Etablering af Viral infektion og analyse af Host-Virus interaktion i Drosophila Melanogaster

* These authors contributed equally
Immunology and Infection
 

Summary

Denne protokol beskriver Sådan oprettes viral infektion i vivo i Drosophila melanogaster ved hjælp af nano-injektion metode og grundlæggende teknikker til at analysere virus-værts-samspillet.

Cite this Article

Copy Citation | Download Citations

Yang, S., Zhao, Y., Yu, J., Fan, Z., Gong, S. t., Tang, H., Pan, L. Establishment of Viral Infection and Analysis of Host-Virus Interaction in Drosophila Melanogaster. J. Vis. Exp. (145), e58845, doi:10.3791/58845 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Virus spredning er en væsentlig årsag til epidemiske sygdomme. Dermed, forståelse samspil mellem virus og værten er meget vigtigt at udvide vores viden om forebyggelse og behandling af virusinfektion. Frugtflue Drosophila melanogaster har vist sig for at være en af de mest effektive og produktive modelorganismer til at screene for antiviral faktorer og undersøge virus-vært interaktion, på grund af stærke genetiske værktøjer og meget velbevarede medfødte immun signalering veje. Proceduren beskrevet her viser en nano-injektion metode til at fastlægge viral infektion og fremkalde systemisk antiviral svar i voksne fluer. Den præcis kontrol af viral injektion dosis i denne metode giver høj eksperimentelle reproducerbarhed. Protokoller er beskrevet i denne undersøgelse omfatter forberedelse af fluer og virus, injektion metode, overlevelse sats analyse, virus belastning måling og antiviral pathway vurdering. Indflydelse virkningerne af viral infektion af fluer baggrund blev nævnt her. Denne infektion metode er nem at udføre og kvantitativt gentagelig; Det kan anvendes til at screene for host/viral faktorer involveret i virus-vært interaktion og at dissekere krydstale mellem medfødte immun signalering og andre biologiske veje som svar på viral infektion.

Introduction

Nye virale infektioner, især af arboviruses, såsom den Chikungunya virus1, Dengue virus, gul feber virus2 og Zikavirus3, har været en stor trussel mod folkesundheden ved at forårsage pandemier 4. således en bedre forståelse af virus-vært interaktion er blevet stadig vigtigere for epidemiske kontrol og behandling af virale sygdomme hos mennesker. For dette mål, skal mere passende og effektive modeller oprettes til at efterforske de mekanismer, der ligger til grund for virusinfektion.

Frugtflue, Drosophilamelanogaster (D. melanogaster), sørger et kraftfuldt system for at undersøge virus-vært interaktion5,6 og har vist sig for at være en af de mest effektive modeller til at studere menneskets virussygdomme7 , 8 , 9. stærkt bevarede antiviral signalering veje og uforlignelige genetiske værktøjer gør flyver en stor model for at give betydelige resultater med reelle konsekvenser for menneskers antiviral undersøgelser. Derudover fluer er nemt og billigt at opretholde i laboratoriet og er bekvemt for omfattende screening af roman regulerende faktorer6,10 i virus og værten under infektion.

Fire store stærkt bevarede antiviral veje (fx., RNA interferens (RNAi) vej11, JAK-STAT vej12, NF-κB vej og autophagy vej13) er godt undersøgt i Drosophila i de seneste år6. RNAi-vej er en bred antiviral mekanisme, der kan undertrykke de fleste former for virus infektion6,14. Afbrydelse af denne vej af mutation i gener som Dicer-2 (Dcr-2) eller Argonaute 2 (AGO2) kan føre til øget virus titer og vært dødelighed15,16,17. JAK-STAT pathway har været impliceret i kontrol af infektion med en virus fra familien Dicistroviridae og familien Flaviviridae i insekter, fx., Drosophila C virus (DCV) i fluer16 og West Nile-virus (VNV) og Dengue Virus i myg18,19. Drosophila vejafgift (homologe til den menneskelige NF-κB vej) og immundefekt (IMD) veje (svarende til den menneskelige NF-κB og TNF pathway) er begge involveret i forsvaret virus invasionen20,21, 22. autophagy er en anden bevarede mekanisme, der er involveret i reguleringen af viral infektion, som er godt præget i Drosophila23,24. Således, identifikation af nye regulerende faktorer af disse veje og dissekere krydstale mellem disse antiviral signalering og andre biologiske veje som stofskifte, aldring, neurale reaktion og så videre, kan være nemt at sætte op i Drosophila system.

Selv om mest veletablerede viral smitsomme modeller i Drosophila er induceret af RNA-vira, infektion af hvirvelløse iriserende Virus 6I (IV-6) og Kallithea virus har vist potentiale for undersøgelse af DNA virus i fluer25, 26. Virussen kan desuden også ændres for at tillade infektion i Drosophila, såsom influenzavirus9. Dette har stærkt udvidet anvendelse af Drosophila screening platform. I denne procedure bruger vi DCV som et eksempel til at beskrive hvordan man kan udvikle en viral smitsomme system i Drosophila. DCV er en positiv følelse enkelt strandede RNA virus af ca 9300 nukleotider, kodning 9 proteiner27. Som en naturlig patogen af D. melanogasterbetragtes DCV som en egnet virus at studere vært fysiologiske, adfærdsmæssige og basal immunrespons i værten-virus interaktion og co-Evolution28. Derudover gør dens hurtige dødelighed efter infektion i vildtype fluer DCV nyttigt at screene for resistente eller modtagelige gener i vært29.

Men der er flere aspekter af bekymring når man studerer virale infektioner i Drosophila. For eksempel, har symbiotisk bakterier Wolbachia en evne til at hæmme et bredt spektre af RNA-virus spredning i Drosophila og myg30,31,32. Seneste beviser viser en mulig mekanisme i hvilke Wolbachia blokke Sindbis virus (SINV) infektion gennem opregulering af methyltransferase Mt2 udtryk i vært33. Den genetiske baggrund for insekter er desuden også afgørende for virusinfektion. For eksempel, den naturlige polymorfi i gen, pastrel (pst), bestemmer modtagelighed for DCV infektion i Drosophila34,35, mens loci Ubc-E2H og CG8492 er involveret i Cricket lammelse virus (CrPV) og Flock hus virus (FHV) infektion, henholdsvis36.

De særlige måder at etablere virus-værts-samspillet i fluer, skal vælges efter forskningsformål som en høj overførselshastighed skærmen til værten cellulære komponenter i Drosophila celle linjer37,38, mundtlige infektion at studere gut-specifikke antivirale svar22,39,40, nål pricking41,42 eller nano-injektion ved at passere epitelial barrierer for at stimulere systemisk immun svar. Nano-injektion kan netop kontrollere viral dosis for at fremkalde en kontrolleret antiviral reaktion og en fysiologisk læsion43, dermed garantere høj eksperimentelle reproducerbarhed44. I denne undersøgelse beskriver vi en nano-injektion metode for at studere virus-værtssammenspil i Drosophila, fremhæver betydningen af fluer baggrundseffekter.

Protocol

Bemærk: Før du starter eksperimentet, cellelinjer og flyve lagre brugt må ikke være forurenet med andre patogener, især for vira som DCV, FHV, Drosophila X virus (DXV) og aviær nefritis virus (ANV). Ideelt, RNA sekvensering eller en enklere PCR-baseret identifikation anvendes til at opdage forurening10,45. Hvis forureningen skete, cellelinjer og flyve bestande bør ikke anvendes mere indtil de dekontamineres helt46.

1. virus og flyve forberedelse

  1. Virus spredning og samling
    Bemærk: Drosophila S2 * celler anvendes til DCV formering og titrering. S2 * celle linjen stammer fra en primær kultur af sene fase D. melanogaster embryoner. Denne celle line har været godt beskrevet tidligere47.
    1. Vokse S2 * celler i Schneiders Drosophila Medium ved 25 ° C uden yderligere CO2, som en løs, semi-vedhængende éncellelag i en 10 cm celle kultur fad, med en tæthed på 1 x 107 levedygtige celler/mL. Brug komplet medium for S2 * celler: Schneiders Drosophila Medium indeholdende 10% varme inaktiveret FBS, 100 enheder/mL Penicillin og 100 μg/mL Streptomycin.
      Bemærk: Raske celler bør vise en rund form og udstille homogen størrelse.
    2. Hurtigt optø DCV lager fra-80 ° C i en 25 ° C vandbad. Inficere S2 * celler med DCV på MOI = 0,01 straks ved direkte tilsætning af 1 mL af virus løsning til celle kultur retter (vækstområde: 55 cm2) med 10 mL af komplet medium for S2 * celler.
    3. Inkuber celler ved 25 ° C i 3 til 5 dage. Når virus er klar til afhentning, celle morfologi er unormal (celle form ser blur) og substratet er fuld af sorte partikler vejledende celle debris.
    4. Indsamle de hele cellekultur i en 15 mL tube af pipettering op og ned og frys på-80 ° C (for op til et år).
      Bemærk: DCV kan opbevares i længere tid ved-80 ° C med minimalt tab af smitteevne, i op til et år.
    5. Tø cellekultur i en 25 ° C vandbad under konstant omrystning og derefter centrifugeres ved 6.000 x g i 15 min. ved 4 ° C. Indsamle supernatanten i en steril 15 mL rør og vortex. Alikvot op til 200 μl af virus løsning pr tube.
      Bemærk: Virus delprøver kan opbevares i korte perioder af op til 3 dage ved 4 ° C og i op til 1 år ved-80 ° C. Gentagne fryse-tø cykler bør undgås. Det er altid bedre at bruge alle alikvot på én gang.
    6. Pick 5 tilfældige virus-holdige rør til at bestemme den gennemsnitlige virus vævskultur smitsom dosis (TCID50) ved en cytopatisk effekt (CPE) assay (1 enhed af TCID50= 0,7 plak danner enhed [PFU]).
      Bemærk: CPE refererer til strukturelle ændringer i værtsceller forårsaget af viral invasion. Den inficerer virus forårsager lysering af vært-cellen, eller når cellen dør uden lysis på grund af manglende evne til at reproducere48.
      1. På dag 1, indsamle rede S2 * celler af pipettering. Tælle celle nummer. Centrifugeres celler for 300 x g i 4 min og supernatanten. Fortynd celler til densiteten af 1 x 106 celler/mL med komplet medium for S2 * celler som beskrevet i trin 1.1.1.
      2. Frø 1 x 105 S2 * celler (100 μL) pr. brønd til flad bund 96-brønd-plade, (~ 30% confluency).
      3. Udføre seriel 10-fold fortyndinger af DCV bestanden med komplet medium for S2 * celler. Tilsæt 50 µL fortyndinger i brønden. Tilsæt 50 µL af næringssubstratet uden virus til brønd klassificeret som den negative kontrol godt.
        Bemærk: For hver fortynding sats, 8 brønde blev brugt. Som det typiske DCV udbyttet er omkring 108-109 PFU/mL, skal fortynding mindst dække ~ 10-5-10-10.
      4. Dag 4, observere CPE med en lysfelt mikroskop med en 20 X eller 40 X mål. Klassificere en brønd, som cellerne ser sløret og medium er fuld af fragmenter som en "positiv godt", og en brønd, hvori celle morfologi er normalt som "negative godt".
      5. Mark CPE positive eller negative brønde med + eller-, henholdsvis. Beregne virussen TCID50 af Reed og Muench metode49.
    7. Bortskaf alle kontaminerede materialer og handsker i dekontaminering pan. Hvis virusen ikke kan nå de ønskede TCID50, koncentrere sig 100 mL af virus løsning ved centrifugering ved 68.000 x g i 1 time ved 4 ° C.
      Bemærk: afhængigt af formålet med forsøget, en række doser fra 102 til 106 TCID50 enheder kan bruges til virusinfektion. Vi bruger typisk 3 x 106 TCID50 enheder.
    8. Supernatanten og genopslæmmes i 1 mL af Tris-HCl buffer (10 mM, pH 7,2). Alikvot 20 μL af virus løsning pr. tube og opbevares ved-80 ° C. Pick 5 tilfældige rør til at bestemme den gennemsnitlige virus TCID50 igen.
  2. Flyve forberedelse for infektion
    Bemærk: Symbiotisk bakterier Wolbachia kan undertrykke mange slags RNA-virusinfektion i insekter30,31,32,33,41. Det er således vigtigt at rense Wolbachia fra fluer før studerer vært-virus infektion i vivo33.
    1. Forberede flyve mad der indeholder tetracyklin ved at tilføje 400 μL af 50 µg/mL tetracyclin (i 70% ethanol) til 4 g frisk standard cornmeal flyve mad (1 L af fødevarer indeholder 77,7 g majsmel, 32.19 g gær, 10,6 g agar, 0.726 g CaCl2 31.62 g saccharose, 63,3 g glucose, 2 g af kaliumsorbat og 15 mL 5% C8H8O3). Bland grundigt og markedsføre fødevarer ved 4 ° C natten over til at fordampe ethanol.
      Bemærk: En høj dosis af ethanol kan påvirke flyve fertilitet, så ikke udelade dette trin.
    2. Varm mad til stuetemperatur og sætte nyligt eclosed voksne fluer (20 hunner og 10 hanner) i hætteglasset. Opdrætte fluer ved 25 ° C, 60% fugtighed under en normal lys/mørke cyklus.
      Bemærk: Det tager typisk 3-4 dage for fluer at lægge nok æg. Alt for mange æg hæmme larver udvikling og mindske tetracyklin effektivitet.
    3. Indsamle nyligt eclosed voksne fluer (inden for 3 ~ 5 dage) under en let flow af CO2, og Gentag trin ~ 1.2.1-1.2.2. Typisk, mindst 3 generationer er nødvendige for en fuldstændig afskaffelse af Wolbachia.
    4. Efter 3 generationer med tetracyclin behandling, indsamle flyver 5 under en let flow af CO2 for Wolbachia infektion test. Grind fluer i 1 min. med 250 μL dobbeltdestilleret vand (ddH2O) og et par 0,5 mm sterile keramiske perler i 1,5 mL rør ved hjælp af en homogeniseringsapparat. Tilføje en anden 250 μL 2 x buffer A (0,2 M Tris-HCl, pH 9,0; 0,2 M EDTA; 2% SDS) til prøven og vortex.
      Bemærk: Da SDS vil hindre perle bevægelse, 1 x buffer A kan ikke direkte bruges til at slibe fluer. Hvis fluerne har røde øjne, fjerne hoveder inden slibning, da dette kan påvirke farven på DNA produkt.
    5. Fryse prøver på-80 ° C (holde i op til et år). Hurtigt optø den prøve fra-80 ° C i en 25 ° C vandbad indtil opløst. Inkuber prøver ved 70 ° C i 30 min.
    6. Tilføje 190 μl af 5 M KOAc, vortex og Ruger på isen til 15 min eller længere.
    7. Centrifugeres prøver på 13.000 x g i 5 min ved stuetemperatur, indsamle supernatanten og overføre dem til nye rør.
    8. Gentag trin 1.2.7 at få DNA med bedre kvalitet.
    9. Tilføje 750 μL af isopropanol til hver prøve og forsigtigt vendes et par gange i hånden. Inkuber ved stuetemperatur i 5 min.
    10. Centrifugeres prøver på 13.000 x g i 5 min ved stuetemperatur og supernatanten. Den hvide genomisk DNA pellet vil bo i bunden af røret.
    11. Der tilsættes 1 mL af 70% ethanol til pellets, centrifuger på 13.000 x g i 5 min, og supernatanten. Lufttørre DNA, indtil det bliver gennemsigtig.
    12. Opløse DNA i 100 μL af Hedeselskabet2O, titreres DNA koncentration af UV-Vis absorption spektrofotometri og fortyndes DNA til 100 ng/μl.
    13. Brug 200 ng af DNA til PCR reaktion (i en 20 μL system, se Tabel af materialer). Udføre PCR ved følgende program: 95 ° C i 15 min; 36 cyklus på 95 ° C til 45 s, 50 ° C til 45 s, og mindst 72 ° C i 1 min; og en sidste udvidelse trin (72 ° C i 1 min) i en termisk cycler.
      Bemærk: Baseret på Wolbachia 16S rRNA, bruge de følgende primere: 5' TGAGGAAGATAATGACGG 3' (frem) og 5' CCTCTATCCTCTTTCAACC 3' (omvendt). Wsp, primere var 5' CATTGGTGTTGGTGTTGGTG 3' (frem) og 5' ACCGAAATAACGAGCTCCAG 3' (omvendt).
    14. Analysere PCR produkter med 1% Agarosen gelelektroforese. Wolbachia 16S rRNA og wsp PCR produktstørrelse er omkring 200 bp og 600 bp, henholdsvis.
    15. Bageste Wolbachia gratis flyve bestand på standard cornmeal flyve mad. Indsamle 3-5 dages nyligt eclosed mandlige fluer for infektion.
      Bemærk: Tetracyclin behandling kan også påvirke tarmens mikrobiota sammensætning, som derefter påvirker antiviral svar i værten. Vi anbefaler, at alle fluer skal modtage de samme tetracyklin behandlinger. Holde Wolbachia-fri fluer vokser under standardbetingelser for mindst 3 generationer at genoprette gut mikrobiota.
  3. Pastrel genotypebestemmelse
    Bemærk: Tilstedeværelsen af S eller R-allel af pst genet i den genetiske baggrund er blevet rapporteret at påvirke DCV infektion i Drosophila34,35. Det er nødvendigt at kontrollere pst genotype, især for DCV infektion. Der er et par SNPs i pst , der kan påvirke virusinfektion, major SNP er 512 C/T. Temperaturgradient PCR er en hurtig metode til at identificere pst genotype.
    1. Ekstrakt flyve genomisk DNA som beskrevet ovenfor (trin 1.2.4 - 1.2.15).
    2. Brug 100 ng af DNA som skabelon, 512C primer, 5' CAGCATGGTGTCCATGAAGTC 3' (frem) og 5' ACGTGATCAATGCTGAAAGT 3' (omvendt) til at registrere R allel, 512T primer, 5' CAGCATGGTGTCCATGAAGTT 3' (frem) og 5' ACGTGATCAATGCTGAAAGT 3' (omvendt) til at registrere de S allel.
    3. Sæt Tm (smeltende temperatur) forløb som følger: 54 ° C, 54.7 ° C, 55.5 ° C, 58 ° C, 59.7 ° C, 62.2 ° C, 63,7 ° C og 64 ° C (45 s ved hver temperatur).
      Bemærk: 30 cyklusser af PCR kædereaktion anbefales (20 μL system).
    4. Visualiser 100-bp PCR produkt ved 2% Agarosen gelelektroforese.

2. virusinfektion i Drosophila

  1. Inficere fluer ved nano-injektion og udføre overlevelse assays.
    1. Trække kapillærer for at forberede injektion nåle, back-fill injektion nål med olie og samle injektor som tidligere beskrevet50.
    2. Anaesthetize fluer på pad under en let flow af CO2. Podes fluer af intra thorax injektion44 af 50,6 nL af virus løsning (100 PFU, fortyndet med Tris-HCl buffer, pH 7,2). Indsprøjtes mindst 3 hætteglas af fluer (20 fluer per vial).
      Bemærk: Injektion er tidskrævende (generelt 100 fluer per time) og DCV replikering er meget hurtig, så det er meget vigtigt at nedskrive den nøjagtige tid på tuben når efterbehandling hvert hætteglas (20 fluer). Bufferen kun injektion er angivet som en mock kontrol. Normalt er mandlige voksne fluer foretrukne, som resultaterne er mere stabil og reproducerbar end når ved hjælp af hunner da hormonelle udsving under parring og reproduktion kan påvirke udlæsning af hunner51.
    3. Vokse injiceres fluer ved 25 ° C, 60% fugtighed under en normal lys/mørke cyklus. Levere fluer med frisk mad dagligt og registrere antallet af døde flies.
    4. Udføre mindst 3 biologiske replikater og plot overlevelse kurven.
    5. Generere Kaplan-Meier overlevelse kurver af statistisk software til statistisk analyse af overlevelsesdata. Udfør log-rank test for at beregne P-værdier. Angiv oplysninger for hvert emne på tabellen overlevelse. Softwaren derefter beregner procent overlevelse på hver gang, og afbilder en Kaplan-Meier overlevelse plot.
      Bemærk: Må ikke tilsættes ekstra gær i hætteglasset. Sammenlignes med forlorne kontrolelementer, DCV-inficerede fluer lejlighedsvis have ascites og er klodset, som gør dem sårbare over for den klæbrige gær. Det er bedre at optage flere tidspunkter i den foreløbige eksperiment at finde ud af en gang indramme hvor den massive død vil ske for inficerede fluer. Generelt, de inficerede flyver sjældent dø inden for de første to dage, selv for Dcr-2 mutant linjer. For den Wolbachia gratis w1118 (Bloomington 5905) flyve inficeret med 100 PFU af DCV, er dette tidsvindue omkring 3-5 dage efter infektion. Bananfluer, der dør inden for 0,5 h post injektion timer bør ikke medregnes som en trafikdræbt fordi de kan blive dræbt af nålen skade ikke af virusinfektion.
  2. DCV indlæse foranstaltning af CPE assay
    Bemærk: Viral belastning er målt på samme måde til titrering af virus stock (trin 1.1.6) men kræver yderligere Prøveforberedelse (trin 2.2.1-2.2.4).
    1. På dag 1, inficere mandlige fluer som beskrevet i trin 2.1.1-2.1.2. Gruppere injiceres fluer i grupper af 20 og holde dem vokser på frisk flyve mad til den ønskede tid (typisk for 24 h eller 3 dage). Give fluer med frisk mad dagligt.
    2. På dag 2, frø Drosophila S2 * celler i en 10 cm celle kultur parabol til tætheden af ca 5 x106 til 1 x 107 celler/mL som beskrevet i trin 1.1.1.
    3. På dag 3, indsamle 5 fluer (under en let flow af CO2) og male dem i en 1,5 mL centrifugeglas for 30 s med 200 μl af Tris buffer og keramiske perler ved hjælp af homogeniseringsapparat. Gemme prøver på-80 ° C eller straks gå videre til næste trin.
    4. Grundigt vortex prøven. Bruge en 1 mL sprøjte og 0,22 μm filter til at filtrere supernatanten til en ny 1,5 mL tube. Fortsæt med titrering, som beskrevet i trin 1.1.6.1-1.1.6.5.
  3. DCV belastning målt ved qRT-PCR
    1. På dag 1, inficere fluer som beskrevet ovenfor. Gruppe injiceres mandlige fluer (20 fluer/gruppe) og vokse på frisk flyve mad for ønskede tid, typisk for 24 h eller 3 dage. Give fluer med frisk mad dagligt.
    2. På dag 3, indsamle 5 fluer under en let flow af CO2 i 1,5 mL rør med 200 μL lysisbuffer og 20 keramik perler (diameter = 0.5 mm), slibe prøver af homogeniseringsapparat med høj hastighed til 30 s. tilføje 800 μL af yderligere lysisbuffer til hver tube og gemme s amples ved-80 ° C eller straks foretage RNA udvinding og qRT-PCR.
    3. Forberede RNase gratis tips, rør og deioniseret, diethylpyrocarbonate (DEPC) behandles og 0,22 µm membran-filtreret vand. Tilføje 200 μl chloroform (≥99.5%) til prøven og energisk omrystes i 15 s i hånden. Inkuber i 5 min eller længere ved stuetemperatur indtil den vand og den organiske fase er klart adskilt.
      Bemærk: Chloroform er ekstremt farlige og skal håndteres med omhu. Gør ikke vortex stikprøven, hvilket vil øge risikoen for DNA forurening.
    4. Centrifuge prøver på 13.000 x g i 15 min. ved 4 ° C.
    5. Indsamle 400 μL af supernatanten og overføre supernatanten til nye rør. Bland med den samme rumfangsdele isopropanol (≥ 99,5%) forsigtigt vendes prøverne for 20 gange i hånden og derefter bundfald i 10 minutter eller længere ved stuetemperatur.
      Bemærk: Nedbør ved-20 ° C vil øge RNA udbytte.
    6. Centrifuge prøver på 13.000 x g i 10 min. ved 4 ° C. Hvid RNA pellets er synlig i bunden af røret.
    7. Supernatanten og tilsættes 1 mL af 70% ethanol (ethanol i DEPC vand) og invertere par gange at vaske RNA.
    8. Centrifuge prøver på 13.000 x g i 5 min. ved 4 ° C. Kassér den supernatanten og tør RNA for 5-10 min. RNA bør være gennemsigtig.
    9. Tilsættes 50 μL DEPC vand til prøven, pipette til par gange og vortex.
    10. Tage 3 μL af RNA for tilsætningen af RNA-koncentrationen. Kvantificere RNA på 260 nm. Normalt, er RNA-koncentrationen udvundet af denne protokol ca 100-500 μg/μL, som er egnet til cDNA syntese.
    11. Brug 2 μg af RNA til cDNA syntese. Fortyndes prøven til 100 μL med ddH2O og opbevares ved-20 ° C.
    12. Udføre qRT-PCR ifølge producentens anvisninger og køre qRT-PCR.
      Bemærk: CDNA syntese af DCV, tilfældige primere arbejdet meget bedre end Poly A primer i vores hænder. DCV mRNA udtryk er normaliseret til endogene ribosomale protein 49 (rp49) mRNA. Oligonukleotid primere anvendes i denne del: rp49 5' AGATCGTGAAGAAGCGCACCAAG 3' (frem) og 5' CACCAGGAACTTCTTGAATCCGG 3' (bagsiden); DCV, 5' TCATCGGTATGCACATTGCT 3' (frem) og 5' CGCATAACCATGCTCTTCTG 3' (bagsiden); Vago, 5' TGCAACTCTGGGAGGATAGC 3' (frem) og 5' AATTGCCCTGCGTCAGTTT 3' (bagsiden); virus-induceret RNA 1 (vir-1) 5' GATCCCAATTTTCCCATCAA 3' (frem) og 5' GATTACAGCTGGGTGCACAA 3' (omvendt).

Representative Results

Resultaterne af dette afsnit er fremstillet efter DCV infektion af D. melanogaster. Figur 1 viser flowdiagram af virusinfektion i Drosophila. Fluer er indsprøjtet intra-thoracically, og derefter prøver indsamles til måling af den virale TCID50 og genom RNA niveau (figur 1). Virusinfektion kan fremkalde celle lysis og CPE er observeret på 3 dage efter infektion (figur 2A). Virus belastning målt af CPE assay måles i overensstemmelse med det af qPCR (figur 2B). Som vist i figur 3, hæmmer Wolbachia DCV infektion i Drosophila. WOL-16s rRNA og wsp primere anvendes til at opdage Wolbachia tilstedeværelse (figur 3A) og Wolbachia-gratis fluer viser betydeligt nedsat overlevelsesrate efter DCV infektion (figur 3B). Figur 4 viser hvordan man kan kontrollere pst polymorfi af gradient PCR ved hjælp af specifikke primere. Figur 5 viser dosis afhængige effekter af DCV infektion i vildtype flyve. Overlevelsesraten i figur 5A og virus belastning på 3 dage efter infektion er vist i figur 5B. Figur 6 viser, at DCV infektion kan aktivere den Dcr2/RNAi og JAK/STAT antiviral signalering veje i vært52. Det udtryk reporter gen vago udtryk for Dcr2/RNAi pathway er forhøjet 3 dage efter infektion (figur 6A). JAK-STAT pathway er også aktiveret på DCV infektion, som er angivet af udtrykket niveau af reporter gen vir-1 (fig. 6B). Figur 7 viser, at Dcr2/RNAi pathway er kritisk for antiviral infektion i Drosophila52. DCR-2 mutant fluer har en nedsat overlevelse (figur 7A) og en øget virus belastning (figur 7B) efter DCV infektion.

Figure 1
Figur 1: Flow chart Drosophila infektion og virus belastning analyse.
Oprettelse af Drosophila infektion af nano-injektion. Skema diagram viser at fluer er smittet intra-thoracically og denne virus belastning er målt af CPE assay og qRT-PCR. Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2: DCV load analyse.
Virus belastning målt af CPE assay måles i overensstemmelse med det af qPCR. (A) S2 * celler er kulturperler ved 25 ° C i 3 dage med en anden virus fortynding (50 μl). 1 enhed TCID50 af brugte virus er 4,29 x 109 (svarende til 3 x 109 PFU/mL). Første panel, 10-3 fortynding; anden panel, 10-7 fortynding; tredje panel, 10-10 fortynding; tilbage panel infektion. Celler i panelet et og to viser de typiske CPE positive fænotype (hvide pile angiver celle debris), og celler i panelet tre og fire vise den typiske negative fænotype. Skalalinjen er angivet i figur. (B) måling af DCV belastning af qPCR. Udføre seriel 10-fold fortyndinger af DCV og inficere cellelinie S2 *. Den samlede RNA af inficerede celler er udvundet og qPCR udføres for at måle DCV RNA niveau. Gradient smitsomme virusmængden (bestemmes af CPE assay) i celler er afstemt og positivt relateret til måling af qPCR (r2= 0.999). Venligst klik her for at se en større version af dette tal.

Figure 3
Figur 3: Viral infektion af fluer med eller uden Wolbachia.
Wolbachia infektion bidrager til DCV modstandsbevægelse i Drosophila. (A) Wolbachia tilstedeværelse er opdaget af wol-16s rRNA og wsp primere. G1, G2 og G3 repræsenteret malmrfluer (Oregon-R) (Bloomington 5) behandles af tetracyclin for en, to og tre generationer henholdsvis. PCR produktstørrelse er omkring 200 bp (wol-16s rRNA) og 600 bp (wsp). (B) Wolbachia gratis fluer er mere følsomme over for DCV infektion. 3-5 dages gamle mandlige voksne fluer er injiceret med 100 PFU af DCV. Wolbachia gratis flyver (streger) viser betydeligt nedsat overlevelse end Wolbachia beskyttet flyver (nedslå linier) på DCV infektion. To forskellige vildtype linjer, OreRasmussen og w1118, der anvendes for overlevelse analyse og viser tilsvarende resultat. Alle fejllinjer repræsenterer standardfejl (s.e.) af mindst tre uafhængige tests; * P < 0,05, ** P < 0,01, *** P < 0,001, *** P < 0.0001, ns, ikke betydelig. Kaplan-Meier (B). Venligst klik her for at se en større version af dette tal.

Figure 4
Figur 4: Pastrel genotypebestemmelse af gradient PCR.
PST polymorfi er verificeret af gradient PCR. Gradient PCR er udført for at skelne pst Rasmussen (512 C) og Sørensen (512T) allel i Drosophila voksen. TM gradienter er a: 54 ° C, b: 54.7 ° C, c: 55.5 ° C, d: 58 ° C, e: 59.7 ° C, f: 62.2 ° C, g: 63,7 ° C, h: 64 ° C.  Venligst klik her for at se en større version af dette tal.

Figure 5
Figur 5: Overlevelsesrate og DCV titer af malmr fluer inficeret med en anden dosis af DCV.
Malmrfluer er injiceret med tre forskellige doser af DCV, 10 PFU/flyve, 50 PFU/flyve og 100 PFU/flyve. (A) fluer overlevelsesrate er betydeligt lavere, når inficeret med højere smitsomme doser. (B) DCV RNA niveau i hele kroppen af angivne fluer er målt af qRT-PCR på det angivne tidspunkt og normaliseret til 10 PFU/flyve podning gruppe. Alle fejllinjer repræsenterer standardfejl (s.e.) af mindst tre uafhængige tests; * P < 0,05, ** P < 0,01, *** P < 0,001, *** P < 0.0001, ns, ikke betydelig. Kaplan-Meier (A) eller en-vejs anova (B). Venligst klik her for at se en større version af dette tal.

Figure 6
Figur 6: Dcr2/RNAi og JAK/STAT antiviral signalering pathway aktiveret efter DCV infektion.
Malmrfluer var inficeret med 100 PFU af DCV. Vago (A) og vir-1 (B) mRNA udtrykt i hele kroppen er målt af qRT-PCR på angivne tid point efter infektion. Ændringen af udtryk er normaliseret til de basale niveau før infektionen. Alle fejllinjer repræsenterer standardfejl (s.e.) af mindst tre uafhængige tests; * P < 0,05, ** P < 0,01, *** P < 0,001, *** P < 0.0001, ns, ikke betydelig. En-vejs ANOVA (A, B). Venligst klik her for at se en større version af dette tal.

Figure 7
Figur 7: Dcr-2 mutant flyve følsomme til DCV infektion.
DCR-2 mutant flyver og dens genetiske kontrol w1118 fluer var inficeret med 100 PFU af DCV. (A) overlevelsesrater Dcr-2 mangelfuld fluer og wild-type (w1118) fluer efter DCV infektion. (B) DCV RNA niveau i hele kroppen af angivne fluer er målt af qRT-PCR 2 dage efter infektion og normaliserede end w1118. Alle fejllinjer repræsenterer standardfejl (s.e.) af mindst tre uafhængige tests; * P < 0,05, ** P < 0,01, *** P < 0,001, *** P < 0.0001, ns, ikke betydelig. Kaplan-Meier (A) eller student's T-test (B). Venligst klik her for at se en større version af dette tal.

Discussion

I denne artikel præsenterer vi en detaljeret procedure om, hvordan at skabe en viral smitsomme system i voksen Drosophila melanogaster ved hjælp af nano-injektion. Protokollerne omfatter udarbejdelsen af passende flyve linjer og virus lager, infektion teknikker, evaluering af smitsomme indikatorer og måling af de antivirale svar. Selvom DCV bruges som et eksempel på en viral patogen, har snesevis af forskellige slags virus været anvendt med succes til undersøgelse i Drosophila system. Derudover er hundredvis af regulerende faktorer, enten virus eller værten, blevet identificeret gennem omfattende screening i fluer. Således, denne metode er meget fleksibel og ikke begrænser til DCV /Drosophila interaktion.

For at kunne udbrede og høste høj titer DCV, skal der træffes nogle forholdsregler. Celler skal være sunde, kulturperler med en passende tæthed og høstet på tid. At reducere cellevolumen kultur påvirker ikke væsentligt virus titer. Typisk 107 celler inficeret med DCV på MOI = 0,01 vil endelig udbyttet anslået 108-109 TCID50 af DCV, som kan opfylde kravene, som de fleste i vivo og in vitro- eksperimenter. CPE assay og qRT-PCR assay er beskrevet i denne protokol til måling af virus belastning. CPE assay er noget tricky. Den passende tæthed af celle podning og en erfaren standard af positive/negative CPE diskrimination giver mulighed for en hurtig og vellykket CPE assay. Dermed, vi leverer en nem qRT-PCR assay her for at hjælpe med at bestemme fortynding skæringspunkt i CPE assay før mastering CPE assay.

DCV er imidlertid en meget potent virus for voksen flue og Drosophila cellelinie. Kun 100 PFU/flyve podning kan dræbe 50% af vilde fluer inden 5 dage. En overskydende infektion dosis kan skygge betydning mellem vildtype flyve og potentielle modtagelige linjer. Det er vigtigt at anvende mindst to infektion doser, når indlede en ny skærm. Da den massive død af Drosophila kan ske i en meget kort tidsvindue på grund af den høje dødelighed af DCV, anbefales optagelse død antallet oftere i indledende forsøg kraftigt. Efter DCV infektion har nogle fluer lejlighedsvis ascites syndrom. Navnlig, bør fluer, der dør inden for 0,5 h efter infektion udelukkes, som kan være forårsaget af uhensigtsmæssige nål injektion skade.

DCV smitsomme styrke påvirkes også af mange vært faktorer, som bør overvejes før du starter et eksperiment. Wolbachia er en lodret sender endosymbiont, der har stor indflydelse på virusinfektion i fluer32. Tetracyclin behandling i fly mad er en fælles metode til at fjerne Wolbachia infektion. Men denne metode også ændrer tarmens mikrobiota sammensætning, som kan påvirke antiviral svar53. Et par undersøgelser har understreget betydningen af genetiske varians på virus infektion36, f.eks ubc-e2h, cg8492 og pst. For eksempel, de fleste vildtype flyve linjer har pst S allel og er følsomme over for picorna-lignende virus, mens de fleste mutant linjer vi testet fra Bloomington stock center har pst R allel, således at have resistente fænotyper. Det er meget vigtigt at udelukke virkningerne af pst, især når frasortere en resistens gen sammenligne med vildtype kontrol29.

Udover nano-injektion til at fremkalde systemisk virusinfektion, findes andre metoder til at studere virusinfektion i fluer. Drosophila cellelinjer har vist sig at være en høj overførselshastighed metode til at frasortere virusinfektion relateret vært cellulære komponent37,38. Men en in vitro- systemet er altid ledsaget med et stort antal falske positiver, når bekræfter in vivo. DCV kan også anvendes til at inficere Drosophila oralt, hvorimod det kan kun udløse en begrænset og mildere infektion. Kun 20% af larver var inficeret inden for 12 timer og 14% dødelighed blev observeret, med kun 25% flyver dødelighed i 20 dage i voksen22. Prikkende fluer med 0,15 mm diameter benene er en anden måde at indstille viral infektion men det kan ikke sikre nøjagtige infektion dosis og kvantitative repeterbarhed. Overekspression virale proteiner af genmanipulation i fluer er en god måde at studere molekylære interactomes in vivo7. Dog kan det ikke skildre virkeligheden i fysiologi og patologi i vært ved infektion. I mellemtiden, nano-injektion metode også har ulemper, da det er ikke den naturlig rute for smitte og kan direkte stimulerer et stærkt immunrespons lige efter infektion, som omgås neglebånd, den første antiviral forsvarslinje. I sum er specifikke forskning formål og tilgængelige eksperimentelle tilstand de afgørende faktorer i valg blandt forskellige metoder.

Disclosures

Forfatterne har ikke noget at oplyse.

Acknowledgments

Vi vil gerne takke hele Pan laboratoriet i IPS. CAS. Vi takker Dr. Lanfeng Wang (IPS, CAS) for eksperimenterende bistand og Dr. Gonalo Cordova Steger (Springer natur), Dr. Jessica VARGAS (IPS, Paris) og Dr. Seng Zhu (IPS, Paris) for kommentarer. Dette arbejde blev støttet af tilskud fra den strategiske prioritet Research Program af kinesiske Academy of Sciences Larsen (XDA13010500) og Vivi Hansen (XDB29030300), National Natural Science Foundation of China Larsen (31870887 og 31570897) og J.Y (31670909). Larsen er en fellow af CAS ungdom Innovation fremme Association (2012083).

Materials

Name Company Catalog Number Comments
0.22um filter Millipore SLGP033RS
1.5 ml Microcentrifuge tubes Brand 352070
1.5 ml RNase free Microcentrifuge tubes Axygen MCT-150-C
10 cm cell culture dish Sigma CLS430167 Cell culture
100 Replacement tubes Drummond Scientific 3-000-203-G/X
15 ml tube Corning 352096
ABI 7500 qPCR system ABI 7500 qPCR
Cell Incubator Sanyo MIR-553
Centriguge Eppendof 5810R
Centriguge Eppendof 5424R
Chloroform Sigma 151858 RNA extraction
DEPC water Sigma 95284-100ML RNA extraction
Drosophila Incubator Percival I-41NL Rearing Drosophila
FBS Invitrogen 12657-029 Cell culture
flat bottom 96-well-plate Sigma CLS3922 Cell culture
Fluorescence microscope Olympus DP73
Isopropyl alcohol Sigma I9516 RNA extraction
Lysis buffer (RNA extraction) Thermo Fisher 15596026 TRIzol Reagent
Lysis buffer (liquid sample RNA extraction) Thermo Fisher 10296028 TRIzol LS Reagent
Microscope Olympus CKX41
Nanoject II Auto-Nanoliter Injector Drummond Scientific 3-000-204 Nanoject II Variable Volume (2.3 to 69 nL) Automatic Injector with Glass Capillaries (110V)
Optical Adhesive Film ABI 4360954 qPCR
Penicillin-Streptomycin, Liquid Invitrogen 15140-122 Cell culture
qPCR plate ABI A32811 qPCR
Schneider’s Insect Medium Sigma S9895 Cell culture
statistical software GraphPad Prism 7
TransScript Fly First-Strand cDNA Synthesis SuperMix TransScript AT301 RNA extraction
Vortex IKA VORTEX 3 RNA extraction

DOWNLOAD MATERIALS LIST

References

  1. Rahim, M. A., Uddin, K. N. Chikungunya: an emerging viral infection with varied clinical presentations in Bangladesh: Reports of seven cases. BMC Research Notes. 10, 410 (2017).
  2. Douam, F., Ploss, A. Yellow Fever Virus: Knowledge Gaps Impeding the Fight Against an Old Foe. Trends in Microbiology. (2018).
  3. Santiago, G. A., et al. Performance of the Trioplex real-time RT-PCR assay for detection of Zika, dengue, and chikungunya viruses. Nature Communications. 9. 9, 1391 (2018).
  4. Gould, E., Pettersson, J., Higgs, S., Charrel, R., de Lamballerie, X. Emerging arboviruses: Why today? One Health. 4, 1-13 (2017).
  5. Hughes, T. T., et al. Drosophila as a genetic model for studying pathogenic human viruses. Virology. 423, 1-5 (2012).
  6. Xu, J., Cherry, S. Viruses and antiviral immunity in Drosophila. Developmental & Comparative Immunology. 42, 67-84 (2014).
  7. Shirinian, M., et al. A Transgenic Drosophila melanogaster Model To Study Human T-Lymphotropic Virus Oncoprotein Tax-1-Driven Transformation In Vivo. Journal of Virology. 89, 8092-8095 (2015).
  8. Adamson, A. L., Chohan, K., Swenson, J., LaJeunesse, D. A Drosophila model for genetic analysis of influenza viral/host interactions. Genetics. 189, 495-506 (2011).
  9. Hao, L., et al. Drosophila RNAi screen identifies host genes important for influenza virus replication. Nature. 454, 890-893 (2008).
  10. Webster, C. L., et al. The Discovery, Distribution, and Evolution of Viruses Associated with Drosophila melanogaster. Plos Biology. 13, e1002210 (2015).
  11. Heigwer, F., Port, F., Boutros, M. RNA Interference (RNAi) Screening in Drosophila. Genetics. 208, 853-874 (2018).
  12. West, C., Silverman, N. p38b and JAK-STAT signaling protect against Invertebrate iridescent virus 6 infection in Drosophila. PLOS Pathogens. 14, e1007020 (2018).
  13. Liu, Y., et al. STING-Dependent Autophagy Restricts Zika Virus Infection in the Drosophila Brain. Cell Host & Microbe. 24, 57-68 (2018).
  14. Wang, X. H., et al. RNA interference directs innate immunity against viruses in adult Drosophila. Science. 312, 452-454 (2006).
  15. van Rij, R. P., et al. The RNA silencing endonuclease Argonaute 2 mediates specific antiviral immunity in Drosophila melanogaster. Genes & Development. 20, 2985-2995 (2006).
  16. Deddouche, S., et al. The DExD/H-box helicase Dicer-2 mediates the induction of antiviral activity in drosophila. Nature Immunology. 9, 1425-1432 (2008).
  17. Chotkowski, H. L., et al. West Nile virus infection of Drosophila melanogaster induces a protective RNAi response. Virology. 377, 197-206 (2008).
  18. Paradkar, P. N., Trinidad, L., Voysey, R., Duchemin, J. B., Walker, P. J. Secreted Vago restricts West Nile virus infection in Culex mosquito cells by activating the Jak-STAT pathway. Proceedings of the National Academy of Sciences of the United States of America. 109, 18915-18920 (2012).
  19. Souza-Neto, J. A., Sim, S., Dimopoulos, G. An evolutionary conserved function of the JAK-STAT pathway in anti-dengue defense. Proceedings of the National Academy of Sciences of the United States of America. 106, 17841-17846 (2009).
  20. Zambon, R. A., Nandakumar, M., Vakharia, V. N., Wu, L. P. The Toll pathway is important for an antiviral response in Drosophila. Proceedings of the National Academy of Sciences of the United States of America. 102, 7257-7262 (2005).
  21. Costa, A., Jan, E., Sarnow, P., Schneider, D. The Imd pathway is involved in antiviral immune responses in Drosophila. PLoS One. 4, e7436 (2009).
  22. Ferreira, A. G., et al. The Toll-dorsal pathway is required for resistance to viral oral infection in Drosophila. PLOS Pathogens. 10, e1004507 (2014).
  23. Moy, R. H., et al. Antiviral autophagy restrictsRift Valley fever virus infection and is conserved from flies to mammals. Immunity. 40, 51-65 (2014).
  24. Shelly, S., Lukinova, N., Bambina, S., Berman, A., Cherry, S. Autophagy is an essential component of Drosophila immunity against vesicular stomatitis virus. Immunity. 30, 588-598 (2009).
  25. Bronkhorst, A. W., et al. The DNA virus Invertebrate iridescent virus 6 is a target of the Drosophila RNAi machinery. Proceedings of the National Academy of Sciences of the United States of America. 109, E3604-E3613 (2012).
  26. Palmer, W. H., Medd, N. C., Beard, P. M., Obbard, D. J. Isolation of a natural DNA virus of Drosophila melanogaster, and characterisation of host resistance and immune responses. PLOS Pathogens. 14, e1007050 (2018).
  27. Jousset, F. X., Bergoin, M., Revet, B. Characterization of the Drosophila C virus. Journal of General Virology. 34, 269-283 (1977).
  28. Gupta, V., Stewart, C. O., Rund, S. S. C., Monteith, K., Vale, P. F. Costs and benefits of sublethal Drosophila C virus infection. J Evol Biol. 30, 1325-1335 (2017).
  29. Yang, S., et al. Bub1 Facilitates Virus Entry through Endocytosis in a Model of Drosophila Pathogenesis. Journal of Virology. (2018).
  30. Teixeira, L., Ferreira, A., Ashburner, M. The bacterial symbiont Wolbachia induces resistance to RNA viral infections in Drosophila melanogaster. Plos Biology. 6, e2 (2008).
  31. Ferguson, N. M., et al. Modeling the impact on virus transmission of Wolbachia-mediated blocking of dengue virus infection of Aedes aegypti. Science Translational Medicine. 7, 279ra237 (2015).
  32. Hedges, L. M., Brownlie, J. C., O'Neill, S. L., Johnson, K. N. Wolbachia and virus protection in insects. Science. 322, 702 (2008).
  33. Bhattacharya, T., Newton, I. L. G., Hardy, R. W. Wolbachia elevates host methyltransferase expression to block an RNA virus early during infection. PLOS Pathogens. 13, e1006427 (2017).
  34. Magwire, M. M., et al. Genome-wide association studies reveal a simple genetic basis of resistance to naturally coevolving viruses in Drosophila melanogaster. PLOS Genetics. 8, e1003057 (2012).
  35. Cao, C., Cogni, R., Barbier, V., Jiggins, F. M. Complex Coding and Regulatory Polymorphisms in a Restriction Factor Determine the Susceptibility of Drosophila to Viral Infection. Genetics. 2159-2173 (2017).
  36. Martins, N. E., et al. Host adaptation to viruses relies on few genes with different cross-resistance properties. Proceedings of the National Academy of Sciences of the United States of America. 111, 5938-5943 (2014).
  37. Moser, T. S., Sabin, L. R., Cherry, S. RNAi screening for host factors involved in Vaccinia virus infection using Drosophila cells. Journal of Visualized Experiments. (2010).
  38. Zhu, F., Ding, H., Zhu, B. Transcriptional profiling of Drosophila S2 cells in early response to Drosophila C virus. Journal of Virology. 10, 210 (2013).
  39. Ekstrom, J. O., Hultmark, D. A Novel Strategy for Live Detection of Viral Infection in Drosophila melanogaster. Scientific Reports. 6, 26250 (2016).
  40. Durdevic, Z., et al. Efficient RNA virus control in Drosophila requires the RNA methyltransferase Dnmt2. EMBO Reports. 14, 269-275 (2013).
  41. Chrostek, E., et al. Wolbachia variants induce differential protection to viruses in Drosophila melanogaster: a phenotypic and phylogenomic analysis. PLOS Genetics. 9, e1003896 (2013).
  42. Gupta, V., Vale, P. F. Nonlinear disease tolerance curves reveal distinct components of host responses to viral infection. Royal Society Open Science. 4, 170342 (2017).
  43. Chtarbanova, S., et al. Drosophila C virus systemic infection leads to intestinal obstruction. Journal of Virology. 88, 14057-14069 (2014).
  44. Merkling, S. H., van Rij, R. P. Analysis of resistance and tolerance to virus infection in Drosophila. Nature Protocols. 10, 1084-1097 (2015).
  45. Goic, B., et al. RNA-mediated interference and reverse transcription control the persistence of RNA viruses in the insect model Drosophila. Nature Immunology. 14, 396-403 (2013).
  46. Ashburner, M., Golic, K., Hawley, R. S. Drosophila: A Laboratory Handbook. Cold Spring Harbor Laboratory Press. (2011).
  47. Biochemical and Biophysical Research Communications: 1991 index issue. Cumulative indexes for volumes 174-181. Biochemical and Biophysical Research Communications. 1-179 (1991).
  48. Cotarelo, M., et al. Cytopathic effect inhibition assay for determining the in-vitro susceptibility of herpes simplex virus to antiviral agents. Journal of Antimicrobial Chemotherapy. 44, 705-708 (1999).
  49. Reed, L. J. M., H, A simple method of estimating fifty percent endpoints. The American Journal of Hygiene. 27, 493-497 (1938).
  50. Khalil, S., Jacobson, E., Chambers, M. C., Lazzaro, B. P. Systemic bacterial infection and immune defense phenotypes in Drosophila melanogaster. Journal of Visualized Experiments. e52613 (2015).
  51. Schwenke, R. A., Lazzaro, B. P. Juvenile Hormone Suppresses Resistance to Infection in Mated Female Drosophila melanogaster. Current Biology. 27, 596-601 (2017).
  52. Sabin, L. R., Hanna, S. L., Cherry, S. Innate antiviral immunity in Drosophila. Current opinion in immunology. 22, 4-9 (2010).
  53. Yin, J., Zhang, X. X., Wu, B., Xian, Q. Metagenomic insights into tetracycline effects on microbial community and antibiotic resistance of mouse gut. Ecotoxicology. 24, 2125-2132 (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics