Name: 대형 DNA 주형의 상동성 매개 말단 결합을 통한 일차 인간 T 세포의 비바이러스 공학 (동영상) | JoVE Journal
Uploaded: 2025-05-09T14:50:00.000+00:00
Duration: 6 min 10 s
Description: 학습하세요 CRISPR/Cas9과 HMEJ 경로를 활용한 비바이러스 일차 인간 T 세포 공학 방법입니다. 대형 다시스트론 구조물을 효율적으로 통합하여 면역치료용 기능성 T 세포를 제작하는 비용 효율적인 프로토콜을 탐색하세요.

ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

<ol><li>Sun, L., Su, Y., Jiao, A., Wang, X., Zhang, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((T+cells+in+health+and+disease%5BTitle%5D)+AND+%22Signal+Transduct+Target+Ther%22%5BJournal%5D)">T cells in health and disease.</a> Signal Transduct Target Ther. 8 (1), 235(2023).</li>
<li>Takahama, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Journey+through+the+thymus%3A+stromal+guides+for+T-cell+development+and+selection%5BTitle%5D)+AND+%22Nature+reviews.+Immunology%22%5BJournal%5D)">Journey through the thymus: stromal guides for T-cell development and selection.</a> Nature reviews. Immunology. 6 (2), 127-135 (2006).</li>
<li>Dotti, G., Gottschalk, S., Savoldo, B., Brenner, M. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Design+and+development+of+therapies+using+chimeric+antigen+receptor-expressing+T+cells%5BTitle%5D)+AND+%22Immunol+Rev%22%5BJournal%5D)">Design and development of therapies using chimeric antigen receptor-expressing T cells.</a> Immunol Rev. 257 (1), 107-126 (2014).</li>
<li>DeRenzo, C., Gottschalk, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genetic+modification+strategies+to+enhance+CAR+T+cell+persistence+for+patients+with+solid+tumors%5BTitle%5D)+AND+%22Front+Immunol%22%5BJournal%5D)">Genetic modification strategies to enhance CAR T cell persistence for patients with solid tumors.</a> Front Immunol. 10, 218(2019).</li>
<li>Liu, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+chimeric+switch-receptor+targeting+PD1+augments+the+efficacy+of+second-generation+CAR+T+cells+in+advanced+solid+tumors%5BTitle%5D)+AND+%22Cancer+Res%22%5BJournal%5D)">A chimeric switch-receptor targeting PD1 augments the efficacy of second-generation CAR T cells in advanced solid tumors.</a> Cancer Res. 76 (6), 1578-1590 (2016).</li>
<li>Yeku, O. O., Purdon, T. J., Koneru, M., Spriggs, D., Brentjens, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Armored+CAR+T+cells+enhance+anti-tumor+efficacy+and+overcome+the+tumor+microenvironment%5BTitle%5D)+AND+%22Sci+Rep%22%5BJournal%5D)">Armored CAR T cells enhance anti-tumor efficacy and overcome the tumor microenvironment.</a> Sci Rep. 7 (1), 10541(2017).</li>
<li>Schober, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Orthotopic+replacement+of+T-cell+receptor+%CE%B1-+and+%CE%B2-chains+with+preservation+of+near-physiological+T-cell+function%5BTitle%5D)+AND+%22Nat+Biomed+Eng%22%5BJournal%5D)">Orthotopic replacement of T-cell receptor α- and β-chains with preservation of near-physiological T-cell function.</a> Nat Biomed Eng. 3 (12), 974-984 (2019).</li>
<li>Roth, T. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Reprogramming+human+T+cell+function+and+specificity+with+non-viral+genome+targeting%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">Reprogramming human T cell function and specificity with non-viral genome targeting.</a> Nature. 559 (7714), 405-409 (2018).</li>
<li>Chandran, S. S., Klebanoff, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((T+cell+receptor-based+cancer+immunotherapy%3A+Emerging+efficacy+and+pathways+of+resistance%5BTitle%5D)+AND+%22Immunol+Rev%22%5BJournal%5D)">T cell receptor-based cancer immunotherapy: Emerging efficacy and pathways of resistance.</a> Immunol Rev. 290 (1), 127-147 (2019).</li>
<li>Rosenberg, S. A., Restifo, N. P. Adoptive cell transfer as personalized immunotherapy for human cancer. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aRosenberg%2C+SA+%22Science+%28New+York%2C+N.Y.%29%22">Science (New York, N.Y.)</a>. 348 (6230), 62-68 (2015).</li>
<li>Campoli, M., Ferrone, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((HLA+antigen+and+NK+cell+activating+ligand+expression+in+malignant+cells%3A+a+story+of+loss+or+acquisition%5BTitle%5D)+AND+%22Semin+Immunopathol%22%5BJournal%5D)">HLA antigen and NK cell activating ligand expression in malignant cells: a story of loss or acquisition.</a> Semin Immunopathol. 33 (4), 321-334 (2011).</li>
<li>Walther, W., Stein, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Viral+vectors+for+gene+transfer%3A+a+review+of+their+use+in+the+treatment+of+human+diseases%5BTitle%5D)+AND+%22Drugs%22%5BJournal%5D)">Viral vectors for gene transfer: a review of their use in the treatment of human diseases.</a> Drugs. 60 (2), 249-271 (2000).</li>
<li>Bulcha, J. T., Wang, Y., Ma, H., Tai, P. W. L., Gao, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Viral+vector+platforms+within+the+gene+therapy+landscape%5BTitle%5D)+AND+%22Signal+Transduct+Target+Ther%22%5BJournal%5D)">Viral vector platforms within the gene therapy landscape.</a> Signal Transduct Target Ther. 6 (1), 53(2021).</li>
<li>Kumar, M., Keller, B., Makalou, N., Sutton, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Systematic+determination+of+the+packaging+limit+of+lentiviral+vectors%5BTitle%5D)+AND+%22Hum+Gene+Ther%22%5BJournal%5D)">Systematic determination of the packaging limit of lentiviral vectors.</a> Hum Gene Ther. 12 (15), 1893-1905 (2001).</li>
<li>Samulski, R. J., Muzyczka, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((AAV-mediated+gene+therapy+for+research+and+therapeutic+purposes%5BTitle%5D)+AND+%22Annu+Rev+Virol%22%5BJournal%5D)">AAV-mediated gene therapy for research and therapeutic purposes.</a> Annu Rev Virol. 1 (1), 427-451 (2014).</li>
<li>Wang, D., Tai, P. W. L., Gao, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Adeno-associated+virus+vector+as+a+platform+for+gene+therapy+delivery%5BTitle%5D)+AND+%22Nature+reviews.+Drug+Discov%22%5BJournal%5D)">Adeno-associated virus vector as a platform for gene therapy delivery.</a> Nature reviews. Drug Discov. 18 (5), 358-378 (2019).</li>
<li>Pomeroy, E. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((a+genetically+engineered+primary+human+natural+killer+cell+platform+for+cancer+immunotherapy%5BTitle%5D)+AND+%22Mol+Ther%22%5BJournal%5D)">a genetically engineered primary human natural killer cell platform for cancer immunotherapy.</a> Mol Ther. 28 (1), 52-63 (2020).</li>
<li>Johnson, M. J., Laoharawee, K., Lahr, W. S., Webber, B. R., Moriarity, B. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Engineering+of+primary+human+B+cells+with+CRISPR%2FCas9+targeted+nuclease%5BTitle%5D)+AND+%22Sci+Rep%22%5BJournal%5D)">Engineering of primary human B cells with CRISPR/Cas9 targeted nuclease.</a> Sci Rep. 8 (1), 12144(2018).</li>
<li>Nguyen, D. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Polymer-stabilized+Cas9+nanoparticles+and+modified+repair+templates+increase+genome+editing+efficiency%5BTitle%5D)+AND+%22Nat+Biotechnol%22%5BJournal%5D)">Polymer-stabilized Cas9 nanoparticles and modified repair templates increase genome editing efficiency.</a> Nat Biotechnol. 38 (1), 44-49 (2020).</li>
<li>Lock, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Automated%2C+scaled%2C+transposon-based+production+of+CAR+T+cells%5BTitle%5D)+AND+%22J+Immunother+Cancer%22%5BJournal%5D)">Automated, scaled, transposon-based production of CAR T cells.</a> J Immunother Cancer. 10 (9), e005189(2022).</li>
<li>Semenova, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Multiple+cytosolic+DNA+sensors+bind+plasmid+DNA+after+transfection%5BTitle%5D)+AND+%22Nucleic+Acids+Res%22%5BJournal%5D)">Multiple cytosolic DNA sensors bind plasmid DNA after transfection.</a> Nucleic Acids Res. 47 (19), 10235-10246 (2019).</li>
<li>Wimberger, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Simultaneous+inhibition+of+DNA-PK+and+Pol%CF%B4+improves+integration+efficiency+and+precision+of+genome+editing%5BTitle%5D)+AND+%22Nat+Comm%22%5BJournal%5D)">Simultaneous inhibition of DNA-PK and Polϴ improves integration efficiency and precision of genome editing.</a> Nat Comm. 14 (1), 4761(2023).</li>
<li>Monjezi, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Enhanced+CAR+T-cell+engineering+using+non-viral+Sleeping+Beauty+transposition+from+minicircle+vectors%5BTitle%5D)+AND+%22Leukemia%22%5BJournal%5D)">Enhanced CAR T-cell engineering using non-viral Sleeping Beauty transposition from minicircle vectors.</a> Leukemia. 31 (1), 186-194 (2017).</li>
<li>Kay, M. A., He, C. -Y., Chen, Z. -Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+robust+system+for+production+of+minicircle+DNA+vectors%5BTitle%5D)+AND+%22Nat+Biotechnol%22%5BJournal%5D)">A robust system for production of minicircle DNA vectors.</a> Nat Biotechnol. 28 (12), 1287-1289 (2010).</li>
<li>Webber, B. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cas9-induced+targeted+integration+of+large+DNA+payloads+in+primary+human+T+cells+via+homology-mediated+end-joining+DNA+repair%5BTitle%5D)+AND+%22Nat+Biomed+Eng%22%5BJournal%5D)">Cas9-induced targeted integration of large DNA payloads in primary human T cells via homology-mediated end-joining DNA repair.</a> Nat Biomed Eng. 8, 1553-1570 (2024).</li>
<li>Williams, J. A., Paez, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Improving+cell+and+gene+therapy+safety+and+performance+using+next-generation+Nanoplasmid+vectors%5BTitle%5D)+AND+%22Mol+Ther+Nucleic+Acids%22%5BJournal%5D)">Improving cell and gene therapy safety and performance using next-generation Nanoplasmid vectors.</a> Mol Ther Nucleic Acids. 32, 494-503 (2023).</li>
<li>Wierson, W. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Efficient+targeted+integration+directed+by+short+homology+in+zebrafish+and+mammalian+cells%5BTitle%5D)+AND+%22eLife%22%5BJournal%5D)">Efficient targeted integration directed by short homology in zebrafish and mammalian cells.</a> eLife. 9, 53968(2020).</li>
<li>Hendel, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Chemically+modified+guide+RNAs+enhance+CRISPR-Cas+genome+editing+in+human+primary+cells%5BTitle%5D)+AND+%22Nat+Biotechnol%22%5BJournal%5D)">Chemically modified guide RNAs enhance CRISPR-Cas genome editing in human primary cells.</a> Nat Biotechnol. 33 (9), 985-989 (2015).</li>
<li>Moretti, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+past%2C+present%2C+and+future+of+non-viral+CAR+T+cells%5BTitle%5D)+AND+%22Front+Immunol%22%5BJournal%5D)">The past, present, and future of non-viral CAR T cells.</a> Front Immunol. 13, 867013(2022).</li>
</ol>

<table><tbody><tr><td>아세트산</td><td>밀리포어 시그마</td><td>A6283</td><td></td></tr><tr><td>1x DPBS, 칼슘 없음, 마그네슘 없음</td><td>Thermo Fisher Scientific</td><td>14190144</td><td></td></tr><tr><td>2.5% CTS 면역 세포 혈청 대체</td><td>Thermo Fisher Scientific</td><td>A2596101</td><td></td></tr><tr><td>Amaxa P3 1차 세포 4D-Nucleofactor X 키트 L</td><td>Lonza</td><td>V4XP-3024</td><td></td></tr><tr><td>Amaxa P3 1차 세포 4D-Nucleofactor X 키트 S</td><td>Lonza</td><td>V4XP-3032</td><td></td></tr><tr><td>소 혈청 알부민</td><td>Thermo Fisher Scientific</td><td>15561020</td><td></td></tr><tr><td>화학 변형 가이드 RNA</td><td>통합 DNA 기술</td><td>및</td><td>맞춤형 디자인</td></tr><tr><td>CleanCap Cas9 mRNA</td><td>Trilink</td><td>L-7206</td><td></td></tr><tr><td>CTS OpTmizer T 세포 확장 배지 SFM +OpTmizer T 세포 확장 보충제</td><td>Thermo Fisher Scientific</td><td>A1048501</td><td></td></tr><tr><td>DNase I</td><td>줄기 세포 기술</td><td>07900</td><td></td></tr><tr><td>Dynabeads 인간 T-활성제 CD3/CD28&nbsp;</td><td>써모 피셔 사이언티픽</td><td>11141D</td><td></td></tr><tr><td>다이나마그-2</td><td>써모 피셔 사이언티픽</td><td>12321D</td><td></td></tr><tr><td>인간 IL15</td><td>페프로테크</td><td>200-15</td><td></td></tr><tr><td>인간 IL2</td><td>페프로테크</td><td>200-02&nbsp;</td><td></td></tr><tr><td>인간 IL7</td><td>PeproTech</td><td>200-07</td><td></td></tr><tr><td>L-글루타민</td><td>Thermo Scientific&nbsp;</td><td>25030081</td><td></td></tr><tr><td>Lonza 4D 핵실험기&nbsp; 코어</td><td>Lonza</td><td>AAF-1003B</td><td></td></tr><tr><td>Lonza 4D 핵무기&nbsp; X 유닛</td><td>Lonza</td><td>AAF-1003X</td><td></td></tr><tr><td>Minicircle</td><td>System Biosciences</td><td>MN910A-1</td><td>맞춤형 디자인</td></tr><tr><td>N-아세틸-L-시스테인</td><td>밀리포어 시그마</td><td>A9165</td><td></td></tr><tr><td>나노플라스미드</td><td>알데브론</td><td>및</td><td>맞춤형 디자인</td></tr><tr><td>페니실린/스트렙토마이신</td><td>써모 피셔 사이언티픽</td><td>15-140-122</td><td></td></tr></tbody></table>

대형 dna 주형의 상동성 매개 말단 결합을 통한 일차 인간 t 세포의 비바이러스 공학

Non-Viral Engineering of Primary Human T Cells via Homology-Mediated End-Joining Targeted Integration of Large DNA Templates

여기에서 "Giant Minicircle" 구조체라고 하는 대형(&gt;6.3kb) multicistronic 템플릿이 CRISPR/Cas9 편집을 사용하여 1차 인간 T 세포의 TRAC 유전자 자리에 통합되었습니다. TRAC 특이적 gRNA(TCTCTCAGCTGGTACACGGC), UgRNA 및 HMEJ 나노플라스미드(그림 2A)는 TRAC 특이적 gRNA, 범용 gRNA 및 음성 대조군으로 사용된 Cas9 mRNA가 결핍된 상태입니다. Giant Minicircle 구조체, TRAC 특이적 gRNA, 범용 gRNA 및 Cas9 mRNA를 포함하는 샘플은 GFP 발현을 측정할 때 평균 23.35%(23.5% ± 5.247)인 반면, 음성 대조군은 GFP 발현이 없었습니다(그림 2B). 실험 조건 간에 접힘 확장(그림 2C)과 생존력(그림 2D)에는 유의한 차이가 없었습니다. 이러한 결과는 매우 큰 템플릿의 고효율 knock-in을 보여주면서 우수한 세포 생존력과 세포 확장을 유지합니다.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/68150/68150fig01.jpg"> 그림 1: HMEJ 구성 설계의 개략도. <a href="https://www.jove.com/files/ftp_upload/68150/68150fig01large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/68150/68150fig02.jpg"> 그림 2: 거대 미니서클 구조체로 전기천공된 T 세포의 특성화. (A) Giant Minicircle 구성의 개략도, GSG 링커, anti-CD19 CAR 및 MND 프로모터 아래의 DHFR 뮤테인 및 eGFP를 사용하여 TRAC 프로모터 하에서 항-메소텔린 CAR 및 RQR8을 인코딩하는 대형(&gt;6.3kb) 다중시스트로닉 템플릿. (B) Giant Minicircle 구조체 및 CRISPR-Cas9 시약을 사용한 전기천공 후 9일 후 T 세포의 RQR8 발현 비율, (C) 접힘 확장 및 (D) 생존율, CRISPR-Cas9 시약이 없는 Giant Minicircle로 전기천공된 음성 대조군과 비교. (***p &lt; 0.001). <a href="https://www.jove.com/files/ftp_upload/68150/68150fig02large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td>플레이트 크기</td>
			<td>큐벳 볼륨</td>
			<td>세포/웰</td>
			<td>복구 미디어의 볼륨</td>
			<td>1x TCM(NAC 포함) 부피</td>
			<td>총 최종 부피</td>
		</tr><tr><td>24웰 플레이트</td>
			<td>22/22 μL</td>
			<td>1-3 엑스 106</td>
			<td>300 마이크로L</td>
			<td>680 마이크로L</td>
			<td>1 mL</td>
		</tr><tr><td>6웰 플레이트</td>
			<td>100/110 μL</td>
			<td>4-20 엑스 106</td>
			<td>1 mL</td>
			<td>2.9 밀리리터</td>
			<td>4 mL</td>
		</tr><tr><td>24웰 G-Rex 플레이트</td>
			<td>20-110 μL</td>
			<td>1-20 엑스 106</td>
			<td>400 μL</td>
			<td>5.6 밀리리터</td>
			<td>6 밀리리터</td>
		</tr></tbody></table>표 1: 큐벳 및 회수 플레이트의 세포 농도.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td>큐벳 크기</td>
			<td>템플릿 플라스미드</td>
			<td>타겟 부위 gRNA</td>
			<td>플라스미드 선형화 gRNA</td>
			<td>Cas9 mRNA</td>
		</tr><tr><td>20 마이크로L</td>
			<td>1-2 μg (1 μg)</td>
			<td>1-3 μg (1 μg)</td>
			<td>1-3 μg (1 μg)</td>
			<td>1-3 μg (1.5 μg)</td>
		</tr><tr><td>100 마이크로L</td>
			<td>5-10 μg (5 μg)</td>
			<td>5-15 μg (5 μg)</td>
			<td>5-15 μg (5 μg)</td>
			<td>5-15 μg (5 μg)</td>
		</tr></tbody></table>표 2: 필요한 CRISPR/Cas9 시약 및 DNA 템플릿의 양.

대형 DNA 주형의 상동성 매개 말단 결합을 통한 일차 인간 T 세포의 비바이러스 공학

Many current adoptive cellular therapies rely on lenti- or retroviral vectors to engineer T cells for the expression of a chimeric antigen receptor (CAR) ...

non-viral-engineering-primary-human-t-cells-via-homology-mediated-end

Research

연구

JoVE Journal

Biology

생물학

의 생성에 대한 신속, 간단하고 비용 효율적인 프로토콜 기증자 파생 CMV, EBV 감염 또는 교수실을 개발하는 위험 allogeneic 조혈 줄기 세포 이식 (HSCT) 수신자에게 주입을위한 multivirus 특정 CTLs (rCTL을). 이 제조 과정은 GMP 준수하고 전문 센터 이외 T - 세포 immunotherapy의 광범위한 구현을 보장한다.

Multivirus 특정 T 세포 생성 Allogeneic 조혈 줄기 세포 이식 후 바이러스 감염을 예방 / 치료

유전자 표적화 방법론을 사용하여 knockout, knock-in 및 tagged 대립유전자가 있는 형질전환 마우스를 생성할 수 있습니다.  여기에서는 E. coli에서 재조합하는 개선된 방법, 즉 'subcloning plus insertion'이라고 하는 재조합 방법을 설명하며, 이는 맞춤형 유전자 표적화 벡터를 빠르게 생성하는 데 사용할 수 있습니다.

서브 클로닝 플러스 삽입 (SPI) - 유전자 타겟팅 벡터의 신속한 건설 소설 Recombineering 방법

이 프로토콜은 전사 인자의 강제 발현을 통해 인간 만능 줄기 세포에서 혈구 내피 및 다중전위 조혈 전구 세포의 효율적인 유도를 설명합니다.

인간 만능 줄기 세포에서 전사 인자의 과발현에 의해 직접 Hemogenic 내피 세포의 유도 및 혈액

감염된 세포의 게놈 DNA에서 레트로바이러스 통합 부위를 증폭하고, 증폭된 바이러스-숙주 접합부를 염기서열분석한 다음, 이러한 염기서열을 참조 게놈에 매핑하는 프로토콜을 설명합니다. 또한 BEDTools를 사용하여 다양한 게놈 주석과 관련된 통합 부위의 분포를 정량화하는 기술에 대해서도 설명합니다.

레트로 바이러스 통합 사이트의 증폭, 차세대 시퀀싱 및 게놈 DNA 매핑

여기서 우리는, 기존 TCR의 TCRα 또는 TCRβ 페어링 말초 T 세포 수용체 레퍼토리 상보 hemichain으로 관심 항원 특이성을 보유하여 항원 특이 적 T 세포 수용체 (TCR도)을 생성하는 신규 한 방법을 설명한다. 드 노보 생성 TCR도 선호도 변화와 항원 특이성을 유지한다.

생성<em&gt; 드 노보</em&gt; 중심 Hemichain의 레트로 바이러스 형질 도입에 의해 항원 특이 적 인간 T 세포 수용체

이 원고는 상향 및 하향 벡터 - 숙주 접합 DNA를 동시에 분석 할 수있는 양방향 통합 사이트 분석을위한 실험 절차 및 소프트웨어 분석을 설명합니다. 양방향 PCR 제품은 모든 다운 스트림 시퀀싱 플랫폼에 사용할 수 있습니다. 결과 데이터는 통합 DNA 표적의 높은 처리량, 정량적 비교에 유용합니다.

양방향 레트로 바이러스 통합 사이트 PCR 방법론 및 정량적 데이터 분석 워크 플로

이 프로토콜 설명 합니다 자세한 워크플로 생성에 대 한 immunomodulators, 예를 들어 bispecific T 세포 engagers를 인코딩 하는 홍 역 바이러스를 사용 하 여 표현 위한 oncolytic 바이러스의 비보 특성화 전. 응용 프로그램 및 다른 벡터 플랫폼 및 transgenes 적응 임상 번역 소설 immunovirotherapeutics의 개발을 가속화할 것 이다.

종양 대상 Immunomodulation에 대 한 paramyxoviruses: 설계 및 평가 전 비보

여기서 우리는 B 세포에서 유전자의 생물학적 기능을 연구하고 B 세포 치료제의 개발을 연구하기 위해 유전자 녹아웃 (KO) 및 노크 인 (KI)에 대한 1 차 인간 B 세포의 CRISPR / Cas9 기반 게놈 공학을위한 상세한 단계별 프로토콜을 제공합니다.

CRISPR/Cas9를 사용하여 1차 인간 B 세포의 게놈 공학

조혈 줄기 및 전구 세포 (HSPC)의 체세포 돌연변이를 충실하게 모델링하는 새로운 전략은 조혈 줄기 세포 생물학 및 혈액 악성 종양을 더 잘 연구하는 데 필요합니다. 여기에서는 CRISPR/Cas9의 사용과 이중 rAAV 공여체 형질도입을 결합하여 HSPC에서 이형접합체 기능 획득 돌연변이를 모델링하는 프로토콜이 설명됩니다.

인간 조혈 줄기 및 전구 세포에서 발암성 이형접합체 기능 획득 돌연변이 공학

Metagenomic 도서관 대규모 화면

학습하세요 CRISPR/Cas9과 HMEJ 경로를 활용한 비바이러스 일차 인간 T 세포 공학 방법입니다. 대형 다시스트론 구조물을 효율적으로 통합하여 면역치료용 기능성 T 세포를 제작하는 비용 효율적인 프로토콜을 탐색하세요.

대형 DNA 주형의 상동성 매개 말단 결합을 통한 일차 인간 T 세포의 비바이러스 공학

더 많은 동영상 탐색