A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells

Summary

Here, we describe a method for the purification of differentiated human embryonic stem cells that are committed towards the definitive endoderm for the improvement of downstream applications and further differentiations.

Abstract

The differentiation capabilities of pluripotent stem cells such as embryonic stem cells (ESCs) allow a potential therapeutic application for cell replacement therapies. Terminally differentiated cell types could be used for the treatment of various degenerative diseases. In vitro differentiation of these cells towards tissues of the lung, liver and pancreas requires as a first step the generation of definitive endodermal cells. This step is rate-limiting for further differentiation towards terminally matured cell types such as insulin-producing beta cells, hepatocytes or other endoderm-derived cell types. Cells that are committed towards the endoderm lineage highly express a multitude of transcription factors such as FOXA2, SOX17, HNF1B, members of the GATA family, and the surface receptor CXCR4. However, differentiation protocols are rarely 100% efficient. Here, we describe a method for the purification of a CXCR4+ cell population after differentiation into the DE by using magnetic microbeads. This purification additionally removes cells of unwanted lineages. The gentle purification method is quick and reliable and might be used to improve downstream applications and differentiations.

Introduction

Pluripotent stem cells such as embryonic stem cells (ESCs) have the capability to differentiate into virtually any cell type of the human body. Thus, in vitro differentiation protocols can be used to generate numerous adult cell types such as cardiomyocytes¹, hepatocytes², beta cells³, lung epithelial⁴ or neuronal cells⁵. This makes ESCs a valuable tool for the potential treatment of various degenerative diseases³.

The in vitro differentiation of ESCs towards adult tissues of the lung, liver and pancreas requires a pseudo-gastrulation into cells reminiscent ....

Protocol

1. Differentiation of Human ESC towards the Definitive Endoderm

1. Cultivate human embryonic stem cells (ESCs) in an incubator at 37 °C and 5% CO₂.
2. Coat a new 6-well cell culture plate with 1 ml of a basement membrane matrix and incubate the culture-ware for at least 30 min at RT. For specific details please turn to the respective manufacturer's instructions.
3. Confirm that the cultured human ESCs have reached 80%-90% confluency under the microscope using a low magnification (e.g., 4X). Aspirate the medium from the cavities by sucking off the medium with a sterile glass Pasteur pipet. Wash the cells once with pho....

Results

Upon differentiation ESCs undergo drastic changes in gene and protein expression. Figure 1 depicts typical marker genes that can be used to verify a successful endoderm differentiation. Prime targets for a gene expression analysis are GSC, FOXA2, and SOX17. In a relative gene expression analysis especially FOXA2 and SOX17 are increased by > 2,000 fold when compared to undifferentiated ESCs. GSC is a.......

Discussion

Currently used differentiation protocols rarely result in 100% differentiated cells. For reasons that still have to be addressed some cells resist the differentiation process. Depending on the efficiency of the used differentiation protocol and the propensity of the ESC line a certain number of residual pluripotent cells are commonly observed even after differentiation into the definitive endoderm. These residual cells may impair downstream differentiations or further analysis such as transcriptomics, proteomics, and miR.......

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
Hues8 human embryonic stem cell line	Harvard Department of stem cell & regenerative biology		Suitable cell line for endoderm generation
Hes3 human embryonic stem cell line	ES Cell International		Suitable and robust cell line for endoderm generation
mTeSR1	Stemcell Technologies	5850	ESC culture medium
FCS	Biowest	S1860
Advanced RPMI 1640	Life Technologies	12633012
CD184 (CXCR4)-APC, human	Miltenyi Biotec	130-098-357
anti-APC MicroBeads	Miltenyi Biotec	130-090-855
OctoMACS Separator	Miltenyi Biotec	130-042-109	magnetic field
Y-27632	Selleck Chemicals	S1049	ROCK inhibitor
CHIR-99021	Tocris Bioscience	4423
Activin A	Peprotech	120-14
Gentle Cell Dissociation Reagent	Stemcell Technologies	7174	Enzyme-free passaging solution, alternative: Trypsin/EDTA
Matrigel*	Corning	354277	basement membrane matrix * solve and store in aliquots at -80 °C as outlined in the suppliers manual. Upon use, thaw on ice, dilute in 25 ml ice-cold knockout DMEM/F-12. Add 1 ml to each well of a 6-well plate and incubate for 45 min at room temperature. Remove the matrigel and use immediately.
MS Columns	Miltenyi Biotec	30-042-201
MACS Separator	Miltenyi Biotec	130-042-302
Human FOXA2 FW gggagcggtgaagatgga	Life Technologies	NA
Human FOXA2 REV tcatgttgctcacggaggagta	Life Technologies
Human GSC FW gaggagaaagtggaggtctggtt	Life Technologies
Human GSC REV ctctgatgaggaccgcttctg	Life Technologies
SOX17 TaqMan assay	Applied Biosystems	Hs00751752_s1
Human SOX7 FW gatgctgggaaagtcgtggaagg	Life Technologies
Human SOX7 REV tgcgcggccggtacttgtag	Life Technologies
Human POU5F1 FW cttgctgcagaagtgggtggagg	Life Technologies
Human POU5F1 REV ctgcagtgtgggtttcgggca	Life Technologies
Human Nanog FW ccgagggcagacatcatcc	Life Technologies
Human Nanog REV ccatccactgccacatcttct	Life Technologies
Human TBP FW caa cag cct gcc acc tta cgc tc	Life Technologies
Human TBP REV agg ctg tgg ggt cag tcc agt g	Life Technologies
Human TUBA1A FW ggc agt gtt tgt aga ctt gga acc c	Life Technologies
Human TUBA1A REV tgt gat aag ttg ctc agg gtg gaa g	Life Technologies
Human G6PD FW agg ccg tca cca aga aca ttc a	Life Technologies
Human G6PD REV cga tga tgc ggt tcc agc cta t	Life Technologies
Anti-SOX2	Santa Cruz Biotechnology	sc-17320
Anti-FOXA2	MerckMillipore	07-633
Anti-SOX17	R&D Systems	AF1924