Short Hairpin RNA-Mediated Gene Knockdown in iHSPCs In Vitro: A Lentivirus-Based shRNA Expression System Delivery into iHSPCs for Knockdown of Specific Gene Expression

Abstract

Source: Hsiao, Y. L., et al. Study of Dendritic Cell Development by Short Hairpin RNA-Mediated Gene Knockdown in a Hematopoietic Stem and Progenitor Cell Line In vitro. J. Vis. Exp. (2022).

In this video, we demonstrate a method to perform transduction of shRNA lentiviral vectors to obtain stable knockdown cell lines in immortalized hematopoietic stem and progenitor cells (iHSPCs).

Protocol

1. Preparation of immortalized hematopoietic stem and progenitor cell lines (iHSPCs)

1. Maintain iHSPC cell line in complete RPMI 1640 medium containing 100 ng/mL FL and 1 μM β-estradiol.
2. Passage the cells at a ratio of 1:10 every 3 days.
   NOTE: Make complete RPMI 1640 medium by supplementing with 10% fetal bovine serum (FBS), 5 x10^-5 M β-mercaptoethanol, and 10 μg/mL gentamicin. Recombinant murine FL is also commercially available.

2. Lentiviral transduction

1. Plate iHSPCs at a density of 1 x 10⁵ cells/well....

Results

Figure 1: The construct of lentiviral vector pLKO.1-Puro.

....

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
1.5 mL Micro tube 	ExtraGene 	TUBE-170-C
12-well tissue culture-treated plate 	Falcon 	353043
Fetal bovine serum (FBS) 	Corning 	35-010-CV
RPMI 1640 medium 	Gibco 	11875-085
β-estradiol  	Sigma-Aldrich	E2758-250MG
β-mercaptoethanol (β-ME) 	Sigma-Aldrich 	M6250
Flt3 ligand (FL) 	Home-made
Polybrene 	Sigma-Aldrich 	TR-1003-G
Puromycin 	Invivogen 	ant-pr-1
shId2 (GCTTATGTCGAATGATAGCAA/TRCN0000054390)	The RNAi Consortium (TRC)
shLacZ (CGCGATCGTAATCACCCGAGT/TRCN0000072224)	The RNAi Consortium (TRC)
shTcf4 (GCTGAGTGATTTACTGGATTT/TRCN0000012094)	The RNAi Consortium (TRC)