Konvertering av Human indusert pluripotent Stem Cells (iPSCs) i funksjonell spinal og skallen motor neurons bruke PiggyBac vektorer

Neuroscience

Your institution must subscribe to JoVE's Neuroscience section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Denne protokollen gir rask og effektiv konvertering av indusert Pluripotent stamceller i motoriske neurons med en spinal eller skallen identitet, ved svangerskap utenfor livmoren av transkripsjon faktorer fra induserbart piggyBac vektorer.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Garone, M. G., de Turris, V., Soloperto, A., Brighi, C., De Santis, R., Pagani, F., Di Angelantonio, S., Rosa, A. Conversion of Human Induced Pluripotent Stem Cells (iPSCs) into Functional Spinal and Cranial Motor Neurons Using PiggyBac Vectors. J. Vis. Exp. (147), e59321, doi:10.3791/59321 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Vi beskriver her en metode for å få funksjonell spinal og skallen motor neurons fra humant indusert Pluripotent stamceller (iPSCs). Direkte konvertering til motoriske nervecellen er oppnådd ved svangerskap utenfor livmoren uttrykk for alternative moduler av transkripsjon faktorer, nemlig Ngn2, Isl1 og Lhx3 (NIL) eller Ngn2, Isl1 og Phox2a (NIP). NIL og NIP spesifisere, henholdsvis, spinal og skallen motorisk Nevron identitet. Vår protokoll starter med generering av modifiserte iPSC linjer der NIL eller NIP er stabilt integrert i Genova via en piggyBac Transposon vektor. Uttrykk for transgenes blir deretter indusert av Doxycycline og fører, i 5 dager, til konvertering av iPSCs i MN forfedre. Påfølgende modning, for 7 dager, fører til homogene populasjoner av spinal eller skallen MNs. Vår metode har flere fordeler fremfor tidligere protokoller: det er ekstremt rask og forenklet; det krever ikke viral infeksjon eller ytterligere MN isolasjon; Det gjør det mulig å generere ulike MN subpopulasjoner (spinal og skallen) med en bemerkelsesverdig grad av modning, som demonstrert av evnen til brann tog av handlingen potensialer. Videre kan et stort antall motoriske neurons fås uten rensing fra blandede populasjoner. iPSC-avledet spinal og skallen motor neurons kan brukes til in vitro modellering av amyotrofisk lateral sklerose og andre nevrodegenerative sykdommer i motorisk Nevron. Homogen motorisk Nevron populasjoner kan representere en viktig ressurs for celle type bestemt legemiddel screenings.

Introduction

Motoriske Nevron (MN) degenerasjon spiller en utløsende rolle i menneskelige sykdommer som amyotrofisk lateral sklerose (ALS) og spinal muskel atrofi (SMA). Etablering egnet in vitro celle modellsystemer som recapitulate kompleksiteten i den menneskelige MN er et viktig skritt mot utviklingen av nye terapeutiske tilnærminger. Indusert Pluripotent stamceller (iPSCs), som er utstyrt med bemerkelsesverdig plurilineage differensiering egenskaper, har nå blitt avledet fra en rekke pasienter rammet av motoriske Nevron sykdommer1,2. Ytterligere iPSC linjer bærer patogene mutasjoner knyttet til MN sykdommer har blitt generert av genredigering, fra kontroll "sunn" Pluripotent stamceller3. Disse linjene representerer nyttige verktøy for in vitro sykdom modellering og narkotika screening, forutsatt at hensiktsmessige metoder for iPSC differensiering inn MNs er tilgjengelig. Begrunnelsen for utviklingen av denne metoden er å gi det vitenskapelige samfunnet interessert i MN sykdommer med en rask og effektiv differensiering protokollen gir opphav til eldre funksjonell MNs. Den første fordelen med denne metoden er dens tidsramme for utførelse. En annen relevant punkt av styrke kommer fra eliminering av eventuelle rensing trinn. Endelig protokollen kan brukes til å generere to forskjellige populasjoner av motor neurons.

Muligheten for å generere ulike under typer av MNs er spesielt relevant for modellering av MN sykdommer. Ikke alle MN under typer er like sårbare i ALS og SMA og utbruddet av symptomene i ulike motor enheter i stor grad påvirker prognosen. I ALS, spinal utbruddet med symptomer som starter i øvre og nedre lemmer fører til døden i ca 3-5 år4. Omvendt, bulbar utbruddet, og starter med degenerasjon av skallen MNs, har en verste prognose. Videre er prosentandelen av bulbar utbruddet signifikant høyere hos pasienter med mutasjoner i RNA-bindende proteiner FUS og TDP-43 enn hos personer med SOD1 mutasjoner5. Nesten helheten av alternative MN differensiering protokoller er avhengig av aktiviteten til retinoic acid (ra), som tildeler en spinal karakter å skille iPSCs6,7,8. Dette begrenser muligheten for å studere indre faktorer, som kan være beskyttende i bestemte MN under typer9,10.

I samsvar med et tidligere arbeid i musen embryonale stamceller11, har vi nylig vist at i humant iPSCs svangerskap/Ngn2, Isl1 og LHX3 (Nil) induserer en spinal MN identitet, mens Ngn2 og Isl1 pluss PHOX2A (Nip) spesifiserer skallen MNs12. Vi har derfor utviklet en effektiv protokoll, som fører til produksjon av menneskelige MNs utstyrt med funksjonelle egenskaper i en 12 dagers behandlingstid. Hensikten med denne metoden er å få, i en kort tidsramme og uten behov for rensing (f. eks, av FACS), celle populasjoner svært beriket for MNs med spinal eller hjerne identitet.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. vedlikehold av Human iPSCs

  1. Utarbeidelse av matrise-belagt plater
    1. Tin et 5 mL hetteglass med matrise (se tabell over materialer) ved 4 ° c over natten. Den opprinnelige matrisen bestandene kommer på ulike lager konsentrasjoner og alikvoter er laget i henhold til fortynning faktor som er angitt på dataarket, spesifikke for den enkelte mye. Det er viktig å holde hetteglasset og rør isen kaldt for å hindre prematur gelling av matrisen. Dispensere matrise i alikvoter i pre-kjølt cryotubes på isen. Frys ubrukt alikvoter ved-20 ° c.
    2. Plasser en alikvot på isen i ca 2 t for å tine.
    3. Fortynne alikvot av matrise med 20 mL kaldt DMEM/F12 i et 50 mL konisk rør.
    4. Bland godt og dispensere 1 mL utvannet matrise i 35 mm retter (tilsvarende beløp per overflateareal av andre retter).
    5. Hold rettene som inneholder fortynnet matrise for 1 time ved romtemperatur for å tillate belegg.
      Merk: Retter, forseglet med parafilm, kan oppbevares ved 4 ° c i opptil 2 uker.
  2. Tilberedning av lager løsningen (20 ml) og 1x arbeids alikvoter av den milde celle dissosiasjon reagens (se tabell over materialer).
    1. Løs opp pulveret til 10 mg/mL i PBS (ca2 +/mg2 + gratis).
    2. Filteret steriliseres gjennom en 0,22 μm filter membran.
    3. Forbered 20 alikvoter (1 mL hver) og oppbevar ved-20 ° c.
    4. Før bruk, fortynne en alikvot i PBS (ca2 +/mg2 + gratis) til 1 mg/ml (1x arbeider alikvoter).
      Merk: 1x arbeids alikvoter kan oppbevares ved 4 ° c i opptil 2 uker.
  3. Passaging menneskelige iPSCs.
    1. Før start: Dersom det oppbevares ved 4 ° c, pre-Warm Matrix-belagt plater i inkubator ved 37 ° c for 20-30 min. pre-varm ved romtemperatur mengden av humant iPSC medium (se tabell over materialer) som trengs. Pre-Warm DMEM/F12.
    2. Aspirer kultur medium.
    3. Skyll iPSCs med PBS (ca2 +/mg2 + gratis).
    4. Legg 1x skånsom dissosiasjon oppløsning (0,5 mL for en 35 mm rett). Ruge ved 37 ° c til kantene av koloniene begynner å løsne fra platen, vanligvis 3-5 min.
    5. Aspirer den milde dissosiasjon løsning, være forsiktig med å løsne iPSC kolonier.
    6. Vask cellene med DMEM/F12 (2 mL for en 35 mm rett) og aspirer å være forsiktig så du ikke løsner cellene. Gjenta dette trinnet én gang til.
    7. Tilsett humant iPSC medium (1 mL for en 35 mm rett).
    8. Løsne koloniene forsiktig med en celle løfter og Overfør til et 15 mL rør.
    9. Forsiktig bryte celle klumper ved pipettering opp og ned med en P1000 pipettehjelper 3-4 ganger.
    10. Aspirer supernatanten fra matrisen-belagt plate (r).
    11. Seed cellene i riktig kultur volum av menneskelig iPSC medium. Den delte forholdet kan variere fra linje til linje og er omtrent 1:4-1:8. Endre mediet daglig.

2. generering av NIL og NIP induserbart iPSC Lines

  1. Celle transfeksjoner.
    1. Skyll cellene med PBS (ca2 +/mg2 + gratis).
    2. Legg til celle dissosiasjon reagens (se tabell over materialer) (0,35 ml for en 35 mm rett) og ruge ved 37 ° c til enkeltceller er separert (5-10 min).
    3. Forsiktig komplett celle separasjon ved pipettering opp og ned med en P1000 pipettehjelper 3-4 ganger.
    4. Samle inn et 15 mL rør og tilsett PBS (ca2 +/mg2 + gratis) til 10 ml. Tell cellene.
    5. Pellet 106 celler og resuspend i 100 μL av buffer R (inkludert i celle electroporation Kit, se tabell over materialer).
    6. Legg til plasmider DNA for transfeksjoner: 4,5 μg av transposable vektor (epB-BSD-TT-NIL eller epB-BSD-TT-NIP12) og 0,5 μg av piggyBac transposase plasmider13.
    7. Transfect med celle electroporation systemet (se tabell over materialer) i henhold til produsentens instruksjoner og som tidligere beskrevet3 med følgende parametre: 1 200 V spenning, 30 MS bredde, 1 puls. Seed cellene i humant iPSC medium supplert med 10 μM Y-27632 (ROCK inhibitor, se tabell over materialer) i en 6 mm matrise-belagt parabol.
  2. Valg med antibiotika.
    1. To dager etter transfeksjoner, tilsett 5 μg/mL blasticidin til kultur mediet.
    2. De fleste av de ikke-transfekterte cellene vil dø innen 48 h av blasticidin utvalg. Oppbevare cellene inne blasticidin for det vil si 7-10 dager å telleren-velge cellene det har ikke integrert det transgenes inne det Genova.
    3. Oppretthold stabilt transfekterte celler som en blandet populasjon, sammensatt av celler med ulikt antall transgenes og ulike integrerings områder, eller Isoler enkelt kloner.
    4. Forbered en ekstra rett til å se etter effektive uttrykk for transgenes, på 1 μg/mL Doxycycline induksjon, av RT-PCR med transgene-spesifikk primer for Ngn2 (Forward: TATGCACCTCACCTCCCCATAG; Reverse: GAAGGGAGGAGGGCTCGACT), som tidligere beskrevet12.
    5. På dette stadiet, fryse bestander av romanen NIL-og NIP-iPSC linjer i frysing medium for menneskelig iPSCs (se tabell over materialer).

3. motor Nevron differensiering

  1. Distansere cellene med celle dissosiasjon reagens som beskrevet (trinn 2.1.1.-2.1.3.). Samle dissosiert celler i et 15 mL rør og fortynne med 5 volumer av DMEM/F12. Pellet cellene og resuspend i humant iPSC medium supplert med 10 μM ROCK inhibitor. Telle celler og frø på matrise-belagte retter i en tetthet på 62 500 celler/cm2.
  2. Dagen etter, erstatte mediet med DMEM/F12, supplert med 1x stabil L-glutamin analoge, 1x ikke-essensielle aminosyre (NEAA) cellekultur supplement og 0,5 x penicillin/Streptomycin, og inneholder 1 μg/mL Doxycycline. Dette regnes som dag 0 av differensiering. På dag 1, oppdatere medium og Doxycycline.
  3. På dag 2 endrer du mediet til Neurobasal/B27 medium (Neurobasal medium supplert med 1x B27, 1x stabil L-glutamin analog, 1x NEAA og 0,5 x penicillin/Streptomycin), inneholdende 5 μM DAPT, 4 μM SU5402 og 1 μg/mL Doxycycline (se tabell over materialer ). Oppdater medium og Doxycycline hver dag frem til dag 5.
  4. Dag 5: celler dissosiasjon med celle dissosiasjon reagens (se tabell over materialer).
    1. Skyll cellene med PBS (ca2 +/mg2 + gratis).
    2. Legg celle dissosiasjon reagens (0,35 mL for en 35 mm rett) og ruge ved 37 ° c til hele cellen monolag skiller fra fatet. Merk at enkeltceller ikke vil bli separert under inkubasjons.
    3. Tilsett 1 mL DMEM/F12 og samle cellene i et 15 mL rør.
    4. Forsiktig komplett celle separasjon ved pipettering opp og ned med en P1000 pipettehjelper 10-15 ganger.
    5. Tilsett 4 mL DMEM/F12 og telle cellene.
    6. På dette stadiet, fryse motorisk Nevron forfedre i celle frysing medium (se tabell over materialer), ifølge produsentens instruksjoner.
    7. Pellet cellene og resuspend i neuronal medium (Neurobasal/B27 medium supplert med 20 ng/mL BDNF, 10 ng/mL GDNF og 200 ng/mL L-askorbinsyre, se tabell materiales) supplert med 10 μM rock inhibitor.
    8. Seed cellene på Poly-Ornithine/laminin-eller alternativt på matrise-belagt støtter på tettheten av 100 000 celler/cm2. Bruk μ-Slide plast støtter med polymer dekkglass (se tabell av materialer) for immunostaining analyse.
  5. På dag 6, endre mediet med friskt neuronal medium blottet for ROCK inhibitor. På de neste dagene, oppdatere halvparten av mediet hver 3 dager. Kultur medium må endres svært nøye for å hindre løsrivelse fra overflaten.

4. Immunostaining analyse

  1. Celle fiksering. Skyll cellene med PBS (med ca2 +/mg2 +) og ruge i 15 min i 4% paraformaldehyde i PBS (med ca2 +/mg2 +) ved romtemperatur.
    Forsiktig: Paraformaldehyde er giftig og mistenkt for å forårsake kreft. Unngå kontakt med hud og øyne og håndter under en kjemisk avtrekks hette.
  2. Permeabilize med PBS (med ca2 +/mg2 +) som inneholder 0,1% Triton X-100 i 5 min ved romtemperatur.
  3. Ruge i 30 minutter ved romtemperatur i antistoff blokkerings løsning (ABS: 3% BSA i PBS med ca2 +/mg2 +).
  4. Ruge for 1 t ved romtemperatur med primære antistoffer i ABS: anti-TUJ1 (1:1000; kanin) og anti-Oct4 (1:200; mus) eller anti-CHAT (anti-kolin Acetyltransferase; 1:150; geit). Se tabell over materialer.
  5. Ruge for 45 min ved romtemperatur med passende esel sekundære antistoff par i ABS: anti-mus Alexa fluor 647 (1:250), anti-kanin Alexa fluor 594 (1:250) og anti-geit Alexa fluor 488 (1:250). Se tabell over materialer.
  6. Ruge i 0,4 μg/mL DAPI i 5 minutter ved romtemperatur til etikett kjerner.
  7. Monter cellene med monterings medium (se tabell over materialer) for bildebehandling ved et fluorescens mikroskop.

5. funksjonell karakterisering via patch-klemme innspillinger

  1. Klargjør HEPES-equilibrated eksterne løsningen (NES) som følgende: 140 mM NaCl, 2,8 mM KCl, 2 mM CaCl2, 2 mm MgCl2, 10 mM HEPES og 10 mm glukose. Angi OSMOLARITETSSYSTEM mellom 290-300 mΩ. Juster pH til 7,3 ved hjelp av 1N NaOH og oppbevar oppløsningen ved 4 ° c.
  2. Forbered den interne løsningen: 140 mM K-gluconate, 2 mM NaCl, 5 mM BAPTA, 2 mM MgCl2, 10 mm HEPES, 2 mm mg-ATP, 0,3 mm na-GTP. Juster pH til 7,3 med 1M KOH og kontroller at OSMOLARITETSSYSTEM er satt til rundt 290 mΩ. Frys oppløsningen ved-20 ° c i små alikvoter.
  3. Før du kjører eksperimentene, pre-varme NES-løsning i et vannbad til ca 28-30 ° c.
  4. Trekk noen Borosilikatglass Mikropipetter (ID 0,86 mm; OD 1,5 mm) som bærer en spiss motstand: 5-6 MΩ og fyll med den intracellulære løsningen før montering i pipette holderen.
    Merk: Husk å klorid sølv ledninger av innspillingen elektroden og referanse elektroden i blekemiddel i minst 30 min for å danne et ensartet lag av AgCl på wire overflaten.
  5. Overfør Petri parabolen i innspillingen kammer og la kammeret med NES løsning på 1-2 mL/min. La strømmen passere gjennom en inline Varmeapparat satt ved temperatur på 30 ° c for å holde løsningen varm.
  6. Plasser elektrofysiologisk Innspillings kammer under et stående mikroskop. Record membran strømmer med patch-klemme forsterker og hente data med en passende programvare.
  7. Åpne forsterker Kontrollprogramvaren og Still inn signal forsterkningen ved verdi 1 og Bessel-filteret på 10 kHz. Kontroller at Bessel-filteret er 2,5 ganger lavere enn samplingsfrekvensen.
  8. Sett eksperimentelle protokoller for spennings-klemme og strøm-klemme eksperimenter i innspillingen programvare.
  9. I protokoll innstillingen krysser du episodisk stimulering-modus og angir samplingsfrekvensen ved 25 kHz. Deretter flytter du til bølgeform kategorien og skriv inn spenningen eller gjeldende trinn amplitude og lengde som følger.
  10. For spennings-gated natrium strømninger, bruk 15 spennings trinn (50 MS varighet hver) fra-100 mV til + 40 mV (10 mV økning). Kjør protokollen etter imponerende til lappet celle et Holding potensiale-60 mV gjennom forsterkeren. Tilsvarende er de spennings-gated kalium strømmene fremkalt av spennings trinn (250 MS varighet hver) fra-30 mV til + 50 mV (10 mV økning) holder den innspilte cellen til-40 mV.
  11. For å undersøke avfyring egenskapene til iPSC-avledet skallen og spinal MNs, klemme celler, i gjeldende-klemme-modus, ved en membran potensialet i-70 mV og bruke 4 nåværende pulser (1 s varighet hver) av økende amplitude (fra 20 pA til + 80 pA; 20 pA økning).
  12. Tilegne seg for hver celle spenning-aktiverte strømninger, fremkalt avfyring aktivitet og tre passive egenskaper som hel celle kapasitans (cm), celle membran motstand (RM) og hvile membran potensial (RMP).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

En skjematisk beskrivelse av den differensiering metoden er vist i figur 1. Human iPSCs (WT I linje3) ble transfekterte med EpB-BSD-TT-Nil eller EpB-BSD-TT-Nip, genererer, etter blasticidin utvalg, stabile og induserbart cellelinjer12, heretter referert til som iPSC-Nil og IPSC-Nip, henholdsvis. Differensiering celler ble karakterisert for uttrykket av pluripotency markør OCT4 og Pan-neuronal markør TUJ1. Immunostaining analyse viste ensartet uttrykk for OCT4 i alle celler på dag 0, i fravær av TUJ1 positivitet (figur 2A). På dag 3, observerte vi en sterk nedgang i antall OCT4-positive celler, speilet av uttrykk for TUJ1 i en undergruppe av unike iPSCs (figur 2B). På dag 5, ingen uttrykk for OCT4 ble observert i befolkningen, som viste konsistent uttrykk for TUJ1 og ervervet en neuronal morfologi (figur 2C). Motor Nevron forfedre ble deretter dissosiert og re-belagt for videre modning. Etter 7 dager (12 dager siden dag 0), celler jevnt uttrykt TUJ1 og modne motoriske Nevron markør CHAT (Figur 3). Lignende resultater er oppnådd med to ekstra kommersielle iPSC linjer (se tabell over materialer), ved hjelp av samme kultur og differensiering forhold (supplerende figur S1 og supplerende figur S2). På samme måte som NIL-indusert motor neurons fra mus ESCs11, Human iPSCs indusert med Nil og NIP uttrykt lave nivåer av HOX transkripsjon faktorer og kan være mønstret langs Rostro-caudal aksen med retinoic syre (supplerende figur S3 ).

Disse resultatene ble oppnådd når 62 500 celler/cm2 ble sådd i begynnelsen av differensiering og indusert med 1 μM Doxycycline på dag 0. Dette resulterte i optimal konsentrasjon av Doxycycline å oppnå maksimal induksjon av transgenes uten tydelig toksisitet for cellene (supplerende figur S4A). Ved fjerning av Doxycycline på dag 5, uttrykk for transgenes ble taus (supplerende figur S4B). Vi har også utført forsøks eksperimenter for å etablere den optimale tettheten av cellene på dette punktet i protokollen. Vi la merke til at varierende denne parameteren i parallell differensiering eksperimenter gitt ulike utfall. Med første tetthet senket til 31 250 celler/cm2, differensiering var tilsynelatende normal, som evalueres ved å observere celle morfologi. Men, la vi merke til motstand mot dissosiasjon på dag 5 (§ 3,4) og redusert levedyktighet i den påfølgende modnings fasen. Omvendt, når den første tettheten av cellene ble hevet til 125 000 celler/cm2, observerte vi ineffektiv differensiering, som vurdert av mangel på oppkjøpet av de typiske Nevron-lignende morfologi. Dette resulterte i en blandet befolkning som bare inneholder en mindre brøkdel av MNs, som ville trenge ytterligere rensing (f.eks. av FACS). Vi har derfor fastslått at den optimale tettheten for å få en ren befolkning av neuronal celler, i stand til å overleve i kultur i mer enn to måneder, er 62 500 celler/cm2.

Vi vurderte deretter funksjonell modning av iPSC NIL-avledet spinal motor neurons av karakteriserer sine elektrofysiologisk egenskaper (Figur 4), som tidligere rapportert for IPSC Nip-avledet skallen motor neurons12. Patch klemme innspillinger, i enten spenning-og strøm-Clamp modalitet, ble utført på dag 7 av MNs modnings trinn av protokollen (se figur 1; total tid for differensiering: 12 dager) (Figur 4A). På dette tidspunktet viste den iPSC NIL-avledede motor neurons en noe lavere hvile membran potensial (-30 ± 2 mV; n = 24) og en lignende celle kapasitans verdi (+ 25 ± 2 pF; n = 25) sammenlignet med tidligere rapportert iPSC NIP-avledet MNs12. Så, for å dypere karakterisere graden av modning av differensiert celler, vi undersøkte deres evne til å fremkalle natrium og kalium strømmer når stimulert med en rekke spennings pulser. I disse eksperimentene, IPSC Nil-avledede neurons vellykket vist spennings avhengige natrium strømninger (Figur 4B), og spennings avhengige kalium strømmer (Figur 4C), nådde topp amplitude når klemt på en membran potensial i nærheten av henholdsvis − 20 mV og + 50 mV. Den likevekt potensialer for na+ og K+, beregnet ved hjelp av Nernst ' s ligning (www.physiologyweb.com/Calculators/nernst_potential_calculator.html) med tidligere rapporterte ekstracellulære og intracellulære løsninger, var + 110 mv og-102 mV hhv. I tillegg er 80% av iPSC NIL-avledet MNs festet i Current-Clamp modalitet var i stand til å utløse Spike tog når injisert med en nåværende puls på + 60 pA eller mer (Figur 4D). Minimum strøm som kreves for å lokke fram repeterende avfyring i mer enn 50% av registrerte celler var + 40 pA (15 av 18 celler; Figur 4 E). Spike terskelen var-37,6 ± 0,8 mv og gjennomsnittlig avfyring frekvens på + 40 pa var omtrent 7,9 ± 2,2 Hz (n = 18; Figur 4 F).

Samlet disse dataene tyder på at, på samme måte som tidligere rapportert iPSC NIP-avledet skallen MNs12, IPSC-Nil-avledet spinal MNs har funksjonelle egenskaper typisk for modne neurons.

Figure 1
Figur 1 : Motor Nevron differensiering protokollen. Figuren viser en skjematisk fremstilling av differensiering protokollen, fra generering av stabile iPSC linjer med piggyBac vektorer til tidspunktet for den funksjonelle analysen rapportert i teksten. Representative fase kontrast bilder av cellene ved ulike trinn i protokollen vises. Skala stolper = 50 μm. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2 : Representative immunostaining analyse av unike celler. iPSC-NIL og iPSC-NIP-celler ble analysert av immunostaining for uttrykket av pluripotency markør OCT4 (lilla) og Pan-neuronal markør TUJ1 (rød) på dag 0 (A), dag 3 (B) og dag 5 (C). Kjerner ble counterstained med DAPI. Konfokalmikroskopi bilder ble anskaffet ved laserskanning konfokalmikroskopi mikroskop (se tabell av materialer) ved hjelp av en 20x na 0,75 mål med zoom 2x, 1024 x 1024 pixel, utstyrt med 405 nm, 473 nm, 559 nm og 635 NM lasere. Filter innstilling for DAPI, Alexa fluor 594 og Alexa fluor 647 ble brukt. Skala stolper = 50 μm. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3 : Representative immunostaining analyse av IPSC-avledede motor neurons. iPSC-NIL og iPSC-NIP celler ble analysert av immunostaining for uttrykket av Pan-neuronal markør TUJ1 (rød) og motorisk Nevron markør CHAT (kolin acetyltransferase; grønn) på dag 12. Kjerner ble counterstained med DAPI. Konfokalmikroskopi bilder ble anskaffet som beskrevet i figur 2 Legend. Skala stolper = 50 μm. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 4
Figur 4 : Funksjonell analyse av spinal og skallen motor neurons. (A) lyse felt bilde av hele cellen patch klemme på IPSC Nil-avledet spinal motor Nevron. (B) representativ i/V-kurve for na+ -gjeldende registrert i IPSC Nil-avledet MNs som svar på en serie med økende spennings trinn (n = 26; holder potensial lik-60 mv). (C) representativ i/V-kurve for K+ innspilt i IPSC Nil-avledet MNs som svar på en serie med økende spennings trinn (n = 23; holder potensial lik-40 mv). (D) representative spor av et tog av handlingen potensialer fremkalt som svar på en 1 s varig nåværende injeksjon av + 60 pa. (E) histogram som representerer prosenten av IPSC Nil-avledet MNs fremlokkende handling potensialer ved hver gjeldende puls (n = 18). (F) histogram som viser den utløste skudd frekvensen ved hver nåværende puls (n = 18). Elektrofysiologisk innspilling ble utført under et stående mikroskop. Membranen strømmer opptaks systemet er angitt i tabellen av materialer. Vennligst klikk her for å se en større versjon av dette tallet.

Supplementary Figure 1
Supplerende figur S1: MN differensiering bruke Episomal hiPSCs. (A) Brightfield bilder av differensiering Episomal HIPSC-Nil (venstre) og Episomal HIPSC-Nip (til høyre) på de angitte tidspunkt poeng. Skala stolper = 50 μm. (B) analyse av uttrykket av de indikerte markører i å skille Episomal HIPSC-Nil (øverst) og Episomal HIPSC-Nip (nederst) celler ved sanntid QRT-PCR. For hver markør har tids punktet med det høyeste uttrykket blitt brukt som kalibrerings prøve. Primere som brukes for ISL1 er spesifikke for den endogene genet. (C) Immunostaining for Pan-NEURONAL markør TUJ1 (rød) og skallen MN markør PHOX2B (grønn) i differensiert (dag 6) Episomal HIPSC-Nil (venstre) og Episomal HIPSC-Nip (høyre) celler. Kjerner er counterstained med DAPI. Scale bar for alle paneler: 50 μm. (D) analyse av uttrykk for HB9 og PHOX2B i å skille Episomal HIPSC-Nil (øverst) og Episomal HIPSC-Nip (nederst) celler ved sanntid QRT-PCR. Dag 0 har blitt brukt som kalibrerings prøve. PCR-primere og-metoder rapporteres i de Santis et al., 201812. Vennligst klikk her for å se en større versjon av dette tallet.

Supplementary Figure 2
Supplerende figur S2: MN differensiering bruker DS2U iPSCs. (A) Brightfield bilder av differensiering DS2U-Nil (venstre) og DS2U-Nip (høyre) på det angitte tidspunktet poeng. Skala stolper = 50 μm. (B) analyse av uttrykket av de indikerte markører i å skille DS2U-Nil (øverst) og DS2U-Nip (nederst) celler ved sanntid QRT-PCR. For hvert merke er tids punktet med det høyeste uttrykket brukt som kalibrerings prøve. Primere som brukes for ISL1 er spesifikke for den endogene genet. (C) Immunostaining for Pan-NEURONAL markør TUJ1 (rød) og skallen MN markør PHOX2B (grønn) i differensiert (dag 6) DS2U-Nil (venstre) og DS2U-Nip (høyre) celler. Kjerner er counterstained med DAPI. Skala stolper = 50 μm. (D) analyse av uttrykk for HB9 og PHOX2B i å skille DS2U-Nil (øverst) og DS2U-Nip (nederst) celler ved sanntid QRT-PCR. Dag 0 har blitt brukt som kalibrerings prøve. PCR-primere og-metoder rapporteres i de Santis et al., 201812. Vennligst klikk her for å se en større versjon av dette tallet.

Supplementary Figure 3
Supplerende figur S3: HOX genuttrykk. (A) analyse av uttrykket av fire forskjellige HOX GENER (HOX a2, HOX B1, HOX A4, HOX B5) etter 5 dager med differensiering av IPSC-Nil og IPSC-Nil + ra-celler i sanntid QRT-PCR. IPSC-NIL på dag 0 er brukt som kalibrerings prøve. (B) analyse av uttrykk for fire forskjellige HOX GENER (HOX a2, HOX B1, HOX A4, HOX B5) etter 5 dager med differensiering av IPSC-Nip og IPSC-Nip + ra celler ved sanntid QRT-PCR. IPSC-NIP på dag 0 har blitt brukt som kalibrerings prøve. (C) PCR primer parene. Vennligst klikk her for å se en større versjon av dette tallet.

Supplementary Figure 4
Supplerende figur S4: Doxycycline induksjon analyse. (A) analyse av sanntids QRT-PCR av uttrykket av eksogene Ngn2 i IPSC-Nil (øverst) og IPSC-Nip (bunn) celler ubehandlet eller kultivert for 24 h i nærvær av Doxycycline ved ulik konsentrasjon (0,5 μm, 1,0 μm, 2,0 μm). Ngn2 ble analysert med primere spesifikke for eksogene mus genet. Foreldrenes iPSC-linje, blottet for NIL-og NIP-konstruksjoner, er inkludert i analysen som en kontroll. Uttrykk for transgenes i iPSC-NIL og iPSC-NIP var forsømmelig i fravær av Doxycycline. iPSC-NIL og iPSC-NIP på dag 0 har blitt brukt som kalibrerings prøver. (B) analyse av sanntid QRT-PCR av uttrykket av eksogene Ngn2 i å skille IPSC-Nil (venstre) og IPSC-Nip (høyre) celler på det angitte tidspunktet punkter av protokollen. Ngn2 ble analysert med primere spesifikke for eksogene mus genet. iPSC-NIL og iPSC-NIP på dag 0 har blitt brukt som kalibrerings prøver. PCR-primere og-metoder rapporteres i de Santis et al., 201812. Vennligst klikk her for å se en større versjon av dette tallet.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Denne protokollen gjør det mulig å effektivt konvertere menneskelige iPSCs i spinal og skallen motor neurons takket være utenfor livmoren uttrykk for avstamning-spesifikke transkripsjon faktorer. Disse transgenes er induserbart av Doxycycline og stabilt integrert i Genova takket være en piggyBac Transposon-basert vektor. I en blandet befolkning, en eller flere eksemplarer av piggyBac vektoren vil bli tilfeldig integrert i Genova av individuelle celler, øker risikoen for Genova integritet endringer. Videre, en progressiv utvalg av iPSC subclones kan oppstå over tid, med mulige konsekvenser for differensiering og for sammenlignende analyse av sykdom og kontroll cellelinjer. Alt iPSC-avledet MNs innhentet med denne protokollen vil være uegnet for regenererende medisin. Imidlertid kan vår metode være spesielt nyttig for in vitro motor Nevron sykdom modellering. Major punkter styrke er representert ved ekstremt forenklet kultur forhold, hurtighet av MN konvertering, høy grad av modning av iPSC-avledet MNs og muligheten til å få både spinal og skallen MNs, som tidligere demonstrert av analyse av spesifikk markør gener uttrykk12. Robusthet av protokollen er demonstrert ved reproduserbarhet. Så langt har vi med hell brukt denne protokollen mer enn 30 ganger for spinal og/eller skallen MN generasjon, vurdere utfallet av markøren og/eller funksjonelle analyser. Vi har lykkes opprettholdt motoriske Nevron kulturer i inntil to måneder uten tydelig reduksjon av levedyktighet. Videre, når stabilt transduced iPSC linjen er oppnådd, kan hvert eksperiment startes ved Doxycycline induksjon uten behov for nye transfeksjoner. Viral vektorer er heller ikke nødvendig. Representanten resultatene som presenteres her har blitt innhentet av electroporating iPSCs med cellen electroporation systemet angitt i tabellen av materialer. Andre electroporation metoder kan imidlertid representere alternative alternativer. Omvendt, i vår erfaring, transfeksjoner systemer basert på lipofection er ikke et godt alternativ for Pluripotent stamceller12. Celle populasjoner som oppnås ved slutten av prosessen, består nesten utelukkende av MNs, og unngår behovet for ytterligere rensing (f.eks. ved FACS). Som vi tidligere viste12, protokollen kan skaffe 90% TUJ1-positive celler, hvorav 95% der også PHOX2B positive i Nip-avledede kulturer.

Vi kan forutse noen kritiske punkter som må være nøyaktig tatt i betraktning. For det første er kvaliteten på den opprinnelige populasjonen av iPSCs avgjørende for å sikre homogen og konsistent konvertering til MNs. kulturer som inneholder en betydelig brøkdel av differensiering (mer enn 5-10%) må unngås. Vi har satt opp protokollen ved hjelp av Human iPSC medium beskrevet i tabellen av materialer som vedlikehold medium for udifferensierte iPSCs. Andre kommersielt tilgjengelige definerte medier kan representere gyldige alternative alternativer, til tross for at vi ikke har eksperimentelt adressert dette punktet i dagens arbeid. Siden medie sammensetning kan påvirke sprednings raten til Start celle populasjonen, kan tilpasningen av protokollen til andre vedlikeholds medier kreve optimalisering av den første tettheten på dag 0. Etter transfeksjoner, er det viktig å holde celler under antibiotika valg i minst 2 uker for å få stabile cellelinjer. Det kan være hensiktsmessig for noen programmer å utlede klonal linjer etter piggyBac integrering, for å få en mer homogen befolkning i form av nivåer av transgene uttrykk og en bedre kontroll av integrering nettsteder. Tettheten av cellene på dag 0, tidspunktet for Doxycycline tillegg til mediet, er en avgjørende parameter. Som nevnt i delen representant resultater, anslår vi en optimal celle tetthet for å sikre reproduserbarhet. Vi kan ikke utelukke at andre pluripotent stilk cellen linjer kan kreve ulike innledende tetthet, som skal empirisk bestemmes i pilot eksperimenter, som duplisering hastigheten kan variere betydelig mellom individuelle linjer. Middels bytte til Neurobasal/B27 må skje etter 48 h siden Doxycycline induksjon (§ 3,3): differensiering kan resultere tregere og mindre effektiv hvis cellene ikke er holdt for 2 hele dager i DMEM/F12 medium. Dissosiasjon på dag 5 må utføres uten å understreke differensiering celler. Tidspunktet for inkubasjons med celle dissosiasjon reagens (trinn 3,4) kan avvike fra bunke til parti og bør være nøye anslått i pilot eksperimenter. Ved inkubasjons med celle dissosiasjon reagens, hele cellen monolag løsner fra platen. Deretter må det være nøye dissosiert av pipettering, som beskrevet i avsnitt 3,4, for å bevare celle integritet og for å unngå mekanisk stress, som kan ha en negativ innvirkning på vedlikeholdet av celle kulturen utover D5. Til slutt la vi merke til at etter re-plating MNs følge bedre på vev kultur plast enn glass. Polymer coverslips som sikrer optimal celle overholdelse og egnede optiske egenskaper er et godt alternativ for mikroskopi applikasjoner.

Vår metode representerer en direkte "programmering" av pluripotent celler til en MN skjebne, og ikke recapitulate de mellomliggende trinnene der embryonale celler erverve en MN identitet under in vivo utvikling, slik som første spesifikasjonen til neural ektoderm og mønster langs dorso-ventrale og Rostro-caudal akser. Derfor ville det ikke være egnet til å modellere menneskelige MN spesifikasjon in vitro for å studere, for eksempel, molekylære mekanismer underliggende differensiering. På den annen side, vår protokoll kan generere en betydelig mengde av spinal eller skallen MNs uten behov for ytterligere rensing. Tar også i betraktning graden av modning oppnådd, representerer dette et nyttig verktøy for å studere den molekylære grunnlaget for nevrodegenerative sykdommer i motorisk Nevron. Et konsistent antall iPSC linjer med patogene mutasjoner i motoriske Nevron sykdom-relaterte gener har blitt produsert av det vitenskapelige miljøet i de siste årene. Samlinger av MN "programmerbare" iPSC linjer kan derfor lett genereres av stabil integrering av NIL og NIP moduler i de muterte iPSC linjer. Vi kan forutse, som en mulig fremtidig anvendelse av metoden, karakterisering av cellen-autonome faktorer som tildeler ulik mottakelighet for individuelle MN under typer, ved å sammenligne side-ved-side skallen og spinal MNs innhentet fra iPSCs med samme genetiske bakgrunn. Videre effektiv konvertering av iPSCs til MNs i forenklet kultur forhold som trenger minimal manipulasjon (dvs. uten overgang gjennom embryoid organer) og som lett kan skaleres, kan i stor grad lette automatiserte høy gjennomstrømming narkotika screening tilnærminger for motoriske Nevron sykdommer. In vitro modellering av voksen-utbruddet nevrodegenerative sykdommer kan være utfordrende på grunn av Foster-lignende karakter av iPSC-avledet neurons14. Tidligere strategier utviklet for å akselerere aldring av MNs avledet av konvensjonell differensiering av iPSCs, slik som progerin overuttrykte15, kan kombineres med vår metode for å oppnå bedre sykdoms modeller.

Metoden beskrevet her, basert på induserbart uttrykk for transkripsjon faktorer formidlet av en piggyBac vektor, kan brukes til andre induserte celletyper. Vi har tidligere vist at skjelettlidelser muskelceller kan fås fra menneskelige iPSCs av uttrykk for BAF60c og Myod16. På samme måte kan vi envision muligheten til å utvide metoden til andre celletyper av interesse, inkludert andre neuronal under typer og astrocytter, ved piggyBac-mediert uttrykk for riktig sett av programmering faktorer17,18, 19,20,21.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ingenting å avsløre

Acknowledgments

Forfatterne ønsker å takke Imaging Facility ved Center for Life nano Science, Istituto Italiano di Tecnologia, for støtte og tekniske råd. Vi er takknemlige for medlemmer av Center for Life nano Science for nyttig diskusjon. Dette arbeidet ble delvis støttet av et stipend fra AriSLA (pilot Grant 2016 "StressFUS") til AR.

Materials

Name Company Catalog Number Comments
5-Bapta Sigma-Aldrich A4926-1G chemicals for electrophysiological solutions
Accutase Sigma-Aldrich A6964-100ML  Cell dissociation reagent
anti-CHAT EMD Millipore  AB144P Anti-Choline Acetyltransferase. Primary antibody used in immunostaining assays. RRID: AB_2079751; Lot number: 2971003
anti-goat Alexa Fluor 488  Thermo Fisher Scientific  A11055 Secondary antibody used for immonofluorescence assays. RRID: AB_2534102; Lot number: 1915848
anti-mouse Alexa Fluor 647 Thermo Fisher Scientific  A31571 Secondary antibody used for immonofluorescence assays. RRID: AB_162542; Lot number: 1757130
anti-Oct4  BD Biosciences 611202 Primary antibody used in immunostaining assays. RRID: AB_398736; Lot number: 5233722
anti-Phox2b Santa Cruz Biotechnology, Inc. sc-376997 Primary antibody used in immunostaining assays. Lot number: E0117
anti-rabbit Alexa Fluor 594  Immunological Sciences IS-20152-1 Secondary antibody used for immonofluorescence assays
anti-TUJ1  Sigma-Aldrich  T2200 Primary antibody used in immunostaining assays. RRID: AB_262133
B27 Miltenyi Biotec 130-093-566 Serum free supplement for neuronal cell maintenance
Bambanker Nippon Genetics NGE-BB02 Cell freezing medium, used here for motor neuron progenitors
BDNF PreproTech 450-02 Brain-Derived Neurotrophic Factor
Blasticidin Sigma-Aldrich 203350 Nucleoside antibiotic that inhibits protein synthesis in prokaryotes and eukaryotes
BSA Sigma-Aldrich A2153 Bovine Serum Albumin. Blocking agent to prevent non-specific binding of antibodies in immunostaining assays
CaCl2 Sigma-Aldrich C3881 chemicals for electrophysiological solutions
Clampex 10 software Molecular Devices Clampex 10 Membrane currents recording system
Corning Matrigel hESC-qualified Matrix Corning 354277 Reconstituted basement membrane preparation from the Engelbreth-Holm-Swarm (EHS) mouse sarcoma. Used for adhesion of iPSC to plastic and glass supports
CRYOSTEM ACF FREEZING MEDIA Biological Industries 05-710-1E Freezing medium for human iPSCs
D-Glucose Sigma-Aldrich G5146 chemicals for electrophysiological solutions
DAPI powder Roche 10236276001 4′,6-diamidino-2-phenylindole. Fluorescent stain that binds to adenine–thymine rich regions in DNA used for nuclei staining in immonofluorescence assays
DAPT AdipoGen AG-CR1-0016-M005 Gamma secretase inhibitor
Dispase Gibco 17105-041 Reagent for gentle dissociation of human iPSCs
DMEM/F12 Sigma-Aldrich D6421-500ML Basal medium for cell culture
Doxycycline Sigma-Aldrich D9891-1G  Used to induce expression of transgenes from epB-Bsd-TT-NIL and epB-Bsd-TT-NIP vectors
DS2U  WiCell UWWC1-DS2U Commercial human iPSC line
E.Z.N.A Total RNA Kit  Omega bio-tek R6834-02 Kit for total extraction of RNA from cultured eukaryotic cells
GDNF PreproTech 450-10 Glial-Derived Neurotrophic Factor
Gibco Episomal hiPSC Line Thermo Fisher Scientific A18945 Commercial human iPSC line
Glutamax Thermo Fisher Scientific 35050038 An alternative to L-glutamine with increased stability. Improves cell health.
Hepes Sigma-Aldrich H4034 chemicals for electrophysiological solutions
iScript Reverse Transcription Supermix for RT-qPCR  Bio-Rad 1708841 Kit for gene expression analysis using real-time qPCR
iTaqTM Universal SYBR Green Supermix  Bio-Rad 172-5121  Ready-to-use reaction master mix optimized for dye-based quantitative PCR (qPCR) on any real-time PCR instrument
K-Gluconate Sigma-Aldrich G4500 chemicals for electrophysiological solutions
KCl Sigma-Aldrich P9333 chemicals for electrophysiological solutions
L-ascorbic acid LKT Laboratories A7210 Used in cell culture as an antioxidant
Laminin Sigma-Aldrich 11243217001 Promotes attachment and growth of neural cells in vitro
Laser scanning confocal microscope  Olympus  iX83 FluoView1200 Confocal microscope for acquisition of immunostaining images
Mg-ATP Sigma-Aldrich A9187 chemicals for electrophysiological solutions
MgCl2 Sigma-Aldrich M8266 chemicals for electrophysiological solutions
Mounting Medium  Ibidi 50001 Mounting solution used for confocal microscopy and immunofluorescence assays
Multiclamp patch-clamp amplifier Molecular Devices 700B Membrane currents recording system
Na-GTP Sigma-Aldrich G8877 chemicals for electrophysiological solutions
NaCl Sigma-Aldrich 71376 chemicals for electrophysiological solutions
NEAA Thermo Fisher Scientific 11140035 Non-Essential Amino Acids. Used as a supplement for cell culture medium, to increase cell growth and viability.
Neon 100 μL Kit Thermo Fisher Scientific MPK10096 Cell electroporation kit
Neon Transfection System Thermo Fisher Scientific MPK5000 Cell electroporation system
Neurobasal Medium Thermo Fisher Scientific 21103049 Basal medium designed for long-term maintenance and maturation of neuronal cell populations without the need for an astrocyte feeder layer
NutriStem-XF/FF  Biological Industries 05-100-1A Human iPSC culture medium
Paraformaldehyde Electron Microscopy Sciences 157-8 Used for cell fixation in immunostaining assays
PBS Sigma-Aldrich D8662-500ML Dulbecco's Phosphate Buffer Saline, with Calcium, with Magnesium
PBS Ca2+/Mg2+ free Sigma-Aldrich D8537-500ML Dulbecco's Phosphate Buffer Saline, w/o Calcium, w/o Magnesium
Penicillin/Streptomycin  Sigma-Aldrich P4333-100ML Penicillin/Streptomicin solution used to prevent cell culture contamination from bacteria.
poly-ornithine Sigma-Aldrich P4957 Promotes attachment and growth of neural cells in vitro
SU5402 Sigma-Aldrich SML0443-5MG Selective inhibitor of vascular endothelial growth factor receptor 2 (VEGFR-2)
Triton X-100  Sigma-Aldrich T8787 4-(1,1,3,3-Tetramethylbutyl)phenyl-polyethylene glycol, t-Octylphenoxypolyethoxyethanol, Polyethylene glycol tert-octylphenyl ether. Used for cell permeabilization in immunostaining assays
Upright microscope Olympus BX51VI Microscope for electrophysiological recording equipped with CoolSnap Myo camera 
Y-27632  (ROCK inhibitor) Enzo Life Sciences ALX-270-333-M005  Cell-permeable selective inhibitor of Rho-associated, coiled-coil containing protein kinase (ROCK). Increases iPSC survival
μ-Slide 8 Well  Ibidi 80826 Support for high–end microscopic analysis of fixed cells

DOWNLOAD MATERIALS LIST

References

  1. Dimos, J. T., et al. Induced Pluripotent Stem Cells Generated from Patients with ALS Can Be Differentiated into Motor Neurons. Science (New York, NY). 321, (5893), 1218 (2008).
  2. Ebert, A. D., et al. Induced pluripotent stem cells from a spinal muscular atrophy patient. Nature. 457, (7227), 277-280 (2009).
  3. Lenzi, J., et al. ALS mutant FUS proteins are recruited into stress granules in induced Pluripotent Stem Cells (iPSCs) derived motoneurons. Disease models & mechanisms. 8, (7), 755-766 (2015).
  4. Wijesekera, L. C., Leigh, P. N. Amyotrophic lateral sclerosis. Orphanet journal of rare diseases. 4, (3), 1-22 (2009).
  5. Yan, J., et al. Frameshift and novel mutations in FUS in familial amyotrophic lateral sclerosis and ALS/dementia. Neurology. 75, (9), 807-814 (2010).
  6. Boulting, G. L., et al. A functionally characterized test set of human induced pluripotent stem cells. Nature biotechnology. 29, (3), 279-286 (2011).
  7. Amoroso, M. W., et al. Accelerated high-yield generation of limb-innervating motor neurons from human stem cells. The Journal of neuroscience: the official journal of the Society for Neuroscience. 33, (2), 574-586 (2013).
  8. Maury, Y., et al. Combinatorial analysis of developmental cues efficiently converts human pluripotent stem cells into multiple neuronal subtypes. Nature biotechnology. 33, (1), 89-96 (2015).
  9. Allodi, I., et al. Differential neuronal vulnerability identifies IGF-2 as a protective factor in ALS. Scientific reports. 6, 25960 (2016).
  10. Kaplan, A., et al. Neuronal matrix metalloproteinase-9 is a determinant of selective neurodegeneration. Neuron. 81, (2), 333-348 (2014).
  11. Mazzoni, E. O., et al. Synergistic binding of transcription factors to cell-specific enhancers programs motor neuron identity. Nature neuroscience. 16, (9), 1219-1227 (2013).
  12. De Santis, R., Garone, M. G., Pagani, F., de Turris, V., Di Angelantonio, S., Rosa, A. Direct conversion of human pluripotent stem cells into cranial motor neurons using a piggyBac vector. Stem Cell Research. 29, 189-196 (2018).
  13. Yusa, K., Zhou, L., Li, M. A., Bradley, A., Craig, N. L. A hyperactive piggyBac transposase for mammalian applications. Proceedings of the National Academy of Sciences of the United States of America. 108, (4), 1531-1536 (2011).
  14. Sances, S., et al. Modeling ALS with motor neurons derived from human induced pluripotent stem cells. Nature Neuroscience. 16, (4), 542-553 (2016).
  15. Miller, J. D., et al. Human iPSC-based modeling of late-onset disease via progerin-induced aging. Cell stem cell. 13, (6), 691-705 (2013).
  16. Lenzi, J., et al. Differentiation of control and ALS mutant human iPSCs into functional skeletal muscle cells, a tool for the study of neuromuscolar diseases. Stem Cell Research. 17, (1), 140-147 (2016).
  17. Zhang, Y., et al. Rapid Single-Step Induction of Functional Neurons from Human Pluripotent Stem Cells. Neuron. 78, (5), 785-798 (2013).
  18. Theka, I., et al. Rapid generation of functional dopaminergic neurons from human induced pluripotent stem cells through a single-step procedure using cell lineage transcription factors. Stem cells translational medicine. 2, (6), 473-479 (2013).
  19. Pawlowski, M., et al. Inducible and Deterministic Forward Programming of Human Pluripotent Stem Cells into Neurons, Skeletal Myocytes, and Oligodendrocytes. Stem Cell Reports. 8, (4), 803-812 (2017).
  20. Li, X., et al. Fast Generation of Functional Subtype Astrocytes from Human Pluripotent Stem Cells. Stem Cell Reports. 11, (4), 998-1008 (2018).
  21. Nehme, R., et al. Combining NGN2 Programming with Developmental Patterning Generates Human Excitatory Neurons with NMDAR-Mediated Synaptic Transmission. Cell reports. 23, (8), 2509-2523 (2018).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics