A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells

8K views

DOI:

10.3791/53655

March 3rd, 2016

In This Article

Summary

Here, we describe a method for the purification of differentiated human embryonic stem cells that are committed towards the definitive endoderm for the improvement of downstream applications and further differentiations.

Abstract

The differentiation capabilities of pluripotent stem cells such as embryonic stem cells (ESCs) allow a potential therapeutic application for cell replacement therapies. Terminally differentiated cell types could be used for the treatment of various degenerative diseases. In vitro differentiation of these cells towards tissues of the lung, liver and pancreas requires as a first step the generation of definitive endodermal cells. This step is rate-limiting for further differentiation towards terminally matured cell types such as insulin-producing beta cells, hepatocytes or other endoderm-derived cell types. Cells that are committed towards the endoderm lineage highly express a multitude of transcription factors such as FOXA2, SOX17, HNF1B, members of the GATA family, and the surface receptor CXCR4. However, differentiation protocols are rarely 100% efficient. Here, we describe a method for the purification of a CXCR4+ cell population after differentiation into the DE by using magnetic microbeads. This purification additionally removes cells of unwanted lineages. The gentle purification method is quick and reliable and might be used to improve downstream applications and differentiations.

Introduction

Pluripotent stem cells such as embryonic stem cells (ESCs) have the capability to differentiate into virtually any cell type of the human body. Thus, in vitro differentiation protocols can be used to generate numerous adult cell types such as cardiomyocytes1, hepatocytes2, beta cells3, lung epithelial4 or neuronal cells5. This makes ESCs a valuable tool for the potential treatment of various degenerative diseases3.

The in vitro differentiation of ESCs towards adult tissues of the lung, liver and pancreas requires a pseudo-gastrulation into cells reminiscent of the definitive endoderm (DE)6. Since downstream differentiation towards the aforementioned somatic cell types is significantly less efficient, an optimal endoderm differentiation is regarded as rate-limiting7. Cells that are committed towards the endoderm lineage undergo characteristic changes in their gene expression profile. Pluripotency master regulator genes are down regulated, whereas the expression of other transcription factors such as FOXA2, SOX17, HNF1B, members of the GATA family and the surface receptor CXCR4 is highly upregulated6, 8, 9. CXCR4 is known to be transactivated by SMAD2/3, downstream of Nodal/TGF-β signaling and SOX17 due to specific binding sites in its promoter region10. Thus it is a very suitable marker used in a number of reports6, 8, 11-13. These expression changes reflects a pseudo-gastrulation event, in which ESCs first acquire characteristics of a primitive streak-like cell population and subsequently commit into the endoderm germ layer6.

However, differentiation protocols are rarely 100% efficient as a few cells may resist the differentiation process or differentiate towards other unintended lineages14. These cells may negatively influence further differentiation. Furthermore, residual undifferentiated cells harbor great risks for later transplantation experiments and may give rise to teratomas15-17.

To remove these unwanted cells early-on the surface marker CXCR4 can be used for the purification of cells that are committed towards the DE18. Here, we describe a method for the positive selection of CXCR4+ cells from DE differentiation cultures. For this, the surface marker CXCR4 is bound by an antibody which then in turn binds to magnetic microbeads. Unlike the harsh conditions during FACS sorting, the magnetically labeled DE-like cells can then easily be purified in a benchtop format using a gentle purification method. This protocol provides a straightforward method for the removal of cell populations that resisted the DE differentiation process.

Access restricted. Please log in or start a trial to view this content.

Protocol

1. Differentiation of Human ESC towards the Definitive Endoderm

  1. Cultivate human embryonic stem cells (ESCs) in an incubator at 37 °C and 5% CO2.
  2. Coat a new 6-well cell culture plate with 1 ml of a basement membrane matrix and incubate the culture-ware for at least 30 min at RT. For specific details please turn to the respective manufacturer's instructions.
  3. Confirm that the cultured human ESCs have reached 80%-90% confluency under the microscope using a low magnification (e.g., 4X). Aspirate the medium from the cavities by sucking off the medium with a sterile glass Pasteur pipet. Wash the cells once with phosphate buffered saline (PBS) solution. For this, add 2 ml PBS to each well softly shake the plate and suck off the solution to remove dead cells and cell debris.
  4. Add 1 ml of enzyme-free passaging solution reagent for gentle dissociation of cell clusters. Incubate the cells at 37 °C and 5% CO2 until the cells show clear signs of disruption into small clusters.
    NOTE: The incubation time depends on the reagent used. For the enzyme-free passaging solution mentioned in the materials section, incubation time is roughly 7 min.
  5. Add 1 ml DMEM/F-12 medium and disrupt the remaining cell aggregates into single cells by pipetting up and down using a 1 ml pipette tip. Use this to flush the cells from the surface and transfer the cells to a centrifugation tube. To retrieve all cells, wash each well with 1 ml of DMEM/F-12 medium and add the medium to the centrifugation tube.
  6. Centrifuge the cells for 5 min at 300 x g. Aspirate the supernatant and resuspend the cells in 5 ml ES cell culture medium containing 10 µM Rho-Kinase (ROCK) inhibitor.
  7. Count the cells under the microscope using a hemocytometer and seed 150,000 - 400,000 cells per 6-well or in another plate layout, depending on the ES cell line used. Use culture medium containing 10 µM ROCK inhibitor to avoid apoptosis and culture the cells in an incubator at 37 °C and 5% CO2.
  8. Approximately 24 hr after seeding aspirate the medium with a sterile glass Pasteur pipet and add 2 ml of primitive streak induction medium.
    NOTE: This medium contains final concentrations of 1% glutamine, 0.2% FCS, 5 µM CHIR-99021 and 50 ng/ml activin A in Advanced RPMI-1640 medium. Commonly, use 2 ml of medium for cultivation in 6-well plates.
  9. 48 hr after seeding, replace the medium to endoderm induction medium. Cultivate the cells in this medium for another 48 hr with daily medium change.
    NOTE: This medium contains 1% glutamine, 0.2% FCS and 50 ng/ml activin A in Advanced RPMI-1640 medium. Cells that are committed towards the definitive endoderm express the surface marker CXCR4. The staining of CXCR4 can be used to quantify the number of DE-committed cells.

2. Staining of CXCR4+ Definitive Endoderm Cells for Flow Cytometry Analysis

  1. For the final 24 hr but at least 1 hr before harvesting the cells add 10 µM ROCK inhibitor to the culture medium.
  2. Coat the cell culture-ware that will be used for re-seeding with a basement membrane matrix, i.e., 12-well plates for qPCR analysis or chamber slides for immunofluorescence staining. Incubate the plates or slides for at least 30 min at RT.
  3. Aspirate the medium with a sterile glass Pasteur pipet from the wells of the differentiated cells used for staining and/or sorting.
  4. Add 1 ml of enzyme-free passaging solution reagent for the gentle dissociation of cell clusters. Incubate the cells at 37 °C and 5% CO2 until the cells show clear signs of disruption into small clusters.
    NOTE: The incubation time depends on the reagent used. For the enzyme-free passaging solution mentioned in the materials section, incubation time is roughly 7 min.
  5. Add 1 ml DMEM/F-12 medium and disrupt remaining cell aggregates into single cells by pipetting up and down using a 1 ml tip. Use this to flush the cells from the surface and transfer the cells to a centrifugation tube. To retrieve all cells, wash each well with 1 ml of DMEM/F-12 medium w/o FCS and add the medium to the centrifugation tube.
  6. Count the cells under the microscope using a hemocytometer. Cells from three wells of a 6-well plate should result in 10-15 x 106 cells after three days of differentiation. Centrifuge the cells for 5 min at 300 x g.
    NOTE: The exact number of obtained cells will depend on the pluripotent cell line used for the differentiation.
  7. Aspirate the supernatant and resuspend the cells in PEB buffer containing 10 µM ROCK inhibitor. Use 100 µl of this buffer for up to 107 cells. Add the 10 µM ROCK inhibitor on the day of staining. Use this buffer for all downstream applications (referred to as PEB buffer + RI).
    NOTE: PEB buffer contains 0.5% BSA and 2 mM EDTA in PBS. If more cells are to be stained, adjust the buffer volume accordingly.
  8. Add 10 µl of a CXCR4-APC antibody per 107 cells in 100 µl, this roughly represents a dilution of 1:10.
    NOTE: The usage of an APC-linked antibody is not mandatory. Instead it can be substituted depending on the microbeads used. If more cells are to be stained adjust the antibody volume accordingly.
  9. Mix by gently flipping the tube with the fingers and incubate at 4 °C in a refrigerator for 15 min. Resuspend the cells with 1-2 ml PEB buffer. Centrifuge the cells for 5 min at 300 x g.
  10. Aspirate the supernatant with a sterile glass Pasteur pipet and resuspend the cell pellet in 80 µl PEB per 107 cells and add 20 µl anti-APC microbeads.
    NOTE: If more cells are to be stained, adjust the micro-bead volume accordingly.
  11. Mix by gently flipping the tube with the fingers and incubate at 4 °C in a refrigerator for 15 min. Resuspend the cells with 1-2 ml PEB buffer + RI. Centrifuge the cells for 5 min at 300 x g. Aspirate the buffer. Resuspend in 500 µl PEB buffer + RI.

3. Magnetic Separation of CXCR4+ Cells

  1. Place a medium sized magnetic column in a magnetic field as per manufacture instructions. Pre-rinse the column with 500 µl PEB buffer +RI. Apply the entire cell suspension to the column. Collect the flow through as not all cells will bind to the column. Make sure not to disturb the columns for optimal retrieval of CXCR4+ cells.
  2. Wash the column three times with 500 µl PEB buffer + RI. Collect the first flow through and combine it with the collected cells from Step 3.1. Remove the magnetic column from the magnetic field and place it in a suitable collection tube. Add 1 ml PEB buffer + RI onto the column. To elute the cells firmly press down the plunger into the column.
  3. Optional: Collect all flow through samples separately and use 20 µl each to analyze the number of CXCR4+ cells using flow cytometry. Their number should decline with every washing step.
    NOTE: At least 2 x 104 viable, gated cells should be counted for reliable results.
  4. Repeat Steps 3.1-3.3 with the collected-flow through sample from Step 3.1 and the first flow through sample from step 3.2 using a new column. Do not re-use the previous column. By using the plunger air is pressed into the column, which blocks it.
  5. Count the cells under the microscope using a hemocytometer. Depending on the efficiency of the differentiation up to 6 x 106 cells can be sorted initially and another 1 x 106 cells by using a second column when using 107 cells for the procedure.
  6. Centrifuge the cells at 300 x g for 5 min. Aspirate the supernatant and with a sterile glass Pasteur pipet and resuspend the cells in 1 ml endoderm induction medium from Step 1.9 with additional 10 µM ROCK inhibitor.
  7. Count the cells under the microscope using a hemocytometer. Seed the cells at an appropriate density, i.e., ~ 4 x 105 cells per well of a 12-well plate (app. 3.6 cm2 surface) or ~ 1.5 x 105 cells per well of an 8-well chamber-slide.

4. Optional: Analysis of Purified Definitive Endoderm Population

  1. For immunofluorescence staining fix the purified cells from Step 3.7 roughly 24 hr after seeding with 4% paraformaldehyde and stain for definitive endoderm (DE) and/or pluripotency marker proteins.
    NOTE: Commonly used DE markers include FOXA2 and SOX17, commonly used pluripotency markers include OCT3/4, NANOG and SOX26, 8.
  2. For RT-qPCR analysis, harvest the purified cells directly or 24 hr after seeding, extract total-RNA and reverse transcribe cDNA from the extracted total-RNA samples. Use 10 ng cDNA as template per RT-qPCR reaction (triplicates) to analyze the expression of DE and pluripotency marker genes6, 8.
    NOTE: Commonly used marker genes are mentioned in Step 4.1. Cycle conditions are 5 min at 95 °C and 40 cycles of 15 sec at 95 °C and 1 min at 60 °C, followed by melting curve analysis.

Access restricted. Please log in or start a trial to view this content.

Results

Upon differentiation ESCs undergo drastic changes in gene and protein expression. Figure 1 depicts typical marker genes that can be used to verify a successful endoderm differentiation. Prime targets for a gene expression analysis are GSC, FOXA2, and SOX17. In a relative gene expression analysis especially FOXA2 and SOX17 are increased by > 2,000 fold when compared to undifferentiated ESCs. GSC is a...

Access restricted. Please log in or start a trial to view this content.

Discussion

Currently used differentiation protocols rarely result in 100% differentiated cells. For reasons that still have to be addressed some cells resist the differentiation process. Depending on the efficiency of the used differentiation protocol and the propensity of the ESC line a certain number of residual pluripotent cells are commonly observed even after differentiation into the definitive endoderm. These residual cells may impair downstream differentiations or further analysis such as transcriptomics, proteomics, and miR...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors declare that they have no competing financial interests.

Acknowledgements

The skillful technical assistance of Jasmin Kresse is gratefully acknowledged.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
Hues8 human embryonic stem cell lineHarvard Department of stem cell & regenerative biologySuitable cell line for endoderm generation
Hes3 human embryonic stem cell lineES Cell InternationalSuitable and robust cell line for endoderm generation
mTeSR1Stemcell Technologies5850ESC culture medium
FCSBiowestS1860
Advanced RPMI 1640Life Technologies12633012
CD184 (CXCR4)-APC, humanMiltenyi Biotec130-098-357
anti-APC MicroBeadsMiltenyi Biotec130-090-855 
OctoMACS SeparatorMiltenyi Biotec130-042-109magnetic field
Y-27632Selleck ChemicalsS1049ROCK inhibitor
CHIR-99021Tocris Bioscience4423
Activin APeprotech120-14
Gentle Cell Dissociation ReagentStemcell Technologies7174Enzyme-free passaging solution, alternative: Trypsin/EDTA
Matrigel*Corning354277basement membrane matrix
* solve and store in aliquots at -80 °C as outlined in the suppliers manual. Upon use, thaw on ice, dilute in 25 ml ice-cold knockout DMEM/F-12.
Add 1 ml to each well of a 6-well plate and incubate for 45 min at room temperature.
Remove the matrigel and use immediately.
MS ColumnsMiltenyi Biotec30-042-201
MACS SeparatorMiltenyi Biotec130-042-302
Human FOXA2 FW
gggagcggtgaagatgga
Life TechnologiesNA
Human FOXA2 REV
tcatgttgctcacggaggagta
Life Technologies
Human GSC FW
gaggagaaagtggaggtctggtt
Life Technologies
Human GSC REV
ctctgatgaggaccgcttctg
Life Technologies
SOX17 TaqMan assayApplied BiosystemsHs00751752_s1
Human SOX7 FW
gatgctgggaaagtcgtggaagg
Life Technologies
Human SOX7 REV
tgcgcggccggtacttgtag
Life Technologies
Human POU5F1 FW
cttgctgcagaagtgggtggagg
Life Technologies
Human POU5F1 REV
ctgcagtgtgggtttcgggca
Life Technologies
Human Nanog FW
ccgagggcagacatcatcc
Life Technologies
Human Nanog REV
ccatccactgccacatcttct
Life Technologies
Human TBP FW
caa cag cct gcc acc tta cgc tc
Life Technologies
Human TBP REV
agg ctg tgg ggt cag tcc agt g
Life Technologies
Human TUBA1A FW
ggc agt gtt tgt aga ctt gga acc c
Life Technologies
Human TUBA1A REV
tgt gat aag ttg ctc agg gtg gaa g
Life Technologies
Human G6PD FW
agg ccg tca cca aga aca ttc a
Life Technologies
Human G6PD REV
cga tga tgc ggt tcc agc cta t
Life Technologies
Anti-SOX2Santa Cruz Biotechnologysc-17320
Anti-FOXA2MerckMillipore07-633
Anti-SOX17R&D SystemsAF1924

References

  1. Sharma, A., Li, G., Rajarajan, K., Hamaguchi, R., Burridge, P. W., Wu, S. M. Derivation of Highly Purified Cardiomyocytes from Human Induced Pluripotent Stem Cells Using Small Molecule-modulated Differentiation and Subsequent Glucose Starvation. J Vis Exp. (97), (2015).
  2. Sgodda, M., et al. Improved hepatic differentiation strategies for human induced pluripotent stem cells. Curr Mol Med. 13 (5), 842-855 (2013).
  3. Naujok, O., Burns, C., Jones, P. M., Lenzen, S. Insulin-producing surrogate beta-cells from embryonic stem cells: are we there yet. Mol Ther. 19 (10), 1759-1768 (2011).
  4. Katsirntaki, K., et al. Bronchoalveolar sublineage specification of pluripotent stem cells: effect of dexamethasone plus cAMP-elevating agents and keratinocyte growth factor. Tissue Eng Part A. 21 (3-4), 669-682 (2015).
  5. Abranches, E., et al. Neural differentiation of embryonic stem cells in vitro: a road map to neurogenesis in the embryo. PLoS One. 4 (7), e6286(2009).
  6. Naujok, O., Diekmann, U., Lenzen, S. The generation of definitive endoderm from human embryonic stem cells is initially independent from activin A but requires canonical Wnt-signaling. Stem Cell Rev. 10 (4), 480-493 (2014).
  7. D'Amour, K. A., et al. Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells. Nat Biotechnol. 24 (11), 1392-1401 (2006).
  8. Diekmann, U., Lenzen, S., Naujok, O. A reliable and efficient protocol for human pluripotent stem cell differentiation into the definitive endoderm based on dispersed single cells. Stem Cells Dev. 24 (2), 190-204 (2015).
  9. Kim, P. T., Ong, C. J. Differentiation of definitive endoderm from mouse embryonic stem cells. Results Probl Cell Differ. 55, 303-319 (2012).
  10. Katoh, M., Katoh, M. Integrative genomic analyses of CXCR4: transcriptional regulation of CXCR4 based on TGFbeta, Nodal, Activin signaling and POU5F1, FOXA2, FOXC2, FOXH1, SOX17, and GFI1 transcription factors. Int J Oncol. 36 (2), 415-420 (2010).
  11. Nostro, M. C., et al. Stage-specific signaling through TGFbeta family members and WNT regulates patterning and pancreatic specification of human pluripotent stem cells. Development. 138 (5), 861-871 (2011).
  12. Rezania, A., et al. Maturation of human embryonic stem cell-derived pancreatic progenitors into functional islets capable of treating pre-existing diabetes in mice. Diabetes. 61 (8), 2016-2029 (2012).
  13. Bruin, J. E., et al. Maturation and function of human embryonic stem cell-derived pancreatic progenitors in macroencapsulation devices following transplant into mice. Diabetologia. 56 (9), 1987-1998 (2013).
  14. Fu, W., Wang, S. J., Zhou, G. D., Liu, W., Cao, Y., Zhang, W. J. Residual undifferentiated cells during differentiation of induced pluripotent stem cells in vitro and in vivo. Stem Cells Dev. 21 (4), 521-529 (2012).
  15. Hentze, H., Soong, P. L., Wang, S. T., Phillips, B. W., Putti, T. C., Dunn, N. R. Teratoma formation by human embryonic stem cells: evaluation of essential parameters for future safety studies. Stem Cell Res. 2 (3), 198-210 (2009).
  16. Herberts, C. A., Kwa, M. S., Hermsen, H. P. Risk factors in the development of stem cell therapy. J Transl Med. 9, 29(2011).
  17. Naujok, O., Kaldrack, J., Taivankhuu, T., Jörns, A., Lenzen, S. Selective removal of undifferentiated embryonic stem cells from differentiation cultures through HSV1 thymidine kinase and ganciclovir treatment. Stem Cell Rev. 6 (3), 450-461 (2010).
  18. Pan, Y., Ouyang, Z., Wong, W. H., Baker, J. C. A new FACS approach isolates hESC derived endoderm using transcription factors. PLoS One. 6 (3), 17536(2011).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Endoderm Cell PurificationCXCR4 Positive CellsMagnetic Bead SeparationDefinitive Endoderm DifferentiationFlow Cytometry AnalysisBasement Membrane CoatingROCK Inhibitor SupplementationCell Surface MarkerEndoderm Induction Medium