3 ZNF333 HOXA9-10
H3K36me3 GAPDH_genic ZNF333

Aanvullende tabel 3: Een lijst van inleidingen voor veelgebruikte Histon marks (H3K4me3, H3K4me1, H3K27me3, H3K27ac, H3K9me3 en H3K36me3).

Aanvullende bestand 1: ndChIP-seq werkblad. Klik hier om dit bestand te downloaden.

Aanvullende codebestanden: qcQpcr_v1.2. R statistische softwarepakket voor qPCR analyse van de verrijking van lage input inheemse ChIP-seq-bibliotheken. Klik hier om dit bestand te downloaden.

Discussion

Gezien de combinatorische aard van chromatine modificatie en nucleosoom positionering in transcriptionele verordening, is een methode waarmee gelijktijdige metingen van deze functies waarschijnlijk bieden nieuwe inzichten in de Epigenetische regulatie. De ndChIP-seq protocol hier gepresenteerd is een inheemse ChIP-seq geoptimaliseerd zodat gelijktijdige ondervraging van Histon modificaties en nucleosoom dichtheid in zeldzame primaire cellen9,10. ndChIP-seq maakt gebruik van enzymatische vertering van chromatine dat wanneer gekoppeld aan gekoppeld-einde massaal parallelle Sequencen en een distributiemodel Gaussian mengsel, voorziet de onderzoek histone modificaties op één nucleosoom niveau en de deconvolutie van epigenomic profielen gedreven door heterogeniteit binnen een populatie. Met behulp van dit protocol, hebben we een unieke verdeling van immuno-neergeslagen fragment maten, bepaald door gekoppeld-end grenzen, gekoppeld aan specifieke chromatine Staten gedefinieerd door ChromHMM10,24Lees eerder gemeld.

De kwaliteit van een ndChIP-seq-bibliotheek, is afhankelijk van meerdere factoren, zoals antilichamenspecificiteit en gevoeligheid, optimale MNase spijsvertering omstandigheden en kwaliteit van de chromatine. De specificiteit van de antilichamen die gebruikt is cruciaal bij het opstellen van de succesvolle ndChIP-seq bibliotheek. Een ideale antilichaam toont hoge affiniteit tegen de epitoop van belang met kleine kruis-reactiviteit met andere epitopes. Het is even belangrijk om te kiezen van magnetische kralen met de hoogste affiniteit voor het antilichaam van keus.

MNase spijsvertering is een kritische en tijd - en concentratie-gevoelige reactie in dit protocol. Bij de verwerking van meerdere monsters, het is daarom belangrijk dat elke reactie een equivalente hoeveelheid tijd is uncubeerd (zie stap 2.2). De kwaliteit van de chromatine is een andere factor die aanzienlijke effecten van het resultaat van ndChIP-seq. briyu chromatine leidt tot een suboptimaal MNase spijsvertering profiel en resultaten in bibliotheken met een lage signaal / ruisverhouding. Primaire monsters met een lage levensvatbaarheid van cellen of gedegradeerd chromatine, zoals formaline-vaste paraffine-ingebedde (FFPE) weefsel worden niet aanbevolen voor dit protocol.

De toevoeging van een PIC tijdens de chromatine extractie vermindert ongewenste (d.w.z., willekeurige) chromatine fragmentatie en conserven integriteit van Histon staarten. PIC moet als zodanig worden toegevoegd aan de lysis-buffermengsel en immunoprecipitation buffer gewoon vooraf te gebruiken. Terwijl selecteren cellen via stroom cytometry, Selecteer voor levensvatbare cellen en zorgen worden cellen gesorteerd op een lage stroomsnelheid te verhogen van de nauwkeurigheid van de cel nummer raming en levensvatbaarheid van cellen. Vermijd sorteren cellen rechtstreeks in lysis-buffermengsel. De schede buffer verdunt de lysis-buffermengsel en effectieve permeabilization van de celmembraan voorkomt tot MNase. Afhankelijk van een soort cellen of organisme, titratie van MNase mogelijk moet verkrijgen van optimale spijsvertering.

ndChIP-seq op zoogdiercellen vereist een minimale sequencing-diepte van 50 miljoen gekoppeld-leest (25 miljoen fragmenten) voor smalle merken en 100 miljoen gekoppeld-leest (50 miljoen fragmenten) voor globale merken en input. Het algoritme van Gauss mengsel distributie zal niet optimaal presteren op bibliotheken die gesequentieerd hebben al tot een diepte aanzienlijk lager ligt dan deze aanbeveling. ndChIP-seq zullen niet kwalificeren voor initiatiefnemers met weinig scheiding tussen de waarde van de gewogen distributie voor mono - en di-nucleosoom fragment lengtes in mono - of di-nucleosoom gedomineerd initiatiefnemers. Daarom moeten deze initiatiefnemers in de daaropvolgende analyse worden verwijderd. Biologische wordt gerepliceerd kunnen worden gegenereerd om het vertrouwen in de voorspelde distributies en technische variabiliteit in de MNase spijsvertering en bibliotheek bouw te identificeren.

In tegenstelling tot de vorige iteraties van inheemse ChIP-seq protocollen, ndChIP-seq mogelijkheid biedt de combinatorische effect van chromatine structuur en Histon wijziging onderzoeken met behulp van fragment grootte post immunoprecipitation te integreren nucleosoom dichtheid, bepaald door MNase toegankelijkheid, histone wijziging metingen. Toepassing van ndChIP-seq primaire cellen en weefsels zal bieden nieuwe inzichten in de integratieve aard van Epigenetische regulatie en geïdentificeerd epigenetische handtekeningen als gevolg van de heterogeniteit binnen de bevolking.

Disclosures

De auteurs verklaren dat zij geen concurrerende financiële belangen hebben.

Acknowledgements

A.L. werd gesteund door een Canadese Graduate beurs van de Canadese instituten van het gezondheidsonderzoek. Dit werk werd gesteund door subsidies van het genoom Brits-Columbia en de Canadese instituten van gezondheidsonderzoek (CIHR-120589) als onderdeel van het Canadese epigenetica, milieu en gezondheid onderzoeksinitiatief Consortium en de Terry Fox Research Institute Program Project Grant #TFF-122869 M.H. en een Terry Fox onderzoeksinstituut nieuwe Investigator Award (Grant # 1039) naar M.H.

Materials

Name Company Catalog Number Comments
1M Tris-HCl –pH 7.5 Thermo Scientific 15567-027
1M Tris-HCl –pH 8 Thermo Scientific 15568-025
0.5M EDTA Thermo Scientific AM9260G
5M NaCl Sigma 1001385276
Triton X-100 Sigma 1001412354
Sodium-Deoxycholate Sigma 1001437582
SDS Thermo Scientific 15525-017
Sodium-Bicarbonate Fisher Scientific S233-500
100% EtOH NA NA
V-bottom 96 well plate (AB 1400) Thermo Scientific AB-1400-L
Gilson P2 pipetman Mandel F144801
Gilson P10 pipetman Mandel F144802
Gilson P20 pipetman Mandel F123600
Gilson P100 pipetman Mandel F123615
Gilson P200 pipetman Mandel F123601
Gilson P1000 pipetman Mandel F123603
Micrococcal Nuclease  NEB M0247S
Thermo Mixer C (Heating block mixer) Eppendorf 5382000023
Multi 12-channel Pippet P20 Rainin 17013803
Multi 12-channel Pippet P200 Rainin 17013805
1.5 ml LoBind tube Eppendorf 22431021
0.5 ml LoBind tube Eppendorf 22431005
Plastic Plate Cover Edge Bio 48461
PCR cover Bio Rad MSD-1001
Aluminum Plate Cover Bio Rad MSF-1001
Elution buffer (EB buffer) Qiagen 19086
1M DTT Sigma 646563
Eppendorf 5810R centrifuge  Eppendorf 22625004
Ultrapure water Thermo Scientific 10977-015
Protein G dynabeads Thermo Scientific 10001D
Protein A dynabeads Thermo Scientific 10001D
Protease inhibitor Cocktail Calbiochem 539134
Rotating platform Mandel 1b109-12052010
Plate magnet Alpaqua 2523
Domed 12-cap strip Bio Rad TCS1201
Buffer G2 Qiagen 1014636
Protease Qiagen 19155
Tube Magnet (DynaMag-2) Thermo Scientific 12321D
Tube Magnet (DynaMag-2) LabCore 730-006
V shape Plastic reservoir Mandel S0100A
Vortex Mandel C1801
Mini Fuge Mettler Toledo XS2035
Analytical scale Mandel LB109-12052010
Quick Ligation Reaction Buffer, 5X NEB B6058S
DNA Polymerase I, Large (Klenow) Fragment NEB M0210S
Klenow Fragment (3'-5' exo) NEB M0212S
T4 DNA Polymerase NEB M0203S
T4 Polynucleotide Kinase NEB M0201S
Deoxynucleotide Solution mix, 10mM NEB N0447S
dATP Solution 10mM NEB N0440S
Quick T4 DNA Ligase NEB M0202T
Adenosine 5'-Triphosphate (ATP), 25mM NEB P0756S
DNA Polymerase Thermo Scientific F549L
NEBuffer 2 NEB B7002S
Hank's buffered salt solution Thermo Scientific 14025076
Fetal bovine serum  Thermo Scientific A3160702
phosphate buffer saline  Thermo Scientific 10010023
H3K4me3 Cell Signaling 9751S
H3K4me1 Diagenode C15410037
H3K27me3 Diagenode pAb-069-050
H3K36me3 Abcam ab9050
H3K9me3 Diagenode C15410056
SeraMag  super-paramagnetic beads

DOWNLOAD MATERIALS LIST

References

  1. Simpson, R. T. Nucleosome Positioning: Occurrence, Mechanisms, and Functional Consequences. Prog. Nucleic Acid Res. Mol. Biol. 40, Issue C 143-184 (1991).
  2. Kornberg, R. D., Lorch, Y. Twenty-five years of the nucleosome, fundmamental particle of the eukaryotic chromosome. Cell. 98, 285-294 (1999).
  3. Schones, D. E., et al. Dynamic regulation of nucleosome positioning in the human genome. Cell. 132, (5), 887-898 (2008).
  4. Segal, E., et al. A genomic code for nucleosome positioning. Nature. 442, (7104), 772-778 (2006).
  5. Shiio, Y., Eisenman, R. N. Histone sumoylation is associated with transcriptional repression. PNAS. 100, (23), 13225-13230 (2003).
  6. Li, L., Lorzadeh, A., Hirst, M. Regulatory variation: An emerging vantage point for cancer biology. Wiley Interdiscip. Rev. Syst. Biol. Med. 6, (1), 37-59 (2014).
  7. Jiang, J., et al. Investigation of the acetylation mechanism by GCN5 histone acetyltransferase. PLoS ONE. 7, (5), (2012).
  8. Kouzarides, T. Histone methylation in transcriptional control. Curr. Opin. Genet. Dev. 12, (2), 198-209 (2002).
  9. Brind'Amour, J., Liu, S., Hudson, M., Chen, C., Karimi, M. M., Lorincz, M. C. An ultra-low-input native ChIP-seq protocol for genome-wide profiling of rare cell populations. Nat. Commun. 6, 6033 (2015).
  10. Lorzadeh, A., et al. Nucleosome Density ChIP-Seq Identifies Distinct Chromatin Modification Signatures Associated with MNase Accessibility. Cell Rep. 17, (8), 2112-2124 (2016).
  11. Noll, M., Kornberg, R. D. Action of micrococcal nuclease on chromatin and the location of histone H1. J. Mol. Biol. 109, (3), 393-404 (1977).
  12. Skene, P. J., Henikoff, S. A simple method for generating high-resolution maps of genome wide protein binding. eLife. 4, 09225 (2015).
  13. Brogaard, K., Xi, L., Wang, J. -P., Widom, J. A map of nucleosome positions in yeast at base-pair resolution. Nature. (2012).
  14. Cui, K., Zhao, K. Genome-wide approaches to determining nucleosome occupancy in metazoans using MNase-Seq. Methods Mol. Biol. 833, 413-419 (2012).
  15. Mieczkowski, J., et al. MNase titration reveals differences between nucleosome occupancy and chromatin accessibility. Nat. Commun. 7, 11485 (2016).
  16. Basu, S., Campbell, H. M., Dittel, B. N., Ray, A. Purification of Specific Cell Population by Fluorescence Activated Cell Sorting (FACS). JOVE. (41), (2010).
  17. Rohland, N., Reich, D. Cost-effective, high-throughput DNA sequencing libraries for multiplexed target capture. Genome Res. 22, (5), 939-946 (2012).
  18. Zheng, Y., Josefowicz, S. Z., Kas, A., Chu, T. T., Gavin, M. A., Rudensky, A. Y. Genome-wide analysis of Foxp3 target genes in developing and mature regulatory T cells. Nature. 445, (7130), 936-940 (2007).
  19. Krishnakumar, R., Gamble, M. J., Frizzell, K. M., Berrocal, J. G., Kininis, M., Kraus, W. L. Reciprocal Binding of PARP-1 and Histone H1 at Promoters Specifies Transcriptional Outcomes. Science. 319, (5864), 819-821 (2008).
  20. Mendenhall, E. M., et al. Locus-specific editing of histone modifications at endogenous enhancers. Nat. Biotechnol. 31, (12), 1133-1136 (2013).
  21. Landt, S. G., et al. ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia. Genome Res. 22, (9), 1813-1831 (2012).
  22. Reference Epigenome Standards - IHEC. Available from: http://ihec-epigenomes.org/research/reference-epigenome-standards/ (2017).
  23. Heinz, S., et al. Simple Combinations of Lineage-Determining Transcription Factors Prime cis-Regulatory Elements Required for Macrophage and B Cell Identities. Mol. Cell. 38, (4), 576-589 (2010).
  24. Feng, J., Liu, T., Qin, B., Zhang, Y., Liu, X. S. Identifying ChIP-seq enrichment using MACS. Nat. Protoc. 7, (9), 1728-1740 (2012).
  25. Fraley, C., Raftery, A. E. MCLUST: Software for Model-Based Cluster Analysis. J. Classif. 16, (2), 297-306 (1999).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics