A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Intrathoracic Viral Nano-Injection to Study Host-Virus Interactions in Adult Flies

1.8K views

⸱

July 8th, 2025

In This Article

Abstract

Source: Yang, S., et al. Establishment of Viral Infection and Analysis of Host-Virus Interaction in Drosophila Melanogaster. J. Vis. Exp. (2019).

In this video, we describe a procedure to perform a nano-injection of a positive-sense, single-stranded RNA virus into adult male Drosophila flies and subsequently study the antiviral responses initiated due to the infection. Polymerase chain reaction analysis identifies the upregulation of specific genes in the infected flies that indicate the activation of immune response pathways including RNA interference and JAK/STAT signaling.

Protocol

1. Viral Infection in Drosophila

  1. Infect flies by nano-injection and perform survival assays.
    1. Pull the capillaries to prepare injection needles, back-fill the injection needle with oil, and assemble the injector.
    2. Anaesthetize flies on the pad under a light flow of CO2. Inoculate flies by intra-thoracic injection of 50.6 nL of virus solution (100 PFU, diluted with Tris-HCl buffer, pH 7.2). Inject at least 3 vials of flies (20 flies per vial).
      NOTE: The injection is time-consuming (generally 100 flies per hour) and Drosophila C virus (DCV) replication is very rapid, so it is very important to write down the exact time on the tube once finishing each vial (20 flies). The buffer-only injection is set as a mock control. Usually, male adult flies are preferred, as results are more stable and reproducible than when using females since hormonal variations during mating and reproduction may influence the readout of females.
    3. Grow the injected flies at 25 °C, 60% humidity under a normal light/dark cycle. Supply flies with fresh food daily, and record the number of dead flies.
    4. Perform at least 3 biological replicates and plot the survival curve.
    5. For the statistical analysis of survival data, generate Kaplan-Meier survival curves by statistical software. Perform a log-rank test to calculate the P values. On the survival table, enter information for each subject. The software then computes the percent survival at each time and plots a Kaplan-Meier survival plot.
      NOTE: Do NOT add additional yeast to the vial. Compared with mock controls, DCV-infected flies occasionally have ascites and are clumsy, which makes them vulnerable to sticky yeast. It is better to record more time points in the preliminary experiment to find out a time frame at which the massive death will happen for infected flies. Generally, the infected flies rarely die within the first two days, even for the Dicer-2 mutant lines. For the Wolbachia-free w1118 (Bloomington 5905) fly infected with 100 PFU of DCV, this time window is around 3-5 days post-infection. Fruit flies that die within 0.5 h post-injection hours should not be counted as a fatality because they may be killed by needle injury not by viral infection.

2. DCV load measure by cytopathic effect (CPE) assay

  1. On day 1, infect male flies as described in steps 1.1.1-1.1.2. Group the injected flies in groups of 20 and keep them growing on fresh fly food for the desired time (typically for 24 h or 3 days). Provide flies with fresh food daily.
  2. On day 2, seed Drosophila S2* cells in a 10 cm cell culture dish to the density of approximately 5 x106 to 1x107 cells/mL.
  3. On day 3, collect 5 flies (under a light flow of CO2) and grind them in a 1.5 mL centrifuge tube for 30 s with 200 μL of Tris buffer and ceramic beads using a homogenizer. Store the samples at -80 °C or immediately proceed to the next step.
  4. Thoroughly vortex the sample. Use a 1 mL syringe and 0.22 μm filter to filter the supernatant to a new 1.5 mL tube.
  5. Perform serial 10-fold dilutions of the supernatant with complete medium for S2* cells. Add 50 μL dilutions into the well. Add 50 μL of culture medium without virus to the well classified as the negative control well.
    NOTE: For each dilution rate, 8 wells were used. As the typical DCV yield is around 108-109 PFU/mL, the dilution should at least cover ~10-5-10-10.
  6. On day 4, observe CPE with a bright-field microscope with a 20X or 40X objective. Classify a well in which the cells look blurry, and the medium is full of fragments as a "positive well", and a well in which the cell morphology is normal as a "negative well".
  7. Mark CPE positive or negative wells with + or –, respectively. Calculate the average virus tissue culture infective dose (TCID50).

3. DCV load measured by qRT-PCR

  1. On day 1, infect flies as described above. Group injected male flies (20 flies/group) and grow them on fresh fly food for the desired time, typically for 24 h or 3 days. Provide flies with fresh food daily.
  2. On day 3, collect 5 flies under a light flow of CO2 in a 1.5 mL tube with 200 μL of lysis buffer and 20 ceramic beads (diameter = 0.5 mm), and grind the samples by homogenizer with high speed for 30 s. Add 800 μL of additional lysis buffer to each tube and store the samples at -80 °C or immediately conduct RNA extraction and qRT-PCR.
  3. Prepare RNase-free tips, tubes, and deionized, diethylpyrocarbonate (DEPC) treated and 0.22 μm membrane-filtered water. Add 200 μL of chloroform (≥99.5%) into the sample and vigorously shake for 15 s by hand. Incubate for 5 min or longer at room temperature until the water phase and the organic phase are clearly separated.
    NOTE: Chloroform is extremely hazardous and must be handled with care. Do NOT vortex the sample, which will increase the risk of DNA contamination.
  4. Centrifuge samples at 13,000 x g for 15 min at 4 °C.
  5. Collect 400 μL of supernatant and transfer the supernatant to new tubes. Mix with the same volume of isopropanol (≥ 99.5%), gently invert the samples 20 times by hand, and then precipitate for 10 min or longer at room temperature.
    NOTE: Precipitation at -20 °C will increase RNA yield.
  6. Centrifuge samples at 13,000 x g for 10 min at 4 °C. White RNA pellets are visible at the bottom of the tube.
  7. Discard the supernatant and add 1 mL of 70% ethanol (ethanol in DEPC water) and invert a few times to wash the RNA.
  8. Centrifuge samples at 13,000 x g for 5 min at 4 °C. Discard the supernatant and dry RNA for 5-10 min; RNA should become transparent.
  9. Add 50 μL of DEPC water to the sample, pipette for few times, and vortex.
  10. Take 3 μL of RNA for titrating the RNA concentration. Quantify the RNA at 260 nm. Normally, the RNA concentration extracted by this protocol is approximately 100-500 μg/μL, which is suitable for cDNA synthesis.
  11. Use 2 μg of RNA for cDNA synthesis. Dilute the sample to 100 μL with ddH2O and store at -20 °C.
  12. Perform qRT-PCR according to the manufacturer's instructions and run qRT-PCR.
    NOTE: For cDNA synthesis of DCV, random primers worked much better than Poly A primers. DCV mRNA expression is normalized to endogenous ribosomal protein 49 (rp49) mRNA. Oligonucleotide primers used in this part:
    rp49 5' AGATCGTGAAGAAGCGCACCAAG 3' (forward) and
    5' CACCAGGAACTTCTTGAATCCGG 3' (reverse);
    DCV, 5' TCATCGGTATGCACATTGCT 3' (forward) and
    5' CGCATAACCATGCTCTTCTG 3' (reverse);
    vago, 5' TGCAACTCTGGGAGGATAGC 3' (forward) and
    5' AATTGCCCTGCGTCAGTTT 3' (reverse);
    virus-induced RNA 1 (vir-1) 5' GATCCCAATTTTCCCATCAA 3' (forward) and
    5' GATTACAGCTGGGTGCACAA 3' (reverse).

Access restricted. Please log in or start a trial to view this content.

Disclosures

No conflicts of interest declared.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
MicroscopeOlympusCKX41
Nanoject II Auto-Nanoliter InjectorDrummond Scientific3-000-204Nanoject II Variable Volume (2.3 to 69 nL) Automatic Injector with Glass Capillaries (110V)
Schneider's Insect MediumSigmaS9895Cell culture
10 cm cell culture dishSigmaCLS430167Cell culture
Drosophila IncubatorPercivalI-41NLRearing Drosophila
0.22um filterMilliporeSLGP033RS
1.5 ml Microcentrifuge tubesBrand352070
1.5 ml RNase-free Microcentrifuge tubesAxygenMCT-150-C
ABI 7500 qPCR systemABI7500qPCR
CentrifugeEppendorf5810R
CentrifugeEppendorf5424R
ChloroformSigma151858RNA extraction
DEPC waterSigma95284-100MLRNA extraction
Isopropyl alcoholSigmaI9516RNA extraction
Lysis buffer (RNA extraction)Thermo Fisher15596026TRIzol Reagent
Lysis buffer (liquid sample RNA extraction)Thermo Fisher10296028TRIzol LS Reagent
Optical Adhesive FilmABI4360954qPCR
Penicillin-Streptomycin, LiquidInvitrogen15140-122Cell culture
qPCR plateABIA32811qPCR
Statistical softwareGraphPad Prism 7
TransScript Fly First-Strand cDNA Synthesis SuperMixTransScriptAT301RNA extraction
VortexIKAVORTEX 3RNA extraction
FBSInvitrogen12657-029Cell culture
Flat bottom 96-well-plateSigma CLS3922 Cell culture
Cell IncubatorSanyoMIR-553
100 Replacement tubesDrummond Scientific3-000-203-G/X

Tags

Viral InfectionDrosophila MelanogasterRNA InterferenceJAK STAT SignalingDicer-2 MutantStereomicroscopeQuantitative RT-PCRCytopathic Effect AssayWolbachia-free Flies