A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells

8K views

DOI:

10.3791/53655

March 3rd, 2016

In This Article

Summary

Here, we describe a method for the purification of differentiated human embryonic stem cells that are committed towards the definitive endoderm for the improvement of downstream applications and further differentiations.

Abstract

The differentiation capabilities of pluripotent stem cells such as embryonic stem cells (ESCs) allow a potential therapeutic application for cell replacement therapies. Terminally differentiated cell types could be used for the treatment of various degenerative diseases. In vitro differentiation of these cells towards tissues of the lung, liver and pancreas requires as a first step the generation of definitive endodermal cells. This step is rate-limiting for further differentiation towards terminally matured cell types such as insulin-producing beta cells, hepatocytes or other endoderm-derived cell types. Cells that are committed towards the endoderm lineage highly express a multitude of transcription factors such as FOXA2, SOX17, HNF1B, members of the GATA family, and the surface receptor CXCR4. However, differentiation protocols are rarely 100% efficient. Here, we describe a method for the purification of a CXCR4+ cell population after differentiation into the DE by using magnetic microbeads. This purification additionally removes cells of unwanted lineages. The gentle purification method is quick and reliable and might be used to improve downstream applications and differentiations.

Introduction

Pluripotent stem cells such as embryonic stem cells (ESCs) have the capability to differentiate into virtually any cell type of the human body. Thus, in vitro differentiation protocols can be used to generate numerous adult cell types such as cardiomyocytes1, hepatocytes2, beta cells3, lung epithelial4 or neuronal cells5. This makes ESCs a valuable tool for the potential treatment of various degenerative diseases3.

The in vitro differentiation of ESCs towards adult tissues of the lung, liver and pancreas requires a pseudo-gastrulation into cells reminiscent ....

Access restricted. Please log in or start a trial to view this content.

Protocol

1. Differentiation of Human ESC towards the Definitive Endoderm

  1. Cultivate human embryonic stem cells (ESCs) in an incubator at 37 °C and 5% CO2.
  2. Coat a new 6-well cell culture plate with 1 ml of a basement membrane matrix and incubate the culture-ware for at least 30 min at RT. For specific details please turn to the respective manufacturer's instructions.
  3. Confirm that the cultured human ESCs have reached 80%-90% confluency under the microscope using a low magnification (e.g., 4X). Aspirate the medium from the cavities by sucking off the medium with a sterile glass Pasteur pipet. Wash the cells once with pho....

Access restricted. Please log in or start a trial to view this content.

Results

Upon differentiation ESCs undergo drastic changes in gene and protein expression. Figure 1 depicts typical marker genes that can be used to verify a successful endoderm differentiation. Prime targets for a gene expression analysis are GSC, FOXA2, and SOX17. In a relative gene expression analysis especially FOXA2 and SOX17 are increased by > 2,000 fold when compared to undifferentiated ESCs. GSC is a.......

Access restricted. Please log in or start a trial to view this content.

Discussion

Currently used differentiation protocols rarely result in 100% differentiated cells. For reasons that still have to be addressed some cells resist the differentiation process. Depending on the efficiency of the used differentiation protocol and the propensity of the ESC line a certain number of residual pluripotent cells are commonly observed even after differentiation into the definitive endoderm. These residual cells may impair downstream differentiations or further analysis such as transcriptomics, proteomics, and miR.......

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors declare that they have no competing financial interests.

Acknowledgements

The skillful technical assistance of Jasmin Kresse is gratefully acknowledged.

....

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
Hues8 human embryonic stem cell lineHarvard Department of stem cell & regenerative biologySuitable cell line for endoderm generation
Hes3 human embryonic stem cell lineES Cell InternationalSuitable and robust cell line for endoderm generation
mTeSR1Stemcell Technologies5850ESC culture medium
FCSBiowestS1860
Advanced RPMI 1640Life Technologies12633012
CD184 (CXCR4)-APC, humanMiltenyi Biotec130-098-357
anti-APC MicroBeadsMiltenyi Biotec130-090-855 
OctoMACS SeparatorMiltenyi Biotec130-042-109magnetic field
Y-27632Selleck ChemicalsS1049ROCK inhibitor
CHIR-99021Tocris Bioscience4423
Activin APeprotech120-14
Gentle Cell Dissociation ReagentStemcell Technologies7174Enzyme-free passaging solution, alternative: Trypsin/EDTA
Matrigel*Corning354277basement membrane matrix
* solve and store in aliquots at -80 °C as outlined in the suppliers manual. Upon use, thaw on ice, dilute in 25 ml ice-cold knockout DMEM/F-12.
Add 1 ml to each well of a 6-well plate and incubate for 45 min at room temperature.
Remove the matrigel and use immediately.
MS ColumnsMiltenyi Biotec30-042-201
MACS SeparatorMiltenyi Biotec130-042-302
Human FOXA2 FW
gggagcggtgaagatgga
Life TechnologiesNA
Human FOXA2 REV
tcatgttgctcacggaggagta
Life Technologies
Human GSC FW
gaggagaaagtggaggtctggtt
Life Technologies
Human GSC REV
ctctgatgaggaccgcttctg
Life Technologies
SOX17 TaqMan assayApplied BiosystemsHs00751752_s1
Human SOX7 FW
gatgctgggaaagtcgtggaagg
Life Technologies
Human SOX7 REV
tgcgcggccggtacttgtag
Life Technologies
Human POU5F1 FW
cttgctgcagaagtgggtggagg
Life Technologies
Human POU5F1 REV
ctgcagtgtgggtttcgggca
Life Technologies
Human Nanog FW
ccgagggcagacatcatcc
Life Technologies
Human Nanog REV
ccatccactgccacatcttct
Life Technologies
Human TBP FW
caa cag cct gcc acc tta cgc tc
Life Technologies
Human TBP REV
agg ctg tgg ggt cag tcc agt g
Life Technologies
Human TUBA1A FW
ggc agt gtt tgt aga ctt gga acc c
Life Technologies
Human TUBA1A REV
tgt gat aag ttg ctc agg gtg gaa g
Life Technologies
Human G6PD FW
agg ccg tca cca aga aca ttc a
Life Technologies
Human G6PD REV
cga tga tgc ggt tcc agc cta t
Life Technologies
Anti-SOX2Santa Cruz Biotechnologysc-17320
Anti-FOXA2MerckMillipore07-633
Anti-SOX17R&D SystemsAF1924

References

  1. Sharma, A., Li, G., Rajarajan, K., Hamaguchi, R., Burridge, P. W., Wu, S. M. Derivation of Highly Purified Cardiomyocytes from Human Induced Pluripotent Stem Cells Using Small Molecule-modulated Differentiation and Subsequent Glucose Starvation. J Vis Exp. (97), (2015).
  2. Sgodda, M., et al.

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Endoderm Cell PurificationCXCR4 Positive CellsMagnetic Bead SeparationDefinitive Endoderm DifferentiationFlow Cytometry AnalysisBasement Membrane CoatingROCK Inhibitor SupplementationCell Surface MarkerEndoderm Induction Medium