A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses

Summary

HIV-1 pathogenesis is defined by both viral characteristics and host genetic factors. Here we describe a robust method that allows for reproducible measurements to assess the impact of the gag gene sequence variation on the in vitro replication capacity of the virus.

Abstract

The protective effect of many HLA class I alleles on HIV-1 pathogenesis and disease progression is, in part, attributed to their ability to target conserved portions of the HIV-1 genome that escape with difficulty. Sequence changes attributed to cellular immune pressure arise across the genome during infection, and if found within conserved regions of the genome such as Gag, can affect the ability of the virus to replicate in vitro. Transmission of HLA-linked polymorphisms in Gag to HLA-mismatched recipients has been associated with reduced set point viral loads. We hypothesized this may be due to a reduced replication capacity of the virus. Here we present a novel method for assessing the in vitro replication of HIV-1 as influenced by the gag gene isolated from acute time points from subtype C infected Zambians. This method uses restriction enzyme based cloning to insert the gag gene into a common subtype C HIV-1 proviral backbone, MJ4. This makes it more appropriate to the study of subtype C sequences than previous recombination based methods that have assessed the in vitro replication of chronically derived gag-pro sequences. Nevertheless, the protocol could be readily modified for studies of viruses from other subtypes. Moreover, this protocol details a robust and reproducible method for assessing the replication capacity of the Gag-MJ4 chimeric viruses on a CEM-based T cell line. This method was utilized for the study of Gag-MJ4 chimeric viruses derived from 149 subtype C acutely infected Zambians, and has allowed for the identification of residues in Gag that affect replication. More importantly, the implementation of this technique has facilitated a deeper understanding of how viral replication defines parameters of early HIV-1 pathogenesis such as set point viral load and longitudinal CD4+ T cell decline.

Introduction

Determining both the host and viral characteristics that influence HIV-1 pathogenesis and disease progression is paramount for rational vaccine design. The cellular immune response is a key component of the human immune response to HIV-1 infection. Cytotoxic T lymphocytes (CTL) are necessary for the initial control of acute viremia, and allow the host to establish a steady state (set point) viral load^1,2. Experimental depletion of these effector cells results in loss of viral control^3,4. Despite this, escape mutations arise within the viral genome that subvert CTL recognition of virally infected cells^5-9.

Ce....

Protocol

1. Amplification of the HIV-1 gag Gene from Infected, Frozen Plasma

1. Extract viral RNA from 140 µl thawed HIV-1 infected plasma using an extraction kit.
   1. When feasible, immediately proceed to cDNA synthesis after RNA extraction as unfrozen viral RNA yields the best amplification results. If possible, set up PCR master mix for first-round DNA amplification and store at 4 °C prior to viral RNA extraction.
2. Reverse-transcribe cDNA from RNA and amplify first-round DNA products using reverse-transcriptase and a thermostable DNA polymerase in a one-step RT-PCR.
   1. Take RNA out of -80 °C freezer (i....

Results

In order to properly execute this protocol, which creates a proviral plasmid capable of assembling fully functional, infectious Gag-MJ4 chimeras, great care must be taken to generate the appropriate PCR amplicons. Determining whether the PCR has generated the appropriately sized gag amplicon is crucial. Products should be within 100 base pairs (bp) of the approximately 1,700 bp amplicon depicted in Figure 1A. The exact length of this fragment will vary depending on the gag gene under st.......

Discussion

Due to the length and technical nature of this protocol, there are several steps that are critical for both the successful construction of chimeric Gag-MJ4 plasmids as well as for quantification of viral replication capacity. Although the restriction enzyme based cloning strategy for the introduction of foreign gag genes into MJ4 outlined in this protocol has numerous advantages over previously used recombination based methods, the protocol can be technically challenging if critical steps are not followed precis.......

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
PCR Reagents
GOF: 5' ATTTGACTAGCGGAGGCTAGAA 3'	IDT DNA	Custom Oligo	25 nmol, standard desalt
VifOR: 5' TTCTACGGAGACTCCATGACCC 3'	IDT DNA	Custom Oligo	25 nmol, standard desalt
GagInnerF1: 5' AGGCTAGAAGGAGAGAGATG 3'	IDT DNA	Custom Oligo	25 nmol, standard desalt
BclIDegRev2: 5' AGTATTTGATCATAYTGYYTYACTTTR 3'	IDT DNA	Custom Oligo	25 nmol, standard desalt
MJ4For1b: 5' CGAAATCGGCAAAATCCC 3'	IDT DNA	Custom Oligo	25 nmol, standard desalt
MJ4Rev: 5' CCCATCTCTCTCCTTCTAGC 3'	IDT DNA	Custom Oligo	25 nmol, standard desalt
BclIRev: 5' TCTATAAGTATTTGATCATACTGTCTT 3'	IDT DNA	Custom Oligo	25 nmol, standard desalt
GagF2: 5' GGGACATCAAGCAGCCAT 3'	IDT DNA	Custom Oligo	25 nmol, standard desalt
For3: 5' CTAGGAAAAAGGGCTGTTGGAAATG 3'	IDT DNA	Custom Oligo	25 nmol, standard desalt
GagR6: 5' CTGTATCATCTGCTCCTG 3'	IDT DNA	Custom Oligo	25 nmol, standard desalt
Rev3: 5' GACAGGGCTATACATTCTTACTAT 3'	IDT DNA	Custom Oligo	25 nmol, standard desalt
Rev1: 5' AATTTTTCCAGCTCCCTGCTTGCCCA 3'	IDT DNA	Custom Oligo	25 nmol, standard desalt
CoolRack PCR 96 XT	Biocision	BCS-529
CoolRack M15	Biocision	BCS-125
Nuclease free water	Fisher	SH30538FS	Manufactured by Hyclone
QIAamp Viral RNA Mini Kit	Qiagen	52906
Simport PCR 8 Strip Tubes, Blue (Flat Cap)	Daigger	EF3647BX
SuperScript III one-step RT-PCR system	Life Technologies/Invitrogen	12574035
Phusion Hot-start II DNA polymerase	Fisher	F-549L
PCR Nucleotide Mix	Roche	4638956001
Agarose, high gel strength	Fisher	50-213-128
TAE 10X	Life Technologies/Invitrogen	AM9869
Promega 1 kb DNA ladder	Fisher	PRG5711	Manufactured by Promega
Sybr Safe DNA Gel Stain, 10,000x	Life Technologies/Invitrogen	S33102
Wizard SV Gel and PCR Clean-Up System	Promega	A9282
Razor blades, single-edged	Fisher	12-640	Manufactured by Surgical Design
Thermocycler, PTC-200	MJ Research
Microbiology & Cloning Reagents
LB Agar, Miller	Fisher	BP1425-2
LB Broth, Lennox	Fisher	BP1427-2
Sterile 100 x 15 mm polystyrene Petri dishes	Fisher	08-757-12
Ampicillin sodium salt	Sigma-Aldrich	A9518-5G
Falcon 14 ml Polypropylene round-bottom tubes	BD Biosciences	352059
NgoMIV restriction endonuclease	New England BioLabs	R0564L
BclI restriction endonuclease	New England BioLabs	R0160L
HpaI restriction endonuclease	New England BioLabs	R0105L
T4 DNA Ligase, 5 U/μl	Roche	10799009001
JM109 competent cells, >108 cfu/μg	Promega	L2001
PureYield plasmid miniprep system	Promega	A1222
Safe Imager 2.0 Blue Light Transilluminator	Invitrogen	G6600
Microfuge 18 centrifuge	Beckman Coulter	367160
Cell Culture Reagents
Amphyl cleaner/disinfectant	Fisher	22-030-394
Fugene HD, 1 ml	VWR	PAE2311	Manufactured by Promega
Hexadimethrine bromide (Polybrene)	Sigma-Aldrich	H9268-5G
Costar Plates, 6-well, flat	Fisher	07-200-83	Manufactured by Corning Life
Costar Plates, 24-well, flat	Fisher	07-200-84	Manufactured by Corning Life
Costar Plates, 96-well, round	Fisher	07-200-95	Manufactured by Corning Life
Flasks, Corning filter top/canted neck, 75 cm2	Fisher	10-126-37
Flasks, Corning filter top/canted neck, 150 cm2	Fisher	10-126-34	Manufactured by Corning Life
Conical Tubes, 50 ml, blue cap	Fisher	14-432-22	Manufactured by BD Biosciences
Conical Tubes, 15 ml, blue cap	Fisher	14-959-70C	Manufactured by BD Biosciences
Trypsin-EDTA	Fisher	MT25052CI	Manufactured by Mediatech
RPMI, 500 ml	Life Technologies/Invitrogen	11875-119
DMEM, 500 ml	Life Technologies/Invitrogen	11965-118
Penicillin/Streptomycin/Glutamine, 100x	Life Technologies/Invitrogen	10378-016
PBS with magnesium and calcium, 500 ml	Life Technologies/Invitrogen	14040-133
PBS without magnesium and calcium	Life Technologies/Invitrogen	20012-050
Sarstedt tubes, assorted colors	Sarstedt	72.694.996
Reservoir Trays for Multichannel, 55 ml	Fisher	13-681-501
DEAE-Dextran	Fisher	NC9691007
Corning 96 well clear V bottom tissue culture treated microplate	Fisher	07-200-96	Manufactured by Corning Life
HEPES, 1 M Buffer Solution	Life Technologies/Invitrogen	15630-080
FBS, Defined, 500 ml	Fisher	SH30070 03
X-gal	VWR	PAV3941	Manufactured by Promega
Glutaraldehyde, Grade II, 25% in H2O	Sigma-Aldrich	G6257-100ML
1 M Magnesium chloride solution	Sigma-Aldrich	M1028-100ML
Formaldehyde solution, for molecular biology, 36.5%	Sigma-Aldrich	F8775-500ML
Potassium hexacyanoferrate(II) trihydrate	Sigma-Aldrich	P9387-100G
Potassium hexacyanoferrate(III)	Sigma-Aldrich	P8131-100G
Allegra X15-R centrifuge	Beckman Coulter	392932
TC10 automated cell counter	Bio-Rad	1450001
VistaVision inverted microscope	VWR
Reverse-Transcriptase Quantification Assay Reagents
dTTP, [α-33P]- 3000 Ci/mmol, 10 mCi/ml, 1 mCi	Perkin-Elmer	NEG605H001MC
1 M Tris-Cl, pH 8.0	Life Technologies/Invitrogen	15568025	Must be adjusted to pH 7.8 with KOH
2 M Potassium chloride (KCl)	Life Technologies/Invitrogen	AM9640G	Adjust to 1 M solution
0.5 M EDTA	Life Technologies/Invitrogen	15575-020
Nonidet P40	Roche	11333941103
Polyadenylic acid (Poly rA) potassium salt	Midland Reagent Co.	P-3001
Oligo d(T) primer	Life Technologies/Invitrogen	18418-012
Dithiothreitol (DTT)	Sigma-Aldrich	43815-1G
SR, Super Resolution Phosphor Screen, Small	Perkin-Elmer	7001485
Corning Costar Thermowell 96-well plate model (M) Polycarbonate	Fisher	07-200-245	Manufactured by Corning Life
Corning 96-well Microplate Aluminum Sealing Tape, Nonsterile	Fisher	07-200-684	Manufactured by Corning Life
DE-81 anion exchange paper	Whatman	3658-915
Trisodium citrate dihydrate	Sigma-Aldrich	S1804-1KG
Sodium Chloride	Fisher	S671-3
Autoradiography cassette	Fisher	FB-CA-810
Cyclone storage phoshpor screen	Packard