Lentiviral Mediated Delivery of shRNAs to hESCs and NPCs Using Low-cost Cationic Polymer Polyethylenimine (PEI)

Summary

Using the low-cost cationic polymer polyethylenimine (PEI), we produced lentiviral particles for stable expression of shRNAs in H9 human embryonic stem cells (hESCs) and transiently transduced H9-derived neural progenitor cells (NPCs) at high efficiency.

Abstract

The current protocol describes the use of lentiviral particles for the delivery of short hairpin RNAs (shRNAs) to both human embryonic stem cells (hESCs) as well as neural progenitor cells (NPCs) derived from hESCs at high efficiency. Lentiviral particles were generated by co-transfecting HEK293T cells using entry vectors (carrying shRNAs) along with packaging plasmids (pAX and pMD2.G) using the low-cost cationic polymer polyethylenimine (PEI). Viral particles were concentrated using ultracentrifugation, which resulted in average titers above 5 x 10⁷. Both hESCs and NPCs could be infected at high efficiencies using these lentiviral particles, as shown by puromycin selection and stable expression in hESCs, as well as transient GFP expression in NPCs. Furthermore, western blot analysis showed a significant reduction in the expression of genes targeted by shRNAs. In addition, the cells retained their pluripotency as well as differentiation potential, as evidenced by their subsequent differentiation into different lineages of CNS. The current protocol deals with the delivery of shRNAs; however, the same approach could be used for the ectopic expression of cDNAs for overexpression studies.

Introduction

Human embryonic stem cells (hESCs) derived from the blastocyst inner cell mass are pluripotent and can be differentiated into different cell types depending upon external factors under in vitro conditions^1,2. In order to fully harness the potential of hESCs, it is imperative to have rapid and reliable gene delivery methods for these cells. Conventionally, the techniques used can be broadly classified into two types: nonviral and viral gene delivery systems^3,4. The more frequently used nonviral gene delivery systems are lipofection, electroporation, and nucleofection. Nonviral delivery systems are advantageous because of fewer insertion mutations and an overall decrease in immunogenicity^5,6. However, these methods result in low transfection efficiency and a short duration of transient gene expression, which is a major limitation for long-term differentiation studies⁷. Electroporation results in better transfection efficiencies compared to lipofection; however, it results in more than 50% cell death^8,9,10. Using nucleofection, the cell survival and transfection efficiency can be improved by combining lipofection and electroporation, but the approach needs cell-specific buffers and specialized equipment and, thus, becomes quite costly for scaled-up applications^11,12.

In contrast, viral vectors have shown improved transfection efficiencies, as well as overall low cytotoxicity, following transduction. In addition, the genes delivered are stably expressed and, hence, make this method ideal for long-term studies¹³. Among the most commonly used viral vectors for gene delivery into hESCs are lentiviral vectors (LVS), which can give more than 80% transduction efficiency using high titer viral particles^14,15. Lipofection and CaPO₄ precipitation are amongst the most commonly used methods to transiently transfect HEK293T cells or its derivatives with gene transfer vectors along with packaging plasmids to yield lentiviral particles¹⁶. Although lipofection results in good transfection efficiency and low cytotoxicity, the technique is hampered by its cost, and scaling up to get high titer lentiviral particles would be very costly. CaPO₄ precipitation results in relatively similar transfection efficiencies to those obtained using lipofection. Although cost-effective, CaPO₄ precipitation results in significant cell death following transfections, which makes it difficult to standardize and to avoid batch-to-batch variations¹⁷. In this scenario, developing a method that gives high transfection efficiency, low cytotoxicity, and cost-effectiveness is crucial for the production of high titer lentiviral particles to be used in hESCs.

Polyethylenimine (PEI) is a cationic polymer that can transfect HEK293T cells at high efficiency without much cytotoxicity and has a negligible cost compared to lipofection-based methods¹⁸. In this situation, PEI can be used for scaled-up applications of high titer LVS production through the concentration of lentiviral particles from culture supernatants using various techniques. The presented article describes the use of PEI to transfect HEK293T cells and lentiviral vector concentration using ultracentrifugation through a sucrose cushion. Using this method, we regularly obtain titers well above 5 x 10⁷ IU/mL with low batch-to-batch variations. The method is simple, straight-forward, and cost-effective for scaled-up applications for gene delivery to hESCs and hESCs-derived cells.

Protocol

1. Transfection of HEK293T cells using either PEI or Lipofectamine 3000 reagent

1. Culture HEK293T cells in DMEM + 10% FBS + 1x penicillin/streptomycin at 37 °C in a humidified incubator with an atmosphere of 5% CO₂ and 21% O₂ until they are 90% confluent before seeding for transfection. Use a relatively low passage number of cells for high titer virus production (ideally less than P30).
2. Seed 4 x 10⁶ cells in 10 mL of complete growth medium in a 100 mm tissue culture plate and grow overnight in a humidified tissue culture incubator with an atmosphere of 5% CO₂ and 21% O_2.
3. For each transfection, dilute plasmid DNA (1 mg/mL stocks) in 1 mL of serum free DMEM media in 1.5 mL centrifuge tubes using the following ratio of entry and packaging plasmids:
   Entry vector = 10 µg
   psPAX2.0 = 7.5 µg
   pMD2.G = 5 µg
4. Vortex for 10 s and spin the tube at 10,000 x g for 30 s at room temperature to collect.
5. Add 70 µL of (1 mg/mL stock solution) PEI to the tube, and vortex and spin briefly as described above to collect. The volume of PEI used is based on a 1:3 ratio of total DNA (µg):PEI (µg).
6. For lipofectamine-based transfection, dilute the above vectors in 500 µL of serum-free DMEM media containing 45 µL of reagent P supplied in the kit and incubate at room temperature for 5 min.
7. Dilute 70 µL of reagent L supplied in the kit using 500 µL of serum-free DMEM media and incubate at room temperature for 5 min.
8. Combine the contents of both tubes and incubate the tubes at room temperature for 20 min to allow complex formation.
9. Add dropwise 1 mL of DNA/PEI or 1 mL of DNA/lipofectamine complexes to the plate containing cells and incubate for 6 h at 37 °C in a humidified incubator with an atmosphere of 5% CO₂ and 21% O_2.
10. After 6 h, change to fresh complete growth media (10 mL) and return the cells back to the humidified incubator with an atmosphere of 5% CO₂ and 21% O_2.

2. LVS collection and ultracentrifugation

1. After 2 days of transfection, collect the virus-containing media and overlay the cells again with 10 mL of fresh complete growth media.
2. After 3 days of transfection, collect the virus-containing media and combine it with the virus-containing media collected at the 2 day time point.
3. Centrifuge the viral supernatant at 2,000 x g for 10 min at 4 °C to pellet cellular debris.
4. Filter the supernatant using a 0.45 µm pore size low protein binding filter (either PES or SFCA) and store at 4 °C until ready for ultracentrifugation. The filtered supernatant containing lentiviral particles can be stored at 4 °C for 5 days without a significant loss in viral titers.
5. Sterilize the ultracentrifuge tubes holding cups by washing them with 70% ethanol for 10 min, air dry, close, and keep at 4 °C.
6. Add 36 mL of filtered media containing lentiviral particles to a sterile ultracentrifuge tube.
7. Fill 5 mL of a sterile stripette with 4 mL of sterile 20% sucrose solution (prepared in PBS) and dispense it right to the bottom of the ultracentrifuge tube (UC) containing LVS. It is important that the sucrose solution is not mixed with the media and makes a gradient at the bottom of the tube.
8. Balance all the ultracentrifuge tubes using serum-free DMEM media, place in the cold ultracentrifuge tube holding cups, and close the lids.
9. Spin the tubes at 125,000 x g for 2 h at 4 °C.
10. After the spin, carefully discard the supernatant by inverting the contents of the tube in a container containing bleach without disturbing the pellet. Mark the pellet if visible.
11. Place the ultracentrifuge tube in a 50 mL sterile tube and add 200 µL of sterile DPBS exactly at the top of the pellet. Keep at 4 °C overnight undisturbed.
12. The following day, gently mix by pipetting up and down 40x.
13. Briefly spin at 13,000 x g in a tabletop centrifuge to pellet any debris.
14. Transfer the supernatant to a new tube and aliquot the virus preparation as 20 µL aliquots. Store at −80 °C.
15. Set aside 5 µL of the preparation for viral titer measurements.

3. LVS titer measurement for pLKO.1-based vectors

1. Determine the titer of lentiviral particles by using a qPCR following the manufacturer's recommendations.
2. For a standard curve, prepare five 10-fold serial dilutions of Standard Control DNA (provided in the kit) by diluting 5 µL of DNA into 45 µL of nuclease-free H₂O in each step. Use dilutions of 1:100 to 1:100,000 to generate a standard curve.
3. Set up reactions on ice in duplicates in the following manner:
   2x qPCR master mix        10 µL
   Primer mix                          2 µL
   Sample or standard DNA   2 µL
   Nuclease-free H₂O            6 µL
4. Perform qPCR using the cycling conditions mentioned in the manual of the kit for a total of 35 cycles.
5. Plot cycle threshold (Ct) values on the Y-axis vs. virus titer on the X-axis.
6. Generate a logarithmic regression using four standard control DNA dilutions (1:100 to 1:100,000) to determine the unknown virus sample titer using a trendline equation.

4. LVS titer measurement for pll3.7-based vectors

1. Seed 1 x 10⁵ HEK293T cells in each well of a P12-well plate in 1 mL of complete growth media 24 h before infections.
2. Supplement the media with 8 µg/mL polybrene and add 1 mL into each sterile 1.5 mL tube.
3. Dilute the viral particles by using 4 µL, 2 µL, 1 µL, 0.5 µL, and 0.1 µL of concentrated lentiviral particles in each of the 1 mL of polybrene-containing media.
4. Replace the media from HEK293T cells with the media containing indicated amounts of lentiviral particles along with 8 µg/mL polybrene and incubate for 24 h at 37 °C in a humidified incubator with an atmosphere of 5% CO₂ and 21% O₂.
5. The next day, change to fresh media and continue the culture for 72 h at 37 °C in a humidified incubator with an atmosphere of 5% CO₂ and 21% O₂.
6. After 72 h, wash the cells with PBS, trypsinize at 37 °C according to the manufacturer's protocol, and resuspend in 1 mL of PBS.
7. Perform FACS cell sorting using a cell sorter, following the manufacturer's recommendations. Set the gate to 0% GFP positive cells using non-infected HEK293T cells and count 50,000 events for each sample to determine the percentage of positive cells for each viral dilution.
8. Use only the volumes of lentiviral particles that give %GFP positive cells in the range of 2%-20% to calculate the titer of lentiviral particles.

5. Infection of hESCs and stable selection

1. Wash the cells with 2 mL of PBS growing in each well of a 6-well cell culture multiwell plate.
2. Detach the cells from the cell culture plate using 1 mL of 1x cell dissociation reagent by incubation at 37 °C for 5 min.
3. Collect the cells in DMEM/F12 media and centrifuge at 1,500 x g for 5 min at room temperature to collect the cell pellet.
4. Aspirate, resuspend the cells in 1 mL, and count using a hemocytometer.
5. Make a cell suspension with 2 x 10⁵ cells/mL of complete growth media containing mTeSR1 supplemented with 10 ng/mL basic fibroblast growth factor (bFGF), penicillin/streptomycin (P/S), and 10 µM ROCK Inhibitor (RI).
6. Seed 1 x 10⁵ cells on 50x diluted complete basement membrane matrix-coated P24-well plates in 500 µL of complete growth media and culture the cells at 37 °C in a humidified incubator with an atmosphere of 5% CO₂ and 21% O_2.
7. The following day, infect hESCs at a multiplicity of infection (MOI) of 10 with 8 µg/mL polybrene and incubate at 37 °C for 8 h.
8. After 8 h, replace the virus-containing media with fresh growth media (-RI) and continue the culture until the cells are 90% confluent.
9. Start puromycin selection (0.8 µg/mL) when the cells reach 90% confluency, which is usually 48-72 h post infection.
10. After selection is complete (usually 4-6 days), split the stable cells (1:4) and expand the cells for cryopreservation and further analysis.

6. Transduction of H9-derived neural progenitor cells (NPCs)

NOTE: NPCs were derived from H9 cells using a dual-Smad inhibition protocol, as described previously¹⁹.

1. Briefly, treat H9 cells with cell dissociation reagent at 37 °C for 5 min to generate single cells and resuspend in complete growth media containing mTeSR1 supplemented with 10 ng/mL basic fibroblast growth factor (bFGF), penicillin/streptomycin (P/S), and 10 µM ROCK Inhibitor (RI). Seed on 1:50 diluted Matrigel-coated 6-well cell culture dishes at a density of 60,000 cells/cm² (day 0).
2. Initiate differentiation when the cells reach 95%-100% confluency by changing to 100% KSR media containing LDN193189 (200 nM), and SB431542 (10 µM) (day1).
3. On day 2, change the media again with 100% KSR supplemented with LDN193189 (200 nM), SB431542 (10 µM), and XAV939 (5 µM).
4. On day 4 of differentiation, switch to a mixture of KSR medium (75%) and N2 medium (25%) with LDN193189 (200 nM), SB431542 (10 µM), and XAV939 (5 µM).
5. From day 6 to day 12, gradually switch the media to 100% N2 supplemented with LDN193189 (200 nM), SB431542 (10 µM), and XAV939 (5 µM) by increasing the N2 media 25% each day and changing the media after every 2 days.
6. Culture day 12 NPCs in N2:B27 media supplemented with 20 ng/mL bFGF.
7. Seed 2 x 10⁵ cells in each well of a 1:50 diluted complete basement membrane matrix-coated P6-plate in 2 mL of NPCs culture media and incubate to allow the cells to attach.
8. The next day, infect the cells with lentiviral particles at an MOI 6 in the presence of 8 µg/mL polybrene.
9. After 8 h, replace the virus-containing media with fresh NPC growth media.
10. The next day, repeat the infections and change the media at 8 h.
11. Keep the cells in culture for 72 h before harvesting for further analysis.

Representative Results

Following gene transfer, high viability of hESCs is inevitably required. Despite the efforts and optimization of protocols to reduce cell death following electroporation of hESCs, more than 50% cell death is still observed after electroporation of these cells, along with low transfection efficiency²⁰. Lentiviral mediated gene transfer not only results in high efficiency of gene transfer but also demonstrates high levels of cell viability following transduction. The results below present two approaches: one using GFP as reporter and transient expression in hESCs-derived NPCs and the other one using puromycin for the stable selection of hESCs for long-term differentiation experiments.

In the first set of experiments, lentiviral particles were produced by co-transfecting shRNAs carrying the pll3.7 vector with GFP as reporter along with second-generation lentiviral packaging plasmids psPAX2.0 and pMD2.G. Lentiviral particles were collected following 48 h and 72 h post transfection and concentrated using ultracentrifugation. Figure 1A shows the abundant GFP expression in HEK293T cells after 72 h of transfection. The expression of viral proteins also resulted in syncytia formation of HEK293T cells where single cells are fused together, as shown by arrows in Figure 1A. The titers were determined using FACS analysis. We also compared the lentiviral titers using low-cost PEI and Lipofectamine 3000 reagent and found no significant difference between the two in terms of viral titers (Figure 2A). Next, H9 hESCs-derived NPCs were infected twice with these GFP-containing lentiviral particles at an MOI of 6 and harvested for analysis post 72 h. Figure 1B shows marked expression of GFP in NPCs following infection. As discussed above, for long-term differentiation experiments, it is imperative to have hESCs that stably express shRNAs. In an attempt to create stable cell lines expressing shRNA for various genes, we used plKO.1-based vectors and cloned shRNAs according to the manufacturer's recommendations. Next, lentiviral particles were produced as described above, and titers were determined using a commercial lentiviral titer measurement kit using qPCR-based methods (Figure 2B). hESCs were infected with lentiviral particles at an MOI of 10 and selected using puromycin selection. Figure 3 shows the results of stable selection of hESCs following transduction. After 5 days of selection with 0.8 µg/mL puromycin, lentiviral transfected cells showed more than 80% cell viability as compared to non-transduced cells, where no cells survived the treatment. After the selection, the stably transduced H9 cells were further expanded, cryopreserved, and analyzed using western blot to assay for efficient gene knockdown.

In our laboratory, we have created multiple stable cell lines of H9 hESCs expressing shRNAs for different genes using the above approach. Here, we have presented the results of one of those, which is the L-2-hydroxyglutarate dehydrogenase (L2HGDH) gene using western blot analysis. Abundant expression of L2HGDH is observed in cells transduced with empty vector backbone. However, no expression of L2HGDH is observed in cells transduced with a vector carrying shRNAs for L2HGDH, showing the efficacy of the stable generation of an H9 hESCs cell line with reduced expression of L2HGDH, which can be used for further differentiation studies (Figure 4).

Figure 1: Expression of GFP in HEK293T cells and viral-infected NPCs. (A) shRNAs were cloned into a pll3.7 vector carrying GFP as reporter and co-transfected with packaging plasmids in HEK293T cells using PEI. The high GFP expression shows efficient transfection efficiency post 72 h of transfection. Arrows indicate syncytia formation in the HEK293T cells, where groups of individual HEK293T cells have fused together due to the expression of viral proteins. (B) H9-derived NPCs were infected twice at an MOI of 6 with lentiviral particles containing GFP as reporter, and GFP expression was observed at 72 h post infection. Scale bar = 50 µm. Please click here to view a larger version of this figure.

Figure 2: LVS titer measurements. (A) Viral titers for pll3.7-based vectors were measured using FACS analysis by quantifying the %GFP positive cells for those viral dilutions that gave 2%-20% GFP positive cells. (B) Viral titers for pLKO.1-based vectors were determined by using a commercial qPCR lentivirus titer kit, following the manufacturer's recommendations. Please click here to view a larger version of this figure.

Figure 3: Establishment of stable shRNA-expressing H9 hESC lines. shRNAs were cloned into pLKO.1-based lentiviral vectors carrying the puromycin selection gene. H9 hESCs were infected with lentiviral particles at an MOI of 10 and selected using puromycin. Using 0.8 µg/mL puromycin for 5 days, 100% of the non-infected cells were killed, while most of the cells survived the treatment in the viral-infected group. These cells were expanded without clonal selection for cryopreservation and further analysis. Scale bar = 50 µm. Please click here to view a larger version of this figure.

Figure 4: A representative western blot analysis for stable knockdown of the L2HGDH gene in H9 hESCs. Total cell lysates from negative control (H9, puro uncut) cells, as well as cells stably expressing shRNAs against L2HGDH (H9, sh-L2HGDH) were subjected to western blot using the anti-L2HGDH antibody. As shown in the figure, no expression of L2HGDH was observed in H9 hESCs stably expressing shRNAs for L2HGDH. A non-specific band was observed just above the specific band corresponding to the correct molecular weight of 46-48 kDa (indicated by a triangle) for the L2HGDH antibody. Anti-GAPDH was used as a loading control. Please click here to view a larger version of this figure.

Discussion

The ability to genetically modify stem cells for study or clinical purposes is limited both by technology and the basic understanding of the biology of hESCs. Techniques that have shown significant potential in mouse ESCs, like lipofection and electroporation, are not highly efficient for hESCs, which are notoriously difficult for gene delivery by conventional methods²⁰. This notion has led to not only the optimization of existing techniques but also the development of novel methods for increased transfection efficiency in hESCs. The focus of these new developments has been efficient and stable gene delivery to hESCs while maintaining minimal effect on hESCs' growth, pluripotency, and differentiation potential over prolonged periods. Among the various new developments that meet these strict criteria is lentiviral mediated gene transfer to hESCs^21,22. For the production of lentiviral particles expressing a certain gene, the desired gene is cloned in one of the transfer vectors and is transfected in HEK293T cells along with packaging plasmids to harvest a cell culture supernatant containing lentiviral particles. To be used in hESCs, it is essential to concentrate these viral particles using various techniques to yield high titers of viruses at least in the range of 1 x 10⁷-1 x 10⁸ IU/mL. In general, large volumes of LVS are concentrated from 200x-500x the original volume to achieve these titers. This means using a highly cost-effective method without compromising the transfection efficiency in HEK293T cells is a prerequisite for these methods to be routinely used in the lab. The present method describes the use of the cationic polymer PEI as a cost-effective method to produce large volumes of LVS with a transfection efficiency similar to lipofection-based methods, which are considered gold standard. Using the presented method, we can get average LVS titers well above 5 x 10⁷ IU/mL after a concentration factor of 200x the original volume. Using these LVS particles, we have been able to establish several stable cell lines of H9 hESCs expressing shRNAs for several genes by infecting the cells at high MOIs. The method presented here bypasses the use of tedious and time-consuming methods of clonal selection and expansion while still getting knockdown efficiencies close to 100%, as shown by one of the representative western blot results for L2HGDH gene knockdown in Figure 4. Following are some of the recommendations for a successful approach.

The use of a low passage number of HEK293T cells is required (ideally below 30) for high viral titers. The confluency of HEK293T cells is another important factor in this regard. HEK293T cells must be at least 80% confluent before transfection as cell-cell contact greatly reduces the cytotoxicity and improves virus production. The vectors used must be prepared using endotoxin-free plasmid isolation kits followed by ethanol precipitation and reconstituted at a minimum concentration of 1mg/mL before usage for transfection. There could be batch-to-batch variations of PEI solutions prepared at different dates. For that reason, each batch of PEI solution must be first tested for performance by using GFP vectors, and the solution must be stored at −20 °C in single-use aliquots to avoid repeated freeze-thaw cycles. For high titers, the collection of LVS supernatant post 72 h of transfection of HEK293T cells is only recommended provided the cells are healthy and attached. Filtration of the LVS-containing supernatant greatly increases the solubility of LVS post ultracentrifugation. It is not advised to store the LVS supernatant at 4 °C for more than 5 days as it will result in a significant reduction of virus titers. Sucrose gradient during ultracentrifugation is required for optimal titers. Temperatures must be maintained close to 4 °C during all the steps of ultracentrifugation. Overnight incubation of concentrated LVS particles in DPBS is required for complete resuspension. Centrifugation following resuspension of LVS removes cellular debris (if any) as it can cause cytotoxicity when used on target cells. After the infection of H9 cells, it is important to replace the virus-containing media with fresh growth media after 8 h as prolonged incubation with the virus would result in significant cell death of the H9 hESCs. The puromycin selection should only be started when the confluency is more than 80%.

The method described above was originally adapted for the expression of shRNAs. A similar approach could be used for the ectopic expression of cDNAs to be cloned into expression vectors. However, a major limitation of lentiviral mediated gene delivery is the size constraint. As size increases, the packaging of lentiviral vectors is not optimal, which results in reduced viral titers²³. Future research should be directed to optimize the protocol to overcome these constraints.

Materials

Name	Company	Catalog Number	Comments
2-Mercaptoethanol	Invitrogen	31350010
38.5 mL, Sterile + Certified Free Open-Top Thinwall Ultra-Clear Tubes	Beckman Coulter	C14292
Accutase	Stem Cell Technologies	7920
bFGF Recombinant human	Invitrogen	PHG0261
Bovine serum albumin FRAC V	Invitrogen	15260037
Corning Matrigel Basement Membrane Matrix, LDEV-free	Corning	354234
Cyclopamine	Stem Cell Technologies	72074
DMEM media	Invitrogen	11995073
DMEM Nutrient mix F12	Invitrogen	11320033
DPBS w/o: Ca and Mg	PAN Biotech	P04-36500
Fetal bovie serum	Invitrogen	10270106
GAPDH (14C10) Rabbit mAb Antibody	CST	2118S
Gentle Cell Dissociation Reagent	Stem Cell Technologies	7174
HyClone Non Essential Amino Acids (NEAA) 100X Solution	GE healthcare	SH30238.01
L Glutamine, 100X	Invitrogen	2924190090
L2HGDH Polyclonal antibody	Proteintech	15707-1-AP
L2HGDH shRNA	Macrogen		Seq: CGCATTCTTCATGTGAGAAAT
Lipofectamine 3000 kit	Thermo Fisher	L3000001
mTesR1 complete media	Stem Cell Technologies	85850
Neurobasal medium 1X CTS	Invitrogen	A1371201
Neuropan 2 Supplement 100x	PAN Biotech	P07-11050
Neuropan 27 Supplement 50x	PAN Biotech	P07-07200
Penicillin streptomycin SOL	Invitrogen	15140122
pLKO.1 TRC vector	Addgene	10878
pLL3.7 vector	Addgene	11795
pMD2.G	Addgene	12259
Polybrene infection reagent	Sigma	TR1003- G
Polyethylenimine, branched	Sigma	408727
psPAX2.0	Addgene	12260
Purmorphamine	Tocris	4551/10
Puromycin	Invitrogen	A1113802
ROCK inhibitor Y-27632 dihydrochloride	Tocris	1254
SB 431542	Tocris	1614/10
Trypsin .05% EDTA	Invitrogen	25300062
XAV 939	Tocris	3748/10