Circulating MicroRNA Quantification Using DNA-binding Dye Chemistry and Droplet Digital PCR

Summary

A sensitive and accurate method for cell-free microRNAs quantification using a dye-based chemistry and droplet digital PCR technology is described.

Abstract

Circulating (of cell-free) microRNAs (miRNAs) are released from cells into the blood stream. The amount of specific microRNAs in the circulation has been linked to a disease state and has the potential to be used as disease biomarker. A sensitive and accurate method for circulating microRNA quantification using a dye-based chemistry and droplet digital PCR technology has been recently developed. Specifically, using Locked Nucleic Acid (LNA)-based miRNA-specific primers with a green fluorescent DNA-binding dye in a compatible droplet digital PCR system it is possible to obtain the absolute quantification of specific miRNAs. Here, we describe how performing this technique to assess miRNA amount in biological fluids, such as plasma and serum, is both feasible and effective.

Introduction

MicroRNAs (miRNAs) are released into blood circulation by potentially all the cells of the organism, as a consequence of active release or necrotic and apoptotic processes. Cell-free miRNAs have been detected in the bloodstream either as free stable molecules or linked to lipoproteins or enveloped inside exosomes and microvesicles ^1-3. They are believed to function as cell-to-cell communicators ⁴, and their amount changes in the presence of cancer, cardiac disorders or autoimmune diseases ^5-7. Their accurate and reproducible quantification is the basis for their evaluation as disease biomarkers. However, for several reasons already des....

Protocol

MicroRNA Isolation from Plasma or Serum

Note: Plasma and serum preparation is a relevant step in circulating miRNA quantification. There is no preferred procedure for plasma and serum preparation. The only important thing to consider is that all the samples from the same experiment must be processed using exactly the same workflow. Start from 200 µl serum or plasma. Total RNA can be isolated from serum or plasma using commercially available kits.

1. Protocol for Total RNA (including miRNA) Isolation

1. Thaw serum/plasma samples on ice.
2. Add 1 ml of Lysis Reagent (e.g., QIAzol) to 200 µl serum/plasma....

Results

The absolute amount of specific miRNAs per ml of plasma or serum can be determined using a green fluorescent DNA-binding dye and droplet digital PCR technology. Figure 1 presents the process of positive-droplets selection, which determines the final miRNA concentration (copies/µl) in the amplification reaction calculated by the analysis software. The amount of each miRNA in the blood is very different, being some miRNA species more abundant than others. Using a 1:50 dilut.......

Discussion

Circulating miRNAs are present in blood at extremely low concentrations and the amount of RNA that can be extracted from plasma and serum samples is low. For this reason, they are difficult to quantify with other techniques such as microarray and RNA sequencing. Moreover, there is a generalized lack of agreement on data normalization and the presence of endogenous "reference" miRNAs in the blood. In this context, a sensitive technology like droplet digital PCR, capable of counting the number of miRNA copies per m.......

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
miRNeasy Mini Kit	Qiagen	217004	Columns for total RNA, including miRNA, extraction from serum/plasma
100 nmole RNA oligo Cel-miR-39-3p	Integrated DNA Technologies	Custom	Sequence: UCACCGGGUGUAAAUCAGCUUG
Universal cDNA synthesis kit II, 8-64 rxns	Exiqon	203301	Kit for microRNA reverse transcription
MicroRNA LNA PCR primer set	Exiqon	204000-206xxx and 2100000-21xxxxx	Primers for miRNA amplification inside droplets
QX200 droplet generator	BioRad	186-4002	Instrument used for droplet reading
QX200 droplet reader	BioRad	186-4003	Instrument used for droplet generation
QuantaSoft software	BioRad	186-3007	Software for data collection and analysis
PX1 PCR plate sealer	BioRad	181-4000	Plate sealer
DG8 droplet generator cartridges and gaskets	BioRad	186-4008	Cartridges used to mix sample and oil to generate droplets
QX200 ddPCR EvaGreen supermix	BioRad	186-4033/36	PCR supermix
QX200 droplet generator oil for EvaGreen dye	BioRad	186-4005	Oil for droplet generation