Duplex Digital PCR for Simultaneous Quantification of Dual Genetic Markers

Abstract

Source: Cao, Y., et al. A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters. J. Vis. Exp. (2016)

In this video, we demonstrate the duplex digital PCR (ddPCR) technique — a modification of the traditional PCR technique that is useful in detecting two different genetic markers simultaneously. A single PCR reaction is partitioned into nanoliter-sized emulsified droplets that are independently amplified, and the detection of differently colored fluorescence amplification signals from the fraction of droplets is used to compute the initial concentration of the target sequences.

Protocol

1. Assay Mixture Preparation

1. Make 100 µmol/L stock concentrations for all primers in molecular grade water and probes in TE pH 8 buffer [Entero F1A, Entero R1, GPL813TQ; HF183-1, BthetR1, BthetP].
   NOTE: Probes for the two targets are fluorescently labeled with different fluorophores as indicated in the List of Materials/Equipment.
2. Prepare master mix by mixing, per reaction planned, 12 µl digital PCR mix (2x stock, see List of Materials/Equipment), 0.216 µl each forward and reverse primer, 0.06 µl each fluorescent probe, and 5.016 µl nuclease-free water (final conce....

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
Low Bind Microtubes	Costar	3207	For storage of reagents, samples/production of master mixes
Nuclease-Free Water	FisherSci	BP2484-50
TE pH 8 buffer	FisherSci	BP2473-100
Hardshell 96-Well Plate	BioRad	HSP-9601	For initial master mix and sample inoculation
Aluminium Sealing Film	BioRad	359-0133	To seal sample plate
Droplet Generator	BioRad	186-3002
Droplet Generation Oil	BioRad	186-3005
Cartridge	BioRad	186-4008
DG8 Cartridge Holder	BioRad	186-3051
Gasket	BioRad	186-3009
20uL pipette tips	Rainin	GP-L10F	For tansferring sample/master mix to cartidge
200uL pipette tips	Rainin	GP-L200F	For transferring droplets to final Twin.Tec Plate
Twin.Tec 96-Well Plate	Eppendorf	951020320	For final droplets thermal cycling and reading
Pierceable Heat Seal Foil	BioRad	181-4040	To seal Twin.Tec plate before thermal cycling
PX1 PCR Plate Sealer	BioRad	181-4000	Only the thermal cycler is needed, no optics
CFX96 Thermal cycler	BioRad	CFX96 and C1000
QX100 Droplet Reader	BioRad	186-3001
Droplet Reader Oil	BioRad	186-3004
Droplet PCR Supermix	BioRad	186-3024	i.e. the digital PCR mix in manuscript
QuantaSoft software (v1.3.2)	Quantasoft	QX100	For viewing, analyzing, and exporting ddPCR data
Entero Forward Primer (Ent F1A)	Operon	GAGAAATTCCAAACGAACTTG	Alternative vendor can be used
Entero Reverse Primer (Ent R1)	Operon	CAGTGCTCTACCTCCATCATT	Alternative vendor can be used
Entero Probe (GPL813TQ)	Operon	[6-FAM]-TGG TTC TCT CCG AAA TAG CTT TAG GGC TA-[BHQ1]	Alternative vendor can be used, but the fluorophore has to be FAM
HF183 Forward Primer (HF183-1)	Operon	ATCATGAGTTCACATGTCCG	Alternative vendor can be used
HF183 Reverse Primer (BthetR1)	Operon	CGTAGGAGTTTGGACCGTGT	Alternative vendor can be used
HF183 Probe (BthetP1)	Operon	[6-HEX]-CTGAGAGGAAGGTCCCCC ACATTGGA-[BHQ1]	Alternative vendor can be used, but the fluorophore has to be HEX (if using VIC, then the appropriate matric compensation must be chosen.)
Positive control			Mixture of E.faecalis genomic DNA and HF183 standard plasmid (ordered from IDT). For detailed methods in culturing E. faecalis and sequences of the ordered HF183 plasmid, please see Cao et al. 2015 (doi:10.1016/j.watres.2014.12.008). Commercially available Enterococcus DNA standards (ATCC 29212Q-FZ) can also be used in the positive control in place of lab-prepared E. faecalis genomic DNA.