A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses

15.4K views

⸱

DOI:

10.3791/51506

⸱

August 31st, 2014

 ,  , 
1Emory Vaccine Center at Yerkes National Primate Research Center, Emory University, 2Department of Pathology and Laboratory Medicine, Emory University

* These authors contributed equally

In This Article

Summary

HIV-1 pathogenesis is defined by both viral characteristics and host genetic factors. Here we describe a robust method that allows for reproducible measurements to assess the impact of the gag gene sequence variation on the in vitro replication capacity of the virus.

Abstract

The protective effect of many HLA class I alleles on HIV-1 pathogenesis and disease progression is, in part, attributed to their ability to target conserved portions of the HIV-1 genome that escape with difficulty. Sequence changes attributed to cellular immune pressure arise across the genome during infection, and if found within conserved regions of the genome such as Gag, can affect the ability of the virus to replicate in vitro. Transmission of HLA-linked polymorphisms in Gag to HLA-mismatched recipients has been associated with reduced set point viral loads. We hypothesized this may be due to a reduced replication capacity of the virus. Here we present a novel method for assessing the in vitro replication of HIV-1 as influenced by the gag gene isolated from acute time points from subtype C infected Zambians. This method uses restriction enzyme based cloning to insert the gag gene into a common subtype C HIV-1 proviral backbone, MJ4. This makes it more appropriate to the study of subtype C sequences than previous recombination based methods that have assessed the in vitro replication of chronically derived gag-pro sequences. Nevertheless, the protocol could be readily modified for studies of viruses from other subtypes. Moreover, this protocol details a robust and reproducible method for assessing the replication capacity of the Gag-MJ4 chimeric viruses on a CEM-based T cell line. This method was utilized for the study of Gag-MJ4 chimeric viruses derived from 149 subtype C acutely infected Zambians, and has allowed for the identification of residues in Gag that affect replication. More importantly, the implementation of this technique has facilitated a deeper understanding of how viral replication defines parameters of early HIV-1 pathogenesis such as set point viral load and longitudinal CD4+ T cell decline.

Introduction

Determining both the host and viral characteristics that influence HIV-1 pathogenesis and disease progression is paramount for rational vaccine design. The cellular immune response is a key component of the human immune response to HIV-1 infection. Cytotoxic T lymphocytes (CTL) are necessary for the initial control of acute viremia, and allow the host to establish a steady state (set point) viral load1,2. Experimental depletion of these effector cells results in loss of viral control3,4. Despite this, escape mutations arise within the viral genome that subvert CTL recognition of virally infected cells5-9.

Certain HLA alleles have been associated with lower viral loads and slower disease progression including B*57, B*27 and B*8110-15. Part of the protective benefit of HLA class I alleles can be attributed to the fact that they target functionally constrained regions of the genome such as Gag and select for escape mutations that decrease the ability of the virus to replicate in vitro16-21. Although escape from the cellular immune system is beneficial to the virus in the context of the selecting HLA class I allele, the effect of these mutations may have differential consequences for the host upon transmission to an HLA-mismatched individual22,23. Therefore, understanding the effects of transmitted HLA-associated escape mutations on viral replication capacity will be important to further our understanding of early HIV-1 pathogenesis.

While much progress has been made to identify and characterize the fitness defects of individual escape mutations associated with specific HLA class I alleles24-29, naturally occurring HIV-1 isolates have unique and complex footprints of HLA-associated polymorphisms, likely arising from the HLA-mediated immune pressure of different immunogenetic backgrounds30. In a previous analysis, Goepfert et al. showed that an accumulation of HLA-associated mutations in the transmitted Gag sequences derived from 88 acutely infected Zambians was associated with a reduction in set point viral load31. This suggested that the transmission of deleterious escape mutations, specifically in Gag, to HLA-mismatched recipients provides a clinical benefit, and may be due to attenuated viral replication. Moving forward, it is imperative to study how complex combinations of Gag polymorphisms within naturally occurring isolates work in concert to define characteristics of the transmitted virus such as replication capacity, and how early replication might in turn affect HIV-1 clinical parameters and late-stage pathogenesis.

Brockman et al. first demonstrated a link between the replication capacity of gag-pro sequences isolated during chronic stage infection and viral load in both subtype C and B infections32-35. The experimental approach presented in these studies, although appropriate for examining the in vitro replication capacity of sequences derived from chronically infected individuals, has several technical caveats and limitations that make studying HIV-1 replicative capacity in subtype C acutely infected individuals difficult. This method relies on the recombination of population based PCR-amplified sequences into the subtype B NL4-3 provirus, which was derived in part from LAV, a laboratory adapted virus stock36. Virus generation was accomplished by co-transfection of a CEM-based T-cell line37 with PCR amplicons and digested delta-gag-pro NL4-3 DNA. This method requires the outgrowth of virus over a period of weeks to months, potentially skewing the nature of the recovered virus stock in relation to the viral quasispecies in vivo, and therefore altering the measurement of replication capacity in vitro. This method is more appropriate for studying chronically infected individuals, where it effectively selects for virus with the highest replicative capacity, and where cloning numerous different viral variants from a large number of chronically infected individuals is quite labor intensive and therefore not feasible. However, within an acutely infected individual, there are generally one to two variants present, and thus eliminating the risk of skewing the nature of the recovered virus stock, through in vitro selection pressures, allows for a more accurate assessment of in vitro replication capacity. Secondly, this method requires recombining subtype C gag-pro sequences into a subtype B derived backbone, and could introduce backbone incompatibility biases into the analysis. Due to these limitations, large numbers of sequences must be analyzed in order to overcome any potential biases introduced.

Here we describe an alternative experimental approach appropriate for studying sequences derived from subtype C acutely infected individuals. We use a restriction enzyme based cloning strategy to introduce the gag gene derived from acute infection time points of HIV-1 subtype C infected individuals into the subtype C proviral backbone, MJ4. The use of MJ4 as a common backbone in which to clone gag genes is crucial for the analysis of subtype C derived sequences. MJ4 is derived from a primary isolate38, and thus would be less likely to introduce bias due to subtype incompatibility between the backbone and gag gene. In addition, the approach of using enzyme based restriction cloning allows for the proviral constructs to be transfected directly into 293T cells, and for the recovery of a clonal virus stock identical to the cloned gag sequence.

The method presented below is a high throughput method for assessing the replication capacity of subtype C derived Gag-MJ4 chimeric viruses. Transfection into 293T cells is straightforward and recovery of virus takes only three days. In vitro replication capacity is assayed on the same CEM-CCR5 based T-cell line created by Brockman et al.37, but using important protocol modifications necessary for the successful replication of subtype C MJ4 chimeric viruses. The use of an appropriate T-cell line rather than PBMCs allows for large numbers of subtype C MJ4-chimeric viruses to be tested with high assay reproducibility. Finally, using a radiolabeled reverse transcriptase assay for quantification of virus in the supernatant is more cost effective than using commercially available p24 ELISA kits. It also gives a higher dynamic range, which was important for detecting both poorly and highly replicating viruses within the same assay and for detecting subtle differences in replication between isolates.

In conclusion, the method presented here has allowed for the in-depth study of the replication capacity of gag sequences derived from HIV-1 subtype C acutely infected individuals from Zambia, and as written, could also be expanded to study other subtype C infected populations. A high degree of variation in replication capacities between different Gag isolates was observed. In addition, we were able to show a statistical association between the replication capacity of the transmitted Gag and set point viral load as well as with CD4+ decline over a three-year period39. Such results highlight the importance of studying how transmitted viral characteristics, such as replication capacity, interact with the host immune system to influence pathogenesis during early infection and will be integral for developing effective vaccine interventions as well as treatment.

Access restricted. Please log in or start a trial to view this content.

Protocol

1. Amplification of the HIV-1 gag Gene from Infected, Frozen Plasma

  1. Extract viral RNA from 140 µl thawed HIV-1 infected plasma using an extraction kit.
    1. When feasible, immediately proceed to cDNA synthesis after RNA extraction as unfrozen viral RNA yields the best amplification results. If possible, set up PCR master mix for first-round DNA amplification and store at 4 °C prior to viral RNA extraction.
  2. Reverse-transcribe cDNA from RNA and amplify first-round DNA products using reverse-transcriptase and a thermostable DNA polymerase in a one-step RT-PCR.
    1. Take RNA out of -80 °C freezer (if freezing was necessary) and briefly thaw at room temperature then place in cold block. Transfer 5 µl of RNA to each PCR tube containing 45 µl of master mix to give a final volume of 50 µl. Immediately place remaining RNA samples into -80 °C freezer.
    2. After enzyme is added to the first-round PCR master mix (Table 1A), aliquot 45 µl into each thin-walled PCR amplification tube for the number of reactions desired. Make sure to use PCR tubes with individual caps and not strip caps to ensure minimal cross-contamination between samples. Place PCR tubes in a cold block to protect the temperature sensitive RT enzyme and RNA template. Note: Samples should be run in triplicate in order to adequately sample the viral quasispecies. It is also important to utilize a product with a high fidelity DNA polymerase enzyme in order to minimize PCR-introduced misincorporation. Please refer to the reagents list for the recommended product.
    3. After RNA template has been added to all reaction tubes, transfer PCR tubes to a thermocycler for amplification using the cycler program described in Table 1B. Note: The product of this amplification will be used in a second-round nested PCR.
  3. Perform a nested second-round PCR amplification, using 1 µl of the first round PCR amplification (1.2) as the DNA template.
    1. Aliquot 49 µl of second-round PCR master mix (Table 2A) to each thin-walled PCR tube for the number of reactions desired. Transfer 1 µl from the first-round PCR amplification to each reaction tube to give a final volume of 50 µl. Note: This will serve as template DNA for the second-round amplification. It is also important to utilize a DNA polymerase with very high fidelity and proofreading capabilities in order to minimize PCR-introduced misincorporation. Please refer to the reagents list for the recommended product.
    2. Transfer second-round PCR reaction mix to thermocycler and run program described in Table 2B. Note: After completion of the program, the products of this reaction will be run on an agarose gel to confirm the production of product.
  4. Add 3 µl of 5x loading dye to 5 µl of the 50 µl second-round reaction volume and run at 120 V on a 1% agarose-TAE gel containing a UV-fluorescent DNA stain until bands are resolved. Visualize 1.6 kb bands on a blue light illuminator (see Figure 1A).
  5. Run the remaining 45 µl reaction volume on a 1% agarose-TAE gel containing a DNA stain, and excise the appropriate bands with a clean razor blade.
    1. Extract DNA from the gel slice using a gel purification kit, elute in nuclease-free water, combine three positive reactions per individual, and freeze product at -20 °C for subsequent use.

2. Preparing gag Amplicons for Cloning by Introduction of the Necessary Restriction Sites

  1. Amplify the Long Terminal Repeat (LTR)/5’ UTR portion of the MJ4 plasmid (see Table 3).
  2. Visualize 1.3 kb PCR products on illuminator, excise positive amplicons, gel purify and freeze as previously described (1.4,1.5; see Figure 1B).
  3. Create fused MJ4 LTR-gag amplicons via "splice-overlap-extension" PCR (see Table 4).
  4. Visualize, excise, purify, and freeze the 3.2 kb amplicons as in 1.4,1.5 (see Figure 1C).

3. Cloning Amplified gag Genes into the MJ4, Subtype C, Infectious Molecular Clone

  1. Digest 1.5 µg of MJ4 plasmid and 1.5 µg of purified LTR-gag PCR product with the BclI (methylation sensitive) restriction endonuclease for 1.5 hr at 50 °C (see Table 5A).
  2. Add 1 µl of NgoMIV to the digestion reaction and incubate at 37 °C for 1 hr.
  3. Add 5x loading dye to restriction digest reactions and slowly electrophorese the total volume on a 1% agarose-TAE gel containing a DNA gel stain for 1-2 hr at 100 V. Visualize, excise, and purify indicated bands for cloning as previously described (see Figure 2).
  4. Prepare ligation reactions using purified LTR-gag insert and MJ4 vector DNA at a 3:1 insert to vector ratio. Incubate ligation reactions overnight at 4 °C (see Table 5B).
  5. Transform JM109 chemically competent bacteria with ligation products and spread on LB agar plates with 100 µg/ml ampicillin and grow at 30 °C for 22+ hr.
    1. Thaw JM109 competent cells on ice for 15 min. Label 1.5 ml microcentrifuge tubes and chill on ice.
    2. Aliquot 50-100 µl of JM109 cells to pre-chilled 1.5 ml microcentrifuge tubes. Add 2.5-5 µl of ligation reaction to JM109 cells, flicking tube lightly to mix and immediately returning to ice. Incubate competent cells with ligation product on ice for 30 min.
    3. Heat shock 1.5 ml microcentrifuge tubes containing JM109 competent cells and ligation reaction in a 42 °C heat block for 45 sec and return to ice for at least 3 min.
    4. Add 50 µl of SOC media to each microcentrifuge tube and plate the entire transformation reaction onto room temperature LB-agar plates supplemented with 100 µg/ml of ampicillin.
    5. Transfer plates to a 30 °C incubator and leave for 20 hr, or until colonies are clearly formed.
  6. Pick isolated colonies and grow in 4 ml of LB with 100 µg/ml ampicillin at 30 °C for 22+ hr.
  7. Spin down cultures at 3,200 x g for 15 min, pour off broth, and extract plasmid DNA.
  8. To confirm cloning fidelity, cut miniprep DNA with NgoMIV and HpaI restriction enzymes in a double digest at 37 °C for 2 hr. Analyze on 1% agarose-TAE gel (see Table 5C).
  9. Sequence the LTR-gag insert region of each plasmid using the following primers: GagInnerF1, GagF2, Rev1, Rev3, and GagR6 (Table 6) to confirm sequence identity.
  10. Compare the cloned sequences obtained with the population sequences derived from the initial purified amplicon from 1.5.1. Note: It is important to ultimately assess the replication capacity of two independent clones in order to ensure that any in vitro replication phenotypes are not due to backbone errors introduced during the cloning process.

4. Generation and Titering of Replication Competent Gag-MJ4 Chimeric Viruses

  1. Generate replication competent virus by transfecting 1.5 µg of the chimeric MJ4 plasmid miniprep DNA into 293T cells using a 4:1 ratio of Fugene HD as described by Prince et al39.
  2. Titer harvested virus stocks on TZM-bl cells as described below and in Prince et al39.
    1. Plate TZM-bl cells 24 hr before infection with virus in order to have a 30-40% confluent cell monolayer on the following day. This can usually be achieved by adding 5 x 104 cells in a total volume of 800 µl per well in a 24-well plate.
    2. After adding cells to the well, gently move the 24-well plate forward and back, then side to side in order to efficiently distribute cells. Never swirl – this will result in cells accumulating in the center of the plate.
    3. The following day, prepare 1% FBS in DMEM; this will be used to dilute DEAE-Dextran and to dilute virus stocks. Stock DEAE-Dextran is 10 mg/ml or 125x, and a final concentration of 80 µg/ml or 1x is desired.
    4. Take out virus stock to be tested from -80 °C freezer and place on shaker to thaw at room temperature.
    5. Using a multichannel pipette, serially dilute virus stocks in a round-bottomed tissue culture treated 96-well plate with lid. This is a 3-fold dilution protocol. See Table 7 for the dilution scheme.
    6. Remove media from seeded TZM-bl 24-well plates using a vacuum aspirator making sure not to disturb cell monolayer. Only remove the media from one 24-well plate at a time so that cells do not dry out.
    7. Add 150 µl of the 1x DEAE-Dextran + 1% FBS in DMEM mixture to each well using a 1,000 µl pipette. Do not use repeat pipette as this disrupts the monolayer.
    8. Add 150 µl of each virus dilution to the appropriate well. Add virus to the center of the well and swirl gently to evenly distribute virus across the cell monolayer. Incubate infected cells for 2 hr in a tissue culture incubator at 37 °C and 5% CO2.
    9. After the 2 hr incubation, add 0.5 ml 10% FBS in DMEM to each well and return plates to incubator for an additional 48 hr.
    10. After 48 hr, cells should be 100% confluent. Because MJ4 is a replication competent virus, there will be some cell death, but this is to be expected.
    11. Remove media from each well and add 400 µl/well of fixing solution (see Table 8A for recipe). Fix only one plate at a time. Add fixing solution using a 1,000 µl pipette, and let sit for 5 min at room temperature.
    12. Remove fixing solution and wash 3x with PBS with Ca2+/Mg2+. Use a squirt bottle to gently add PBS to the side of the well to avoid disrupting the monolayer. After the third wash, blot plate dry on absorbent paper.
    13. Add 400 µl/well of staining solution (see Table 8B for recipe) to each well of the 24-well plate, and incubate at 37 °C for at least 2 hr. Longer incubation times are acceptable, but incubation times should be kept consistent between titering experiments.
    14. Wash 2x with PBS with Ca2+/Mg2+ and score for infection, or add PBS and store at 4 °C for scoring later. Plates can be kept at 4 °C for up to four days, as long as the monolayer is kept hydrated.
    15. To score for infection, use a permanent marker to divide wells of the 24-well plate into quadrants. Count all blue cells within a field of view, using a total magnification of 200X, once in each of the four quadrants of a well.
    16. Compute Infectious Units per µl as follows: [(# blue cells/4) x 67] / (µl virus added) = IU/µl. Refer to Table 8C for volume in µl of virus added to each well. Average several wells together; the numbers should be relatively similar for an accurate titration.

5. Preparation of Culture Media and Propagation of GXR25 Cells for in vitro Replication Assay

  1. Prepare complete RPMI (cRPMI) for propagation of GXR25 cells. NOTE: It is extremely important to culture GXR25 cells at least 4 months prior to planned replication experiments (see Table 9).
  2. Split cells 1:10 twice per week and maintain cell density between 1 x 105 to 2 x 106 cells/ml.

6. In vitro Replication of Gag-MJ4 Chimeras in GXR25 (CEM-CCR5-GFP) Cells

  1. The day before the infection, split cells to a concentration between 2-3 x 105 cells/ml so that they are in logarithmic growth on the day of the infection.
  2. On the day of infection, remove virus stocks from -80 °C freezer and thaw. Calculate the volume of virus needed from each stock based on the IU/µl titer from TZM-bl cell assay in order to infect 5 x 105 GXR25 cells at a multiplicity of infection of 0.05, using the formula:
    Volume of virus for infection (µl) = 1 µl/X IU x 0.05 x 500,000
    NOTE: We have chosen an MOI of 0.05 as this results in a logarithmic growth phase for all of the viruses that we have tested. It is important to conduct initial experiments in order to determine the optimal MOI to capture logarithmic growth for the virus to be tested.
  3. Dilute virus in cRPMI to a volume of 100 µl (in order to achieve a 0.05 MOI) and add into a well of a V-Bottom tissue culture treated 96-well plate. Note: Include both a positive (MJ4 WT infected) and a negative (mock infected cells) control in each set of replication experiments. Set up the plate such that every other column is blank to limit cross-contamination between wells. The positive control is imperative, as it will be used later as a standard to normalize the replication slopes, which are a measure of the replication rate of experimental replicates.
  4. Count GXR25 cells using an automated cell counter. Calculate the number of cells needed in total for all infections (5 x 105 x # infections). Aliquot the required volume into a 50 ml conical tube and centrifuge to pellet cells. Always calculate for 25% more infections than needed.
  5. Aspirate media carefully and resuspend in cRPMI at a concentration of 5 x 105 cells/100 µl.
  6. Pipette cells into a sterile trough and mix thoroughly. Using a multi-channel pipette, add 100 µl of cells into each well of the 96-well plate containing the diluted virus. Mix thoroughly.
  7. Add 2 µl of 5 mg/ml (100x) solution of polybrene to each well and mix cells thoroughly.
  8. Incubate at 37 °C in tissue culture incubator with 5% CO2 for 3 hr.
  9. In order to wash infected cells, centrifuge 96-well V-bottom plate to pellet cells. Then carefully remove 150 µl of the medium and replace with fresh 150 µl of cRPMI without disturbing the cell pellet. Repeat 2 more times (including centrifugation) to sufficiently wash cells.
  10. After the last centrifugation and addition of 150 µl cRPMI, resuspend the cell pellet with a multichannel pipette and add the entire cell/virus mixture (approximately 200 µl) from each well independently to 800 µl of cRPMI in a well of a 24-well tissue culture plate.
  11. Place plate in 5% CO2 tissue culture incubator at 37 °C.
  12. Every two days, remove 100 µl of supernatant from surface of culture well and transfer to a 96-well U-bottom plate and store frozen at -80 °C until running virus quantitation assay. NOTE: Careful arrangement of supernatants in 96-well plates will allow for multi-channel pipette transfer of culture supernatants during virion quantification via a radiolabeled reverse transcriptase (RT) assay. Every plate should contain samples from an infection standard in order to normalize inter-plate variation in the RT assay readout.
  13. After removing each 100 µl sample, split cells 1:2 by thoroughly resuspending cells and removing half of the remaining volume (450 µl). Restore original volume (1 ml) by adding 550 µl of fresh cRPMI to each well.

7. Analysis of Reverse Transcriptase (RT) in Cell Culture Supernatants

Protocol adapted from Ostrowski et al40.

  1. Set up biological safety hood in a BSL-3 facility for use with radioactive materials.
    1. Place absorbent paper in hood and replace aspirator for aspirator designated for radioactive use. Note: All radioactive waste must be properly disposed of with accordance to safety regulations.
  2. Add 1-2 µl of 10 mCi/ml of [α-33P] dTTP and 4 µl of 1 M dithiothreitol (DTT) to each 1 ml aliquot of RT master mix (see Table 10 and Ostrowski et al.40).
  3. Carefully mix each 1.5 ml microcentrifuge tube of RT master mix, DTT, and [α-33P] dTTP with a 1,000 µl pipette and transfer to a sterile trough.
  4. Dispense 25 µl of labeled RT mix into each well of 96-well thin-walled PCR plate. Note: Include space for a positive control (MJ4 WT infection) and negative control (Mock infection).
  5. Add 5 µl of each supernatant to the PCR plate containing the RT master mix.
  6. Seal PCR plate with adhesive foil cover and incubate for 2 hr at 37 °C in a thermocycler. For safety reasons, rinse pipette tips with Amphyl and dispose of tips in small container containing Amphyl waste, which will later be disposed of in radioactive waste.
  7. After incubation, make small holes in the foil cover using a 200 µl multi-channel pipette. Note: If pipette tips touch liquid in well, replace tips before moving to the next column or row.
  8. Mix samples 5x and transfer 5 µl of each sample to the DE-81 paper. Air dry 10 min.
  9. Wash blots 5x with 1x SSC (sodium chloride, sodium citrate), and then 2x with 90% ethanol at 5 min per wash. Allow to air dry.
    1. Place each blot in a separate washing container, such as a sandwich storage box, add enough wash buffer (1x SSC or 90% EtOH) to cover blot, and shake for 5 min.
    2. Pour off wash buffer into separate container and repeat. Note: The first 3 washes are considered radioactive and should be disposed of properly. The last 2 washes can be disposed of regularly.
  10. Once dry, carefully wrap blot in Saran wrap and expose to a phosphoscreen in a tightly sealed cassette overnight at room temperature.
  11. Analyze phosphoscreens with a phosphorimager and quantify radioactive transcripts.
  12. Draw a circle around each radioactive signal using OptiQuant software. Graph the Digital Light Unit (DLU) values to generate replication curves.
  13. In order to generate replication capacity scores, DLU values were log10-transformed and slopes were calculated using the day 2, 4, and 6 time points. Replication slopes are then divided by the slope of WT MJ4 in order generate replication capacity scores. It is important to normalize based on the MJ4 WT values obtained from the same RT plate to reduce intra-assay variability.

Access restricted. Please log in or start a trial to view this content.

Results

In order to properly execute this protocol, which creates a proviral plasmid capable of assembling fully functional, infectious Gag-MJ4 chimeras, great care must be taken to generate the appropriate PCR amplicons. Determining whether the PCR has generated the appropriately sized gag amplicon is crucial. Products should be within 100 base pairs (bp) of the approximately 1,700 bp amplicon depicted in Figure 1A. The exact length of this fragment will vary depending on the gag gene under st...

Access restricted. Please log in or start a trial to view this content.

Discussion

Due to the length and technical nature of this protocol, there are several steps that are critical for both the successful construction of chimeric Gag-MJ4 plasmids as well as for quantification of viral replication capacity. Although the restriction enzyme based cloning strategy for the introduction of foreign gag genes into MJ4 outlined in this protocol has numerous advantages over previously used recombination based methods, the protocol can be technically challenging if critical steps are not followed precis...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors have nothing to disclose.

Acknowledgements

The investigators thank all the volunteers in Zambia who participated in this study and all the staff at the Zambia Emory HIV Research Project in Lusaka who made this study possible. The investigators would like to thank Jon Allen, Smita Chavan, and Mackenzie Hurlston for technical assistance and sample management. We would also like to thank Dr. Mark Brockman for his discussions and generous donation of the GXR25 cells.

This study was funded by R01 AI64060 and R37 AI51231 (EH) and the International AIDS Vaccine Initiative. This work was made possible in part by the generous support of the American people through the United States Agency for International Development (USAID). The contents are the responsibility of the study authors and do not necessarily reflect the views of USAID or the United States Government. This work also was supported, in part, by the Virology Core at the Emory Center for AIDS Research (Grant P30 AI050409). DC and JP were supported in part by Action Cycling Fellowships. This work was supported in part by the Yerkes National Primate Research Center base grant (2P51RR000165-51). This project was also funded in part by the National Center for Research Resources P51RR165 and is currently supported by the Office of Research Infrastructure Programs/OD P51OD11132.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
PCR Reagents
GOF: 5' ATTTGACTAGCGGAGGCTAGAA 3'IDT DNACustom Oligo25 nmol, standard desalt
VifOR: 5' TTCTACGGAGACTCCATGACCC 3'IDT DNACustom Oligo25 nmol, standard desalt
GagInnerF1: 5' AGGCTAGAAGGAGAGAGATG 3'IDT DNACustom Oligo25 nmol, standard desalt
BclIDegRev2: 5' AGTATTTGATCATAYTGYYTYACTTTR 3'IDT DNACustom Oligo25 nmol, standard desalt
MJ4For1b: 5' CGAAATCGGCAAAATCCC 3'IDT DNACustom Oligo25 nmol, standard desalt
MJ4Rev: 5' CCCATCTCTCTCCTTCTAGC 3'IDT DNACustom Oligo25 nmol, standard desalt
BclIRev: 5' TCTATAAGTATTTGATCATACTGTCTT 3'IDT DNACustom Oligo25 nmol, standard desalt
GagF2: 5' GGGACATCAAGCAGCCAT 3'IDT DNACustom Oligo25 nmol, standard desalt
For3: 5' CTAGGAAAAAGGGCTGTTGGAAATG 3'IDT DNACustom Oligo25 nmol, standard desalt
GagR6: 5' CTGTATCATCTGCTCCTG 3'IDT DNACustom Oligo25 nmol, standard desalt
Rev3: 5' GACAGGGCTATACATTCTTACTAT 3'IDT DNACustom Oligo25 nmol, standard desalt
Rev1: 5' AATTTTTCCAGCTCCCTGCTTGCCCA 3'IDT DNACustom Oligo25 nmol, standard desalt
CoolRack PCR 96 XTBiocisionBCS-529
CoolRack M15BiocisionBCS-125
Nuclease free waterFisherSH30538FSManufactured by Hyclone
QIAamp Viral RNA Mini KitQiagen52906
Simport PCR 8 Strip Tubes, Blue (Flat Cap)DaiggerEF3647BX
SuperScript III one-step RT-PCR systemLife Technologies/Invitrogen12574035
Phusion Hot-start II DNA polymeraseFisherF-549L
PCR Nucleotide MixRoche4638956001
Agarose, high gel strengthFisher50-213-128
TAE 10XLife Technologies/InvitrogenAM9869
Promega 1 kb DNA ladderFisherPRG5711Manufactured by Promega
Sybr Safe DNA Gel Stain, 10,000xLife Technologies/InvitrogenS33102
Wizard SV Gel and PCR Clean-Up SystemPromegaA9282
Razor blades, single-edgedFisher12-640Manufactured by Surgical Design
Thermocycler, PTC-200MJ Research
Microbiology & Cloning Reagents
LB Agar, MillerFisherBP1425-2
LB Broth, LennoxFisherBP1427-2
Sterile 100 x 15 mm polystyrene Petri dishesFisher08-757-12
Ampicillin sodium saltSigma-AldrichA9518-5G
Falcon 14 ml Polypropylene round-bottom tubesBD Biosciences352059
NgoMIV restriction endonucleaseNew England BioLabsR0564L
BclI restriction endonucleaseNew England BioLabsR0160L
HpaI restriction endonucleaseNew England BioLabsR0105L
T4 DNA Ligase, 5 U/μlRoche10799009001
JM109 competent cells, >108 cfu/μgPromegaL2001
PureYield plasmid miniprep systemPromegaA1222
Safe Imager 2.0 Blue Light TransilluminatorInvitrogenG6600
Microfuge 18 centrifugeBeckman Coulter367160
Cell Culture Reagents
Amphyl cleaner/disinfectantFisher22-030-394
Fugene HD, 1 mlVWRPAE2311Manufactured by Promega
Hexadimethrine bromide (Polybrene)Sigma-AldrichH9268-5G
Costar Plates, 6-well, flatFisher07-200-83Manufactured by Corning Life
Costar Plates, 24-well, flatFisher07-200-84Manufactured by Corning Life
Costar Plates, 96-well, roundFisher07-200-95Manufactured by Corning Life
Flasks, Corning filter top/canted neck, 75 cm2Fisher10-126-37
Flasks, Corning filter top/canted neck, 150 cm2Fisher10-126-34Manufactured by Corning Life
Conical Tubes, 50 ml, blue capFisher14-432-22Manufactured by BD Biosciences
Conical Tubes, 15 ml, blue capFisher14-959-70CManufactured by BD Biosciences
Trypsin-EDTAFisherMT25052CIManufactured by Mediatech
RPMI, 500 mlLife Technologies/Invitrogen11875-119
DMEM, 500 mlLife Technologies/Invitrogen11965-118
Penicillin/Streptomycin/Glutamine, 100xLife Technologies/Invitrogen10378-016
PBS with magnesium and calcium, 500 mlLife Technologies/Invitrogen14040-133
PBS without magnesium and calciumLife Technologies/Invitrogen20012-050
Sarstedt tubes, assorted colorsSarstedt72.694.996
Reservoir Trays for Multichannel, 55 mlFisher13-681-501
DEAE-DextranFisherNC9691007
Corning 96 well clear V bottom tissue culture treated microplateFisher07-200-96Manufactured by Corning Life
HEPES, 1 M Buffer SolutionLife Technologies/Invitrogen15630-080
FBS, Defined, 500 mlFisherSH30070 03
X-galVWRPAV3941Manufactured by Promega
Glutaraldehyde, Grade II, 25% in H2OSigma-AldrichG6257-100ML
1 M Magnesium chloride solutionSigma-AldrichM1028-100ML
Formaldehyde solution, for molecular biology, 36.5%Sigma-AldrichF8775-500ML
Potassium hexacyanoferrate(II) trihydrateSigma-AldrichP9387-100G
Potassium hexacyanoferrate(III)Sigma-AldrichP8131-100G
Allegra X15-R centrifugeBeckman Coulter392932
TC10 automated cell counterBio-Rad1450001
VistaVision inverted microscopeVWR
Reverse-Transcriptase Quantification Assay Reagents
dTTP, [α-33P]- 3000 Ci/mmol, 10 mCi/ml, 1 mCiPerkin-ElmerNEG605H001MC
1 M Tris-Cl, pH 8.0Life Technologies/Invitrogen15568025Must be adjusted to pH 7.8 with KOH
2 M Potassium chloride (KCl)Life Technologies/InvitrogenAM9640GAdjust to 1 M solution
0.5 M EDTALife Technologies/Invitrogen15575-020
Nonidet P40Roche11333941103
Polyadenylic acid (Poly rA) potassium salt Midland Reagent Co.P-3001
Oligo d(T) primerLife Technologies/Invitrogen18418-012
Dithiothreitol (DTT)Sigma-Aldrich43815-1G
SR, Super Resolution Phosphor Screen, SmallPerkin-Elmer7001485
Corning Costar Thermowell 96-well plate model (M) PolycarbonateFisher07-200-245Manufactured by Corning Life
Corning 96-well Microplate Aluminum Sealing Tape, NonsterileFisher07-200-684Manufactured by Corning Life
DE-81 anion exchange paperWhatman3658-915
Trisodium citrate dihydrateSigma-AldrichS1804-1KG
Sodium ChlorideFisherS671-3
Autoradiography cassetteFisherFB-CA-810
Cyclone storage phoshpor screenPackard

References

  1. Borrow, P., Lewicki, H., Hahn, B. H., Shaw, G. M., Oldstone, M. B. Virus-specific CD8+ cytotoxic T-lymphocyte activity associated with control of viremia in primary human immunodeficiency virus type 1 infection. Journal of virology. 68, 6103-6110 (1994).
  2. Koup, R. A., et al. Temporal association of cellular immune responses with the initial control of viremia in primary human immunodeficiency virus type 1 syndrome. Journal of virology. 68, 4650-4655 (1994).
  3. Jin, X., et al. Dramatic rise in plasma viremia after CD8(+) T cell depletion in simian immunodeficiency virus-infected macaques. The Journal of experimental medicine. 189, 991-998 (1999).
  4. Schmitz, J. E., et al. Control of viremia in simian immunodeficiency virus infection by CD8+ lymphocytes. Science. 283, 857-860 (1999).
  5. Brumme, Z. L., et al. Marked epitope- and allele-specific differences in rates of mutation in human immunodeficiency type 1 (HIV-1) Gag, Pol, and Nef cytotoxic T-lymphocyte epitopes in acute/early HIV-1 infection. Journal of virology. 82, 9216-9227 (2008).
  6. Leslie, A. J., et al. HIV evolution: CTL escape mutation and reversion after transmission. Nature medicine. 10, 282-289 (2004).
  7. Phillips, R. E., et al. Human immunodeficiency virus genetic variation that can escape cytotoxic T cell recognition. Nature. 354, 453-459 (1991).
  8. Price, D. A., et al. Positive selection of HIV-1 cytotoxic T lymphocyte escape variants during primary infection. Proceedings of the National Academy of Sciences of the United States of America. 94, 1890-1895 (1997).
  9. Goulder, P. J., et al. Late escape from an immunodominant cytotoxic T-lymphocyte response associated with progression to AIDS. Nature. 3, 212-217 (1997).
  10. Tang, J., et al. Favorable and unfavorable HLA class I alleles and haplotypes in Zambians predominantly infected with clade C human immunodeficiency virus type 1. Journal of virology. 76, 8276-8284 (2002).
  11. Prentice, H. A., et al. HLA-B*57 versus HLA-B*81 in HIV-1 infection: slow and steady wins the race. Journal of virology. 87, 4043-4051 (2013).
  12. Migueles, S. A., et al. HLA B*5701 is highly associated with restriction of virus replication in a subgroup of HIV-infected long term nonprogressors. Proceedings of the National Academy of Sciences of the United States of America. 97, 2709-2714 (2000).
  13. Leslie, A., et al. Additive contribution of HLA class I alleles in the immune control of HIV-1 infection. Journal of virology. 84, 9879-9888 (2010).
  14. Kaslow, R. A., et al. Influence of combinations of human major histocompatibility complex genes on the course of HIV-1 infection. Nature medicine. 2, 405-411 (1996).
  15. Altfeld, M., et al. Influence of HLA-B57 on clinical presentation and viral control during acute HIV-1 infection. AIDS. 17, 2581-2591 (2003).
  16. Kiepiela, P., et al. CD8+ T-cell responses to different HIV proteins have discordant associations with viral load. Nature medicine. 13, 46-53 (2007).
  17. Mothe, B., et al. Definition of the viral targets of protective HIV-1-specific T cell responses. Journal of translational medicine. 9, 208(2011).
  18. Peyerl, F. W., Barouch, D. H., Letvin, N. L. Structural constraints on viral escape from HIV- and SIV-specific cytotoxic T-lymphocytes. Viral immunology. 17, 144-151 (2004).
  19. Rolland, M., et al. Broad and Gag-biased HIV-1 epitope repertoires are associated with lower viral loads. PloS one. 3, e1424(2008).
  20. Wagner, R., et al. Molecular and functional analysis of a conserved CTL epitope in HIV-1 p24 recognized from a long-term nonprogressor: constraints on immune escape associated with targeting a sequence essential for viral replication. J Immunol. 162, 3727-3734 (1999).
  21. Wang, Y. E., et al. Protective HLA class I alleles that restrict acute-phase CD8+ T-cell responses are associated with viral escape mutations located in highly conserved regions of human immunodeficiency virus type 1. Journal of virology. 83, 1845-1855 (2009).
  22. Chopera, D. R., et al. Transmission of HIV-1 CTL escape variants provides HLA-mismatched recipients with a survival advantage. PLoS pathogens. 4, e1000033(2008).
  23. Crawford, H., et al. Evolution of HLA-B*5703 HIV-1 escape mutations in HLA-B*5703-positive individuals and their transmission recipients. The Journal of experimental medicine. 206, 909-921 (2009).
  24. Boutwell, C. L., et al. Frequent and variable cytotoxic-T-lymphocyte escape-associated fitness costs in the human immunodeficiency virus type 1 subtype B Gag proteins. Journal of virology. 87, 3952-3965 (2013).
  25. Brockman, M. A., et al. Escape and compensation from early HLA-B57-mediated cytotoxic T-lymphocyte pressure on human immunodeficiency virus type 1 Gag alter capsid interactions with cyclophilin A. Journal of virology. 81, 12608-12618 (2007).
  26. Crawford, H., et al. Compensatory mutation partially restores fitness and delays reversion of escape mutation within the immunodominant HLA-B*5703-restricted Gag epitope in chronic human immunodeficiency virus type 1 infection. Journal of virology. 81, 8346-8351 (2007).
  27. Martinez-Picado, J., et al. Fitness cost of escape mutations in p24 Gag in association with control of human immunodeficiency virus type 1. Journal of virology. 80, 3617-3623 (2006).
  28. Schneidewind, A., et al. Escape from the dominant HLA-B27-restricted cytotoxic T-lymphocyte response in Gag is associated with a dramatic reduction in human immunodeficiency virus type 1 replication. Journal of virology. 81, 12382-12393 (2007).
  29. Wright, J. K., et al. Impact of HLA-B*81-associated mutations in HIV-1 Gag on viral replication capacity. Journal of virology. 86, 3193-3199 (2012).
  30. Kawashima, Y., et al. Adaptation of HIV-1 to human leukocyte antigen class I. Nature. 458, 641-645 (2009).
  31. Goepfert, P. A., et al. Transmission of HIV-1 Gag immune escape mutations is associated with reduced viral load in linked recipients. The Journal of experimental medicine. 205, 1009-1017 (2008).
  32. Brockman, M. A., et al. Early selection in Gag by protective HLA alleles contributes to reduced HIV-1 replication capacity that may be largely compensated for in chronic infection. Journal of virology. 84, 11937-11949 (2010).
  33. Huang, K. H., et al. Progression to AIDS in South Africa is associated with both reverting and compensatory viral mutations. PloS one. 6, e19018(2011).
  34. Wright, J. K., et al. Gag-protease-mediated replication capacity in HIV-1 subtype C chronic infection: associations with HLA type and clinical parameters. Journal of virology. 84, 10820-10831 (2010).
  35. Wright, J. K., et al. Influence of Gag-protease-mediated replication capacity on disease progression in individuals recently infected with HIV-1 subtype. C. Journal of virology. 85, 3996-4006 (2011).
  36. Adachi, A., et al. Production of acquired immunodeficiency syndrome-associated retrovirus in human and nonhuman cells transfected with an infectious molecular clone. Journal of virology. 59, 284-291 (1986).
  37. Brockman, M. A., Tanzi, G. O., Walker, B. D., Allen, T. M. Use of a novel GFP reporter cell line to examine replication capacity of CXCR4- and CCR5-tropic HIV-1 by flow cytometry. Journal of virology. 131, 134-142 (2006).
  38. Ndung'u, T., Renjifo, B., Essex, M. Construction and analysis of an infectious human Immunodeficiency virus type 1 subtype C molecular clone. Journal of virology. 75, 4964-4972 (2001).
  39. Prince, J. L., et al. Role of transmitted Gag CTL polymorphisms in defining replicative capacity and early HIV-1 pathogenesis. PLoS pathogens. 8, e1003041(2012).
  40. Ostrowski, M. A., Chun, T. W., Cheseboro, B., Stanley, S. K., Tremblay, M., et al. Detection assays for HIV proteins. Current protocols in immunology / edited by John E. Coligan ... [et al.]. 12 (Unit 12 15), Forthcoming.
  41. Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K., Pease, L. R. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene. 77, 61-68 (1989).
  42. Inoue, H., Nojima, H., Okayama, H. High efficiency transformation of Escherichia coli with plasmids. Gene. 96, 23-28 (1990).
  43. Bichara, M., Pinet, I., Schumacher, S., Fuchs, R. P. Mechanisms of dinucleotide repeat instability in Escherichia coli. Genetics. 154, 533-542 (2000).
  44. Ackerson, B., Rey, O., Canon, J., Krogstad, P. Cells with high cyclophilin A content support replication of human immunodeficiency virus type 1 Gag mutants with decreased ability to incorporate cyclophilin A. Journal of virology. 72, 303-308 (1998).
  45. Dudley, D. M., et al. A novel yeast-based recombination method to clone and propagate diverse HIV-1 isolates. BioTechniques. 46, 458-467 (2009).
  46. Ganser-Pornillos, B. K., von Schwedler, U. K., Stray, K. M., Aiken, C., Sundquist, W. I. Assembly properties of the human immunodeficiency virus type 1 CA protein. Journal of virology. 78, 2545-2552 (2004).
  47. Forshey, B. M., von Schwedler, U., Sundquist, W. I., Aiken, C. Formation of a human immunodeficiency virus type 1 core of optimal stability is crucial for viral replication. Journal of virology. 76, 5667-5677 (2002).
  48. Gottlinger, H. G., Dorfman, T., Sodroski, J. G., Haseltine, W. A. Effect of mutations affecting the p6 gag protein on human immunodeficiency virus particle release. Proceedings of the National Academy of Sciences of the United States of America. 88, 3195-3199 (1991).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

HIV-1 Replication CapacityRestriction Enzyme CloningSubtype C HIV-1CEM-Based T Cell LineRadio Labeled Reverse Transcriptase AssayViral Stock TiteringNested RT-PCR AmplificationBCL One Restriction DigestionGXR25 Cell Infection
A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses
Contact Us
Recommend to Library

Privacy

Terms of Use

Policies

Copyright © 2026 MyJoVE Corporation. All rights reserved.