Overview
The video demonstrates the luciferase assay used to quantify luciferase-tagged proteins. The assay uses an engineered luciferase enzyme composed of a large fragment that binds with the small fragment, which is conjugated with a protein of interest. The bound subunits form an active enzyme that, in the presence of the substrate, releases a luminescent signal. This signal is then quantified using a luminometer.
Protocol
1. Production and evaluation of the HiBiT-RBD bioreporter
- Producing a sufficient quantity of HiBiT-RBD bioreporter
- Prepare for cell culture
- Prepare complete Dulbecco's modified Eagle medium (DMEM) containing 10% fetal bovine serum and 1% penicillin/streptomycin. Then, warm the media in a 37 °C water bath.
- Turn the biological safety cabinet (BSC) on and use 70% v/v ethanol for sterilizing the cabinet surface.
- Culture the cell line.
- Take out the cell line from -80 °C or liquid nitrogen and thaw it in a 37 °C water bath.
NOTE: An appropriate cell line is easy to maintain in culture, has high transfection efficiency, and is suitable for exogenous protein production. Human embryonic kidney, HEK293 cells were used for this protocol. - Mix the thawed cells with at least 10 mL of complete medium, pipette the cell suspension to a 10 cm Petri dish, and swirl the plate to distribute cells in the dish uniformly. Place the dish in a cell culture incubator at 37 °C, 5% CO2, and 85-95% humidity.
- Observe the cells under the microscope until the confluency level reaches 80-90%. At high confluency, remove the medium, wash the cells with warm phosphate-buffered saline (PBS), and add 1 mL of 0.25% trypsin-ethylenediamine tetra acetic acid to detach the cells from the surface.
NOTE: The HEK293 cells are fairly easily detached. Hence, the washing step should be done very gently to prevent accidental detachment and loss of cells. - After approximately 5 min, look at the cells under a microscope. If all cells are floating, add at least 4 mL of medium, and transfer the cell suspension into a new sterile tube. Count the cells using a hemocytometer and add 1 × 106 cells into each well of a 6-well plate for transfection.
NOTE: After 24 h, cells should be at 80% or more confluent.
- Take out the cell line from -80 °C or liquid nitrogen and thaw it in a 37 °C water bath.
- Transfection of the HiBiT-RBD plasmid
- Use 1 µg of the HiBiT-RBD expression plasmid with a suitable transfection reagent. Incubate for 10-15 min at room temperature, and then add the total volume to each well of the plate, drop-wise.
NOTE: Follow the manufacturer's transfection protocol. In this case, a mixture (a specified amount) of the transfection reagent with DMEM was added to the diluted plasmid (1 µg) in DMEM (see the Table of Materials). Use a marker containing (e.g., green fluorescent protein [GFP]) plasmid as a control to monitor the transfection efficiency. - On the next day, replace the medium containing the transfection mixture with complete medium. Observe the transfection control well 48 h after transfection.
NOTE: If the transfection was positive and efficient (more than 80% GFP-positive), the cells should be ready for harvesting the HiBiT-RBD bioreporter. The construct also contains His-tag, which can be used to obtain purified protein in place of the total supernatant. - Collect the supernatant in 1.5 mL microtubes. Add 500 µL of 1x passive lysis buffer (PLB) to the cells; incubate and shake the plate for 15 min at room temperature for cell lysis.
NOTE: The supernatant and the lysate solution can be preserved at -20 °C with minor loss of integrity for at least 6 months. The reporter is stable at a wide range of pH (4-12) and temperature (4-42 °C).
- Use 1 µg of the HiBiT-RBD expression plasmid with a suitable transfection reagent. Incubate for 10-15 min at room temperature, and then add the total volume to each well of the plate, drop-wise.
- Prepare for cell culture
- Evaluation of the luminescent signal from the bioreporter by luciferase assay
- Preparing the reaction components
- Use the supernatant as the source of the bioreporter.
NOTE: Both supernatant and lysate contain the HiBiT-RBD bioreporter and can be used for the assay. However, the supernatant is recommended as the source. - Dilute the LgBiT and substrate to 1x before use (stock concentration is 100x).
NOTE: See the Table of Materials for details about the LgBiT.
- Use the supernatant as the source of the bioreporter.
- Preparing the reaction components
Subscription Required. Please recommend JoVE to your librarian.
Materials
Name | Company | Catalog Number | Comments |
5x Passive Lysis Buffer | Promega | E194A | 30 mL |
DMEM | Sigma | D6429-500ml | |
Dual-Glo luciferase Assay System | Promega | E2940 | 100 mL kit |
Fetal Bovine Serum (FBS) | Sigma | F1051 | |
HiBiT-RBD Plasmid | gacggatcgggagatctcccgatcccctatggt gcactctcagtacaatctgctctgatgccgcata gttaagccagtatctgctccctgcttgtgtgttgg aggtcgctgagtagtgcgcgagcaaaattta agctacaacaaggcaaggcttgaccgacaa ttgcatgaagaatctgcttagggttaggcgttttg cgctgcttcgcgatgtacgggccagatatacgc gttgacattgattattgactagttattaatagt aatcaattacggggtcattagttcatagcccat atatggagttccgcgttacataacttacggtaa atggcccgcctggctgaccgcccaacgaccc ccgcccattgacgtcaataatgacgtatgttccc atagtaacgccaatagggactttccattgacgtc aatgggtggagtatttacggtaaactgcccact tggcagtacatcaagtgtatcatatgccaagta cgccccctattgacgtcaatgacggtaaatgg cccgcctggcattatgcccagtacatgaccttat gggactttcctacttggcagtacatctacgtat tagtcatcgctattaccatggtgatgcggtttt ggcagtacatcaatgggcgtggatagcggtttg actcacggggatttccaagtctccaccccattg acgtcaatgggagtttgttttggcaccaaaatc aacgggactttccaaaatgtcgtaacaactccg ccccattgacgcaaatgggcggtaggcgtgta cggtgggaggtctatataagcagagctctctgg ctaactagagaacccactgcttactggcttatcg aaattaatacgactcactatagggagacccaa gctggctagcgtttaaacttaagcttggtaccga gctcggatccgccaccATGGAGACAGA CACACTCCTGCTATGGGTACTGC TGCTCTGGGTTCCAGGTTCCAC TGGTGACtctggctctagcggctctggctct agcggcggcATGGTGAGCGGCTG GCGGCTGTTCAAGAAGATTAGC tctagcggcGACTACAAGGACC ACGACGGTGACTACAAGGACCA CGACATCGACTACAAGGACGAC GACGACAAGggcagcggctccggca gcagcggaggaggaggctctggaggagga ggctctagcggcggcaacatcacaaatctgtg cccattcggcgaggtgtttaacgccaccagat ttgccagcgtgtatgcctggaaccggaagaga atctctaattgcgtggccgactatagcgtgct gtacaatagcgcctccttctctacctttaagt gctatggcgtgtcccccacaaagctgaacgac ctgtgcttcaccaacgtgtacgccgactcttttgt gatcaggggcgatgaggtgcgccagatcgc acctggacagacaggcaagatcgccgactac aactataagctgccagacgatttcaccggct gcgtgatcgcctggaatagcaacaatctggatt ccaaagtgggcggcaactacaattatctgtac cggctgttcagaaagagcaacctgaagccctt tgagcgggatatcagcacagagatctaccag gcaggctccaccccttgcaacggagtggagg gcttcaattgttattttcccctgcagagctacggc ttccagcctacaaatggcgtgggctatcagcca tacagggtggtggtgctgtcctttgagctgctg cacgcacctgcaaccgtgtcctctggacacatc gagggccgccacatgctggagatgggccatc atcaccatcatcaccaccaccaccactgatag cggccgctcgagtctagagggcccgtttaaac ccgctgatcagcctcgactgtgccttctagtt gccagccatctgttgtttgcccctcccccgtg ccttccttgaccctggaaggtgccactcccac tgtcctttcctaataaaatgaggaaattgcat cgcattgtctgagtaggtgtcattctattctgggg ggtggggtggggcaggacagcaaggggga ggattgggaagacaatagcaggcatgctggg gatgcggtgggctctatggcttctgaggcggaa agaaccagctggggctctagggggtatcccca cgcgccctgtagcggcgcattaagcgcggcg ggtgtggtggttacgcgcagcgtgaccgctac acttgccagcgccctagcgcccgctcctttcg ctttcttcccttcctttctcgccacgttcgccggctt tccccgtcaagctctaaatcgggggctcccttta gggttccgatttagtgctttacggcacctcgacc ccaaaaaacttgattagggtgatggttcacgta gtgggccatcgccctgatagacggtttttcgcc ctttgacgttggagtccacgttctttaatagtg gactcttgttccaaactggaacaacactcaacc ctatctcggtctattcttttgatttataagggatttt gccgatttcggcctattggttaaaaaatgagctg atttaacaaaaatttaacgcgaattaattctgt ggaatgtgtgtcagttagggtgtggaaagtccc caggctccccagcaggcagaagtatgcaaag catgcatctcaattagtcagcaaccaggtgtgg aaagtccccaggctccccagcaggcagaagt atgcaaagcatgcatctcaattagtcagcaac catagtcccgcccctaactccgcccatcccgc ccctaactccgcccagttccgcccattctccgcc ccatggctgactaattttttttatttatgcagaggc cgaggccgcctctgcctctgagctattccagaa gtagtgaggaggcttttttggaggcctaggcttttg caaaaagctcccgggagcttgtatatccattttc ggatctgatcaagagacaggatgaggatcgttt cgcatgattgaacaagatggattgcacgcagg ttctccggccgcttgggtggagaggctattcggc tatgactgggcacaacagacaatcggctgctct gatgccgccgtgttccggctgtcagcgcagggg cgcccggttctttttgtcaagaccgacctgtccgg tgccctgaatgaactgcaggacgaggcagcg cggctatcgtggctggccacgacgggcgttcct tgcgcagctgtgctcgacgttgtcactgaagcg ggaagggactggctgctattgggcgaagtgcc ggggcaggatctcctgtcatctcaccttgctcctg ccgagaaagtatccatcatggctgatgcaatg cggcggctgcatacgcttgatccggctacctgc ccattcgaccaccaagcgaaacatcgcatcg agcgagcacgtactcggatggaagccggtct tgtcgatcaggatgatctggacgaagagcat caggggctcgcgccagccgaactgttcgcca ggctcaaggcgcgcatgcccgacggcgagg atctcgtcgtgacccatggcgatgcctgcttg ccgaatatcatggtggaaaatggccgctttt ctggattcatcgactgtggccggctgggtgt ggcggaccgctatcaggacatagcgttggct acccgtgatattgctgaagagcttggcggcg aatgggctgaccgcttcctcgtgctttacgg tatcgccgctcccgattcgcagcgcatcgcc ttctatcgccttcttgacgagttcttctgagcg ggactctggggttcgaaatgaccgaccaag cgacgcccaacctgccatcacgagatttcgat tccaccgccgccttctatgaaaggttgggctt cggaatcgttttccgggacgccggctggatga tcctccagcgcggggatctcatgctggagt tcttcgcccaccccaacttgtttattgcagctta taatggttacaaataaagcaatagcatcacaa atttcacaaataaagcatttttttcactgcatt ctagttgtggtttgtccaaactcatcaatgtat cttatcatgtctgtataccgtcgacctctagct agagcttggcgtaatcatggtcatagctgtttc ctgtgtgaaattgttatccgctcacaattccacac aacatacgagccggaagcataaagtgtaaag cctggggtgcctaatgagtgagctaactcacat taattgcgttgcgctcactgcccgctttccagtc gggaaacctgtcgtgccagctgcattaatgaa tcggccaacgcgcggggagaggcggtttgcg tattgggcgctcttccgcttcctcgctcactgactc gctgcgctcggtcgttcggctgcggcgagcggt atcagctcactcaaaggcggtaatacggttatc cacagaatcaggggataacgcaggaaagaa catgtgagcaaaaggccagcaaaaggccag gaaccgtaaaaaggccgcgttgctggcgtttt tccataggctccgcccccctgacgagcatcac aaaaatcgacgctcaagtcagaggtggcgaa acccgacaggactataaagataccaggcgtt tccccctggaagctccctcgtgcgctctcctgtt ccgaccctgccgcttaccggatacctgtccgcc tttctcccttcgggaagcgtggcgctttctcat agctcacgctgtaggtatctcagttcggtgtag gtcgttcgctccaagctgggctgtgtgcacgaa ccccccgttcagcccgaccgctgcgccttatcc ggtaactatcgtcttgagtccaacccggtaag acacgacttatcgccactggcagcagccactg gtaacaggattagcagagcgaggtatgtaggc ggtgctacagagttcttgaagtggtggcctaact acggctacactagaagaacagtatttggtatc tgcgctctgctgaagccagttaccttcggaaa aagagttggtagctcttgatccggcaaacaaa ccaccgctggtagcggtggtttttttgtttgca agcagcagattacgcgcagaaaaaaaggat ctcaagaagatcctttgatcttttctacggggt ctgacgctcagtggaacgaaaactcacgttaa gggattttggtcatgagattatcaaaaaggatct tcacctagatccttttaaattaaaaatgaagtt ttaaatcaatctaaagtatatatgagtaaactt ggtctgacagttaccaatgcttaatcagtgagg cacctatctcagcgatctgtctatttcgttcatcca tagttgcctgactccccgtcgtgtagataactac gatacgggagggcttaccatctggccccagtg ctgcaatgataccgcgagacccacgctcacc ggctccagatttatcagcaataaaccagccag ccggaagggccgagcgcagaagtggtcctg caactttatccgcctccatccagtctattaattgtt gccgggaagctagagtaagtagttcgccagtt aatagtttgcgcaacgttgttgccattgctacag gcatcgtggtgtcacgctcgtcgtttggtatgg cttcattcagctccggttcccaacgatcaaggc gagttacatgatcccccatgttgtgcaaaaaag cggttagctccttcggtcctccgatcgttgtca gaagtaagttggccgcagtgttatcactcatggt tatggcagcactgcataattctcttactgtcatg ccatccgtaagatgcttttctgtgactggtgagta ctcaaccaagtcattctgagaatagtgtatgcg gcgaccgagttgctcttgcccggcgtcaatacg ggataataccgcgccacatagcagaactttaa aagtgctcatcattggaaaacgttcttcggggc gaaaactctcaaggatcttaccgctgttgagat ccagttcgatgtaacccactcgtgcacccaact gatcttcagcatcttttactttcaccagcgtttc tgggtgagcaaaaacaggaaggcaaaatgc cgcaaaaaagggaataagggcgacacgga aatgttgaatactcatactcttcctttttcaat attattgaagcatttatcagggttattgtc tcatgagcggatacatatttgaatgtattt agaaaaataaacaaataggggttccgcgca catttccccgaaaagtgccacctgacgtc | ||
LgBiT | Promega | N3030 | |
penicillin Streptomycin | Thermo Fisher Scientific | 15140122 | |
PolyJet In Vitro DNA Transfection Reagent | Signagen | SL100688.5 | |
SARS-CoV-2 (2019-nCoV) Spike Neutralizing Antibody, Mouse Mab | SinoBiological | 40592-MM57 | |
Synergy Mx Microplate Reader | BioTek | 96-well plate reader luminometer | |
Trypsin-EDTA | Thermo Fisher Scientific | 2520056 | 0.25% |