Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Environment

Empirische, metagenomischen und Computertechniken beleuchten die Mechanismen, durch welche Fungizide Kompromiss Bienengesundheit

doi: 10.3791/54631 Published: October 9, 2017

Summary

Mikrobielle Konsortien innerhalb von Bumble Bee Hives bereichern und Pollen für Bienenlarven bewahren. Sequenzierung der nächsten Generation, zusammen mit Labor und Feld-basierte Experimente mit beschreibt diesem Manuskript Protokolle verwendet, um die Hypothese zu testen, dass Fungizid Rückstände der Pollen Mikrobiom und Kolonie Demographie, letztlich zu Kolonie verändern Verlust.

Abstract

Züchter verwenden oft Fungizid Sprays während der Blüte Pflanzen gegen Krankheit, schützen die Bienen Fungizid Rückstände anführt. Obwohl als "Biene-Safe", gibt es Anzeichen dafür, dass Fungizid Rückstände Pollen Biene Rückgänge (für Honig und Bumble Bee Arten) zugeordnet sind. Während die Mechanismen relativ unbekannt bleiben, haben Forscher spekulierten, daß Biene-Mikrobe Symbiosen beteiligt sind. Mikroorganismen spielen eine entscheidende Rolle bei der Erhaltung und/oder Verarbeitung von Pollen, die als Nahrung für die Larven Bienen dient. Durch die Veränderung der mikrobiellen Gemeinschaft, ist es wahrscheinlich, dass Fungizide diese Mikrobe-vermittelten Leistungen stören und damit Gesundheit der Bienen gefährden. Dieses Manuskript beschreibt die Protokolle verwendet, um die indirekte Mechanismen zu untersuchen, durch die Fungizide Kolonie Rückgang verursachen können. Käfig Experimenten auszusetzen Bienen, Blumen Fungizid behandelt haben bereits die ersten belegt, dass Fungizide Tiefe Völkerverluste in eine native Hummel (Bombus Impatiens) verursachen. Mit Feld-relevanten Dosen von Fungiziden, eine Reihe von Experimenten wurden entwickelt, um eine feinere Beschreibung der mikrobiellen Gemeinschaft Dynamik der Fungizid-exponierten Pollen zu bieten. Verschiebungen in der strukturellen Zusammensetzung der Pilz- und bakterielle Assemblagen innerhalb der Pollen Microbiome sind von Next Generation Sequencing und metagenomischen Analyse untersucht. Experimente, die hierin entwickelt wurden so bieten ein mechanistisches Verständnis wie Fungizide Microbiome Pollen-Bestimmungen auswirken. Letztendlich sollten diese Erkenntnisse auf dem indirekten Weg Licht durch die Fungizide Kolonie Rückgänge verursachen können.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Verwaltet und Wildbienenarten sind weit verbreitete Rückgänge, mit großen Auswirkungen auf die beiden natürlichen und landwirtschaftlichen Systemen1erleben. Trotz konzertierte Anstrengungen, die Ursachen des Problems zu verstehen sind die Faktoren, die Honig Biene Rückgänge noch nicht gut verstanden,2,3,4. Für bestimmte Arten von wild, native Bienen ist die Situation dringend5,6geworden. Wenn Bienenvölker nicht aufrechterhalten werden können, wenn sie mit der industriellen Landwirtschaft schneiden, ihre Bevölkerungen werden weiter sinken und die Pflanzen erfordert Bestäuber (35 % der Weltproduktion7) ertragen werden verringert ernten.

Während viele mögliche Faktoren wie Schädlingsbekämpfungsmittelbelichtung Krankheit und Lebensraum Verlust1,4,8,9,10 in Honig Biene Rückgang verwickelt, über die interaktive Wirkung von diesen Stressoren auf heimischen Bienen Gesundheit, innerhalb oder in der Nähe von landwirtschaftlichen Systemen ist relativ wenig bekannt. Viele aktuelle Forschungsbemühungen weiterhin Insektizide (z.B., Neonicotinoide11,12), obwohl die letzten Forschung zeigt, dass Fungizide auch ein Rückgang der Biene Rolle können durch Beeinträchtigung der Gedächtnisbildung konzentrieren, olfaktorische Rezeption13, Nest Anerkennung14, Enzymaktivität und Stoffwechselfunktionen15,16,17. Fungizide weiterhin weltweit, während der Blüte zu blühenden Pflanzen angewendet werden. Neuere Studien belegen, dass Bienen bringen häufig Fungizid Rückstände zurück in den Bienenstock18, in der Tat, einen Großteil der getesteten Nesselsucht enthaltenen Fungizid Rückstände19,20Studien. Weiterarbeit hat ergeben, dass Fungizid Rückstände ist verbunden mit hohen Honig Biene Larven Mortalität21,22,23 und das Vorhandensein von "begraben Pollen" innerhalb der Kolonien, die zwar ungiftig, ist frei von mikrobielle Aktivität und ernährungsphysiologisch kompromittierten24. Trotz der Tatsache, dass Fungizide lange "Biene-Safe" gegolten haben, gibt es jetzt beweisen, dass die Exposition zu Fungizid allein in einer nativen Bumble Bee Spezies, Bombus Impatiens25schwere Kolonie Verluste verursachen kann.

Um Kausalität zwischen Fungizid-Exposition und Kolonie zu etablieren Sterblichkeit, die Arbeitsweise dieser Chemikalien müssen bestimmt werden. Wie in den Böden26, Sedimente27und aquatischen Umwelt28, belegt durch die Ausrichtung auf Pilze, Fungizide am ehesten verändern Pilz Fülle und Vielfalt im Rahmen der Pollen-Vorgaben damit Aufrufen einer großen Gemeinschaft zu verlagern, die Bakterien können stark begünstigen. Ohne Pilz Konkurrenten oder Antagonisten können bestimmte pathogenen Bakterien relativ ungeprüft, erleichtern das Verderben von Pollen-Bestimmungen vermehren. Frühere Forschung hat gezeigt, dass Mikroorganismen, insbesondere Hefen und filamentöse Pilze dienen als Nahrungsergänzung Symbionten für Bienen29,30,31, Schutz gegen Parasiten und Krankheitserreger32 ,33, und Langzeitarchivierung von Pollen Läden bieten. Fungizide, können deshalb, unreife Bienen indirekt Schaden, durch Unterbrechung der mikrobiellen Gemeinschaft, die benötigt wird, um diese Leistungen zu erbringen und/oder durch eine Erhöhung der Anfälligkeit für opportunistische Krankheitserreger und Parasiten12. Mit zunehmender Anforderungen an die Herstellung von Lebensmitteln, sind Kulturen weltweit jedes Jahr mit Fungiziden während der Blüte, unterstreicht die Notwendigkeit zu verstehen, das Ausmaß der Fungizid-induzierte Effekte besprüht.

Bis dato, die primäre Wissenslücken in Bezug auf einheimische Biene mikrobielle Ökologie kann durch die folgenden Fragen dargestellt werden: , inwieweit ändert Fungizid die mikrobielle Gemeinschaft im Rahmen der Biene Blütenstaub-Vorgaben? Was sind die nachgelagerten Auswirkungen des Verzehrs von Pollen mit einer grundlegend veränderten mikrobiellen Gemeinschaft? Im Einklang mit dieser ökologisch germane Fragen, wurden Experimente mit den primären Zielen der Enthüllung 1 entwickelt), Fungizid Rückstände allein kann schwere Kolonie Rückgang verursachen, in einem heimischen Bienenarten; (2) der Grad, mikrobielle Gemeinschaften in Pollen-Bestimmungen sind durch Fungizide und 3 verändert) wie Bienengesundheit von einer stark veränderten mikrobiellen Gemeinschaft betroffen ist. Die experimentelle Ziele wurden definiert, um die oben genannten Fragen mit einer Kombination aus Labor und Feld-basierten Experimente. Mit State-of-the-Art metagenomische und Molekulare Techniken neben traditionellen Methoden der Bereich Beobachtung, diese Forschung zielt darauf ab, die möglichen Auswirkungen von Fungiziden auf die Bienengesundheit zusammenzusetzen.

Das erste Ziel der vorliegenden Studie soll zeigen, dass Fungizid Exposition allein dazu führen, erhebliche Völkerverluste unter einheimischen Bienenarten dass kann. Eine Studie mit Grossfeld Käfige wurde verwendet, um die Auswirkungen einer Fungizid auf das Koloniewachstum von Bombus Impatiens, eine allgegenwärtige, reichlich einheimische Biene in den USA (Abbildung 1, Abbildung 2, Abbildung 3) untersuchen. Es wurde vermutet, dass Fungizid behandelt Nesselsucht geringer Fitness und atypische Demografie im Vergleich zu nicht-exponierten Nesselsucht präsentieren würde. Dieses Experiment gewonnene Daten unterstützt diese Hypothese, zeigen, dass Fungizid Rückstände im Pollen die alleinige Ursache für tiefe Völkerverluste in einer nativen Bumble Bee Arten25sein können. Das zweite Ziel dieser Studie ist, die Reaktion der Pollen Microbiome Fungizid Exposition zu untersuchen. Es wird vermutet, dass die Gemeinschaft Zusammensetzung der Mikroben im Rahmen der Pollen-Vorgaben ausgesetzt, Fungizide anders als die der unbehandelten Pollen werden. Während Pilz Fülle und Vielfalt deutlich zurückgehen voraussichtlich werden, werden Bakterien und/oder einer einzigen dominanten Pilzarten wahrscheinlich unkontrolliert in der Abwesenheit von anderen konkurrierenden Pilze wachsen. Durch eine Reihe von in-Vivo -Studien werden diese Verschiebungen in der Zusammensetzung der mikrobiellen Gemeinschaft mit Metagenomik analysiert werden.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. untersuchen die Wirkung von Fungizid Belichtung auf Bumble Bee Colony Erfolg mittels Cage Feldexperimente

  1. Satz bis zehn Gitter Käfige in einem Feld mit Hafer gepflanzt. Graben Sie einen Graben um jeden Käfig und graben Sie alle vier Kanten des Käfigs Netz in den Boden um sicherzustellen, dass die Bienen nicht entziehen können. Lager der Käfige, blühende Topfpflanzen, die bekannt sind für Bienen (z.B. Buchweizen, Borretsch, Alyssum, Kosmos und Sonnenblumen) attraktiv sein ( Abbildung 2).
  2. Ergänzen die Käfige mit einem einzigen Tablett (36 x 42 cm)-Blüte Klee. Cluster-florale Ressourcen innerhalb einer Ecke des Käfigs, besetzen einen Raum ca. 2,5 m x 1 m vegetieren die Restfläche Käfig durch die Hafer.
  3. Nach dem Zufallsprinzip die Hummel zuzuweisen, Kolonien, jedes mit Arbeiter und eine einzelne Dame, eine Behandlung (Fungizid Gegenwart/abwesend, N = 5 Kolonien pro Behandlung, insgesamt 10 Kolonien), dann legen Sie sie in einem Feld Käfig (N = 1/Käfig) für 29 Tage (23. Juni -21 Juli 2014).
  4. Orientieren die Kolonie Felder so, dass die Kolonie ' s Öffnungen zeigen nach Süden, die Bienen Navigations optimale Bedingungen bieten. Subventionieren die Kolonien mit Zucker Wasser Blase, platziert in den Bienenstock Boxen Ergänzung Nektarverfügbarkeit.
  5. Anwenden Chlorothalonil basierende Fungizid auf Feld-relevanten Ebene (20 g/L), blühende Pflanzen in den fünf Fungizid-Behandlung-Käfigen, statt mit einem Hand-Pestizid-Sprüher, zweimal während des Studiums (Tag 0 und 13). Die Blumen gleichmäßig zu beschichten, so dass keine weitere Flüssigkeit hält sich an floralen Oberflächen ( Abbildung 3).
  6. Zum Abschluss der Käfig Feldstudie B. Impatiens Kolonien aus den Käfigen von hand zu entfernen, die Bienenstöcke durch die Platzierung im Gefrierschrank-20 ° C für 20 min. abkühlen
  7. Bienen mit steriler Pinzette entfernen und notieren Sie die Anzahl der Larven, Puppen, adulte Weibchen (Ich. e. Sammlerinnen), und Männchen. Das trocken-Gewicht der Mutter Königin, Larven, Puppen, adulte Weibchen (d.h. Sammlerinnen) und Erwachsenen Männern aufnehmen mit einer Analysenwaage.

2. Untersuchen Sie die Auswirkungen von Fungizid Belichtung auf mikrobieller Gemeinschaften in den Pollen-Bestimmungen von Bumble Bee Nester mit Labor-basierte In Vivo Studien

  1. pulverisieren kommerziell erworben Pollen zu einem feinen Pulver mit einem Standard- Labor-Kugelmühle. Sterilisieren Sie pulverisierte Pollen durch Einweichen in 70 % igem Ethanol, ermöglicht es, über Nacht unter UV-Licht zu verdampfen. Sterilität der Pollen durch Ausplattieren ~0.5 mg auf Allzweck Agar Medien überprüfen.
    1. Sterilisiert Pollen, mit sterilisierten Pipetten, Hinzufügen der trockenen Bereich relevanten Dosierung von Fungizid: propiconazolhaltige bei 14,3 %; Azoxystrobin bei 22,9 % für Behandlungen (0,74 µL und 0,65 µL bzw. / Tag / hive). Mischen Sie nun mit sterilisierten Holzstäbchen.
  2. Platz 6 experimentelle Nesselsucht (n = 3 Stück für die Kontrolle und Behandlung) in eine saubere, hygienische Labor Benchtop auf Raumtemperatur gehalten. Jeden Tag wiegen 4,27 g Pollen 34 , 35 gemischt mit Fungiziden (für Behandlungen) oder sterilem Wasser (zur Kontrolle) in eine Kapuze mit standard aseptische Technik.
    1. Die Falltüren zur Verfügung gestellt von der Seite des Kartons umschließt die Nesselsucht, führen die Pollen in die Bienenstöcke. Ergänzung der Bienenstöcke mit sterilisierten Zuckerlösung pro Woche. Futterregime für vier Wochen weiter.
  3. Zum Abschluss der Labor-basierte Studie, kühlen die Bienenstöcke indem man in Gefrierschrank-20 ° C für 20 min. kratzen die Pollen-Bestimmungen enthaltenen Brut Kammern mit sterilisierten Pinzette und Spachteln und in sterile Lagerung Rohre statt. Shop bei-80 ° C. Graf und Datensatz das Gewicht der Arbeitnehmer und der Königin-Mutter am Anfang und Ende des Experiments (Schritt 1.7).
  4. Isolieren DNA von Pollen-Bestimmung Probe mit im Handel erhältlichen DNA-Isolierung-kits (siehe Materialtabelle für Details).
    1. Fügen Sie 0,25 g Pollen-Bestimmung zur Extraktion Rohre kurz Vortex mischen.
    2. Machen eine 200 mg/mL Lysozym Lösung in entionisiertem destilliertem Wasser, genug für 50 µL/Probe. Kräftig schütteln, um völlig Formularlösung.
    3. Die Extraktion Rohre mit Probe in es 50 µL der Lysozym-Lösung hinzu und mischen Sie gut durch invertieren mehrmals. Inkubieren Sie das Rohr für 10 min bei 37 ° C im Wasserbad. Wenn Niederschlag gebildet hat, Wärme Lösung auf 60 ° C bis vor Gebrauch aufgelöst.
    4. Hinzufügen 70 µL wässrigen Lyse Lösung zur Extraktion Rohre, horizontal auf einem Flachbett-Wirbel-Pad mit Klebeband sichern und Wirbel für 10 min. Zentrifuge Rohre bei 10.000 x g für 30 s bei Raumtemperatur.
    5. Übertragen den Überstand auf eine saubere 2 mL Sammelröhrchen. Fügen Sie 250 µL Niederschlag Proteinlösung und Vortex für 5 S. Inkubation bei 4 ° C für 5 min in ein Eisbad.
      Hinweis: Erwarten Sie zwischen 400 µL, 500 µL überstand. Überstand kann noch einige Partikel enthalten.
    6. Die Rohre bei Raumtemperatur für 1 min bei 10.000 x g Zentrifugieren und bis zu 600 µL Überstand auf eine saubere 2 mL Sammelrohr übertragen. Fügen Sie 200 µL der wässrigen Inhibitor Haarentfernung Lösung, kurz, Wirbel und inkubieren Sie bei 4 ° C für 5 min. Zentrifuge die Rohre bei Raumtemperatur für 1 min bei 10.000 x g. bis zu 750 µL Überstand in ein sauberes 2 mL Sammelröhrchen übertragen.
    7. Fügen Sie 1200 µL wässrigen Bind Lösung des Überstandes und Wirbel für 5 s. Laden ca. 675 µL des Überstands auf ein Spin Filter und Zentrifuge bei 10.000 x g für 1 min bei Raumtemperatur. Verwerfen die Durchströmung.
    8. Wiederholen 2.4.7. zweimal.
      Hinweis: Insgesamt drei Lasten für jede Probe verarbeitet sind erforderlich.
    9. Hinzufügen 500 µL Ethanol und Zentrifuge bei Raumtemperatur für 30 s bei 10.000 x g. die Durchströmung zu verwerfen und erneut Zentrifugieren, bei Raumtemperatur für 1 min bei 10.000 x g. Ort Spin Filter in einer sauberen 2 mL Sammelröhrchen.
    10. Elution hinzufügen 100 µL Puffer in die Mitte der Filtermembran. Zentrifuge bei Raumtemperatur für 30 s bei 10.000 x g. verwerfen den Spin-Filter. Store gesammelten DNA-20 ° C bis-80 ° C
  5. Verwendung isolierte DNA Sequenzierung.
    1. Quantify, und isolierte DNA auf 2 ng/µL fluorometrisch Analyse zu normalisieren.
      1. Prepare Reaktionen in dreifacher Ausfertigung für jede extrahierte Probe, die relativen Mengen der 28 s zu vergleichen (Pflanze), seine (Pilze), zu analysieren und 16 s (bakterielle) Komponenten der einzelnen Pollen-Bestimmung Probe 36. Stellen Sie sicher, dass jede Reaktion 10 enthält ng der Gesamt-DNA, 2 X asymmetrische Cyanin-Farbstoff basierend-master-Mix und 2,5 µL von forward und reverse Primer Paare 28KJ/28 b 37 für Anlage und ITS1/ITS5.8R für Pilz DNA 38 .
    2. Verstärken DNA mit den folgenden Parametern: 2 min vor Denaturierung bei 50 ° C, 2 min erste Denaturierung bei 95 ° C, 40 Zyklen (15 s bei 98 ° C, 15 s 58 ° c, 60 s bei 72 ° C), gefolgt von einer Schmelze Kurve.
    3. Bereiten Sie eine 2-stufige, verschachtelten PCR-Protokoll Next Generation Sequencing-Bibliotheken für die 16 s rRNA V3/V4 Variable Region und ITS / 5.8s rRNA Abstandhalter Region.
      1. Hinzufügen 12,5 µL DNA bis 5 Pmol jedes Grundierung und 2 x master-Mix. Stellen Sie separate Reaktionen für jede Region (16 s oder ITS; siehe Tabelle 1). Region spezifische Primer zu ändern, wie zuvor beschrieben 39 , 40 gen-spezifische Sequenzen Sequenzer-spezifische Adapter Überhang Nukleotidsequenzen hinzu.
      2. Erste Verstärkung mit den folgenden Parametern ausführen: 3 min erste Denaturierung bei 95 ° C, 25 Zyklen (30 s bei 95 ° C, 30 s bei 55 ° C, 30 s bei 72 ° C), letzte Verlängerung 5 min bei 72 ° c
      3. Folgende erste Verstärkung, Bibliotheksgröße und Menge durch elektrophoretische Mobilität überprüfen und reinigen Sie mit einer 1 x Volume Festphase reversible ImmObilization Perlen, passives Grundierungen und Reaktion Reagenzien zu entfernen. Pool-16 s und seine Amplifikate quantitativ erstelle ich einen einzigen Amplikons Pool für jede Probe.
      4. Sequenzer bestimmte Adapter hinzufügen und probieren Sie spezifische doppelte Indizes verwenden die folgenden Primer (siehe Tabelle 1). 2.5 µL der amplifizierten DNA zu 5 Pmol jedes Grundierung und 2 x master-Mix hinzufügen. Bibliothek Verstärkung mit den folgenden Parametern ausführen: 3 min erste Denaturierung bei 95 ° C, 8 Zyklen (30 s bei 95 ° C, 30 s bei 55 ° C, 30 s bei 72 ° C), letzte Erweiterung 5 min bei 72 ° c
    4. Folgende PCR, sauber fertige Bibliotheken mit einem 1 X Volume der Festphase reversible Immobilisierung Perlen. Bewerten Sie Qualität und Quantität der fertige Bibliotheken mit elektrophoretische Mobilität und Fluorometry, bzw.. Bibliotheken, 2 µM und Pool vor der Sequenzierung zu standardisieren.
    5. Next Generation Sequencing durchführen, auf einer Plattform, die analog zu den Adaptern in der sekundären PCR mit einer entsprechenden Länge zur Deckung der gesamten Amplikons 41 hinzugefügt.
  6. Sequenz, Annotation und Analyse der mikrobiellen Zusammensetzung.
    1. Kombinieren paar-End Sequenzierungsdaten (R1 und R2) in einzelne Contigs für alle sequenzierten Bibliotheken. Nach dem Zusammenführen von R1 und R2 Dateien, wird eine einzelne Fasta-Datei für jeden der Bibliotheken produziert.
      Hinweis: Dieser Schritt und die Prozesse beschrieben (sofern nicht anders angegeben) erfolgt in Mothur Version 1.38.0 38.
    2. Bildschirm jede Fasta-Datei entfernen Sie mehrdeutige Basen, unerwartet lange Sequenzen und lange Homopolymere.
      Hinweis: Die Parameter für das Screening und Sequenz Entfernung sind Maxambig = 0, Maxlength = 600 und Maxhomop = 8 für beide Gene. Entfernen Sie identische Sequenzen, aber halten Sie eine Kontingenz Tabelle separat für alle Bibliotheken (aka Zahlentabelle in Mothur).
    3. Richten Sie einzigartige Sequenzen der 16 s gen Bibliothek gegen SILVA Datenbankversion 123 und gen ITS Bibliothek gegen den vereinen ihre Datenbank 42.
      Hinweis: Sequenzen müssen von der Königreich-Ebene auf die Ebene der Gattung annotiert werden.
      1. Anschließend Cluster ausgerichtet Sequenzen mit der Funktion pre.cluster mit Diff = 5, und entfernen Sie Chimären.
    4. Klassifizieren Sequenzen mit der Methode Wang 43 anhand der SILVA (für 16 s-gen) und vereinen ITS (für gen ITS) Taxonomie Dateien (cutoff-Wert von 80 %).
    5. In R 44 laden die Kontingenz Tabellen (eine pro gen) während der Klassifizierungsprozess in Mothur erzeugt. Auf jeder taxonomischen Ebene, relative Häufigkeit pro Bibliothek zur weiteren Analyse der mikrobiellen Gemeinschaft Änderungen zu erhalten.
      Hinweis: Auf jeder taxonomischen Ebene zusammenführen taxonomische Gruppen als relative Häufigkeit weniger als 2 % für die experimentelle Wiederholungen ist.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Feldstudie Käfig:

Den Käfig Experimenten gewonnene Daten zeigte, dass die Hummeln Bienenvölker eine deutliche Reaktion auf Fungizid Exposition. Das Fungizid behandelt Nesselsucht produziert deutlich weniger Arbeiter (12,2 ± 3,8, Mittelwert ± SE) als Kontrolle Nesselsucht (43,2 ± 11,2, F1,9= 6,8, p = 0,03) (Abbildung 4). Darüber hinaus war die Biene Biomasse der Fungizid behandelt Nesselsucht (0,91 g ± 0.15) deutlich niedriger als die Kontrolle Nesselsucht (2,36 g ± 0.55; F 1,9 = 8,3, p = 0,02). Dieses Muster der abgesenkten Biomasse in den Bienenstöcken Fungizid behandelt wurde auch unter den Königinnen Mutter beobachtet. Die Königinnen der Fungizid behandelt Bienenstöcke präsentiert mit einer deutlich geringeren Biomasse (0,14 g ± 0,04) als die Königinnen der Kontrolle Nesselsucht (0,27 g ± 0,01; Z = 2.5, p = 0,01). Fungizid Belichtung jedoch nicht die Anzahl der Larven, Puppen und Männer über die Behandlungen beeinflussen. Die Biomasse der diskreten Lebensstadien (Larven, Puppen, Arbeiter und Männchen) und einzelnen Gewichte für die Larven, Puppen und Arbeiter nicht zeigen keinen Unterschied über Fungizid behandelt und Kontrolle Nesselsucht.

Labor-basierte Studie:

Labor-basierte Experimenten gewonnene Daten darauf hingewiesen, dass vor der Belichtung Fungizid, Kontrolle und Fungizid behandelt Nesselsucht statistisch vergleichbaren durchschnittlichen Arbeitnehmers Graf (Steuern, Nesselsucht = 28,0 ± 3,1; Fungizid behandelt Nesselsucht = 31,67 ± 2.0; n = 3 jeder) und queen-Gewicht (Steuern, Nesselsucht = 0,77 g ± 0,04; Fungizid behandelt Nesselsucht = 0,74 g ± 0,01). Jedoch am Ende der Studie, Anzahl der Arbeiter war signifikant höher in Kontrolle Nesselsucht (67.67 ± 4,3), verglichen mit Fungizid behandelt Nesselsucht (45.33 ± 3,8) (t4 = 3,89, p = 0,01). Arbeiter-Bevölkerung erhöhte sich um ~ 150 % in Kontrolle Bienenstöcke im Vergleich zu ~ 45 % in den Bienenstöcken Fungizid behandelt. Ebenso blieb Endgewicht der Königinmutter Kontrolle Nesselsucht (0,76 g ± 0,02) im Vergleich zu einem ~ 35 % Abnahme der Fungizid behandelt Nesselsucht (0,49 g ± 0,16) relativ unverändert. Zusammen genommen, diese Ergebnisse stehen im Einklang mit den zuvor veröffentlichten Ergebnisse25 und Fungizid Exposition Kolonie Fitness beeinflusst, wie weniger Arbeitnehmer Zahlen belegt und verringert Königinmutter Gewichte (Abbildung 5).

Metagenomischen Analyse der Pollen-Bestimmungen zeigte deutliche Unterschiede zwischen den mikrobiellen Gemeinschaften gesammelt von Fungizid behandelt und Steuern Nesselsucht (Abbildung 6). Es gab eine Abnahme (> 95 %) in die relative Häufigkeit der häufigsten isolierte Streptomycetales, Enterobacteriales in den Bienenstöcken Fungizid behandelt. Interessanterweise sind beide Gruppen für ihre antimykotische Aktivität und Rolle in der Pollen-Erhaltung30,45 in Hummel Bienenstock Umgebungen bekannt. Bakterielle Mitglieder der Ordnung Rickettsiales, inklusive verbreiteten Erregern von Arthropoden46, zeigten viel mehr Fülle in den Bienenstöcken Fungizid behandelt. Nesselsucht Fungizid behandelt hatte eine geringere Fülle der Pilze gehören zu den Aufträgen Eurotiales und Sordariales und einer höheren Fülle von Aufträgen, Capnodiales und Ascosphaerales im Vergleich zur Kontrolle Nesselsucht (Abbildung 7). Wie erwartet, für Bakterien und Pilze, Shannons Vielfalt Index (H) und Ebenheit (E) lag in Fungizid behandelt Bienenstöcke im Vergleich zu Kontrollen, obwohl diese Unterschiede nicht statistisch signifikant waren (Bakterien: H Steuern, beuten =1,25 ± 0,3, HFungizid behandelt Nesselsucht = 0,82 ± 0,2, EKontrolle Nesselsucht = 0,46 ± 0,1; EFungizid behandelt Nesselsucht = 0,31 ± 0,1; Pilze: HKontrolle Nesselsucht =0.99 ± 0,3, HFungizid behandelt Nesselsucht = 0,72 ± 0,4, EKontrolle Nesselsucht = 0,57 ± 0,2; EFungizid behandelt Nesselsucht = 0,42 ± 0,2). Obwohl Detaillierung der Stoffwechsel- und funktionellen Auswirkungen solche Gemeinschaft verlagert würde den Rahmen dieser Studie war, kombiniert mit der Kolonie Graf und Gewichtsdaten, diese Ergebnisse legen nahe, dass Fungizid Exposition Rückgang der Kolonie Gesundheit durch beeinträchtigen könnten die Symbiose zwischen Bienen und die Pollen Mikrobiom zu stören. Weiteren Untersuchung in die Rolle des spezifischen mikrobiellen Gruppen beeinflussen Larven Survivorship empfiehlt sich besser beurteilen, die Rolle der Pollen Mikrobiom zur Erhaltung gesunder Bienenvölker.

Figure 1
Abbildung 1: ein Nest Bombus Impatiens . Hochauflösendes Bild der Arbeitnehmer tendenziell Brutzellen. Brutzellen können mehrere Eiern und Larven zu einem bestimmten Zeitpunkt enthalten. Entwicklung von Larven ernähren sich von Pollen-Bestimmungen, die in regelmäßigen Abständen in die Kammer eingebracht. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 2
Abbildung 2: Grossfeld Käfige errichtet, um die Bienenvölker Haus. Jedes Netz-Käfig (N = 10) war ausgestattet mit einem kommerziell erworben Bombus Impatiens Bienenstock, sowie in voller Blüte Pflanzenarten bekannt, die Bienen anlocken. Blumen waren in einer Ecke des Käfigs bestückt und die verbleibende Fläche war mit Oat Grass bewachsen. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 3
Abbildung 3: Fungizid Rückstand auf eine vor kurzem gesprüht Sonnenblume. Am Tag 0 und 13 des Experiments wurden Bereich relevante Dosen Fungizide gesprüht. Mit einem Pestizid-Sprayer, wurden die Blumen gleichmäßig mit einem Fungizid-Lösung beschichtet bei Dämmerung/Abend zur Vermeidung von direktem Kontakt mit Sammlerbienen. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 4
Abbildung 4: Auswirkungen von Fungizid Rückstand auf Hummeln im Käfig Experiment. Bumble Bienenvölker, die Fungizid Rückstände auf Pollen ausgesetzt waren, ausgestellt erheblichen Rückgang der Volksstärke (reductIonen im Erwachsenen weiblichen Fülle) im Laufe von einem Monat. Fehlerbalken darzustellen ± 1SE; p < 0,05. Diese Zahl wurde von Bernauer Et Al. modifiziert. 25. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 5
Abbildung 5: Auswirkungen von Fungizid Rückstand auf Hummeln in einem Labor-Experiment. Bumble Bienenvölker, die Fungizid behandelt Pollen ausgesetzt waren, erheblichen Rückgang der Volksstärke (Senkung der Erwachsenen Arbeiter Fülle) und Rückgang der Königinmutter Gewicht im Laufe von einem Monat ausgestellt. Fehlerbalken darzustellen ± 1SE; p = 0,03. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 6
Abbildung 6: Kreisdiagramm metagenomische Klassifikation von Pilz- und bakterielle Diversität bei der Bestellung den Rang. Analysen basierend auf (ein) 16 s und (b) ITS basierte Klassifikation von Pollen-Bereitstellung Proben gesammelt von Kontrolle und Fungizid behandelt Nesselsucht. Kontrolle Nesselsucht zeigte höhere Vielfalt und Ebenheit in mikrobiellen Verteilung. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 7
Abbildung 7: prozentuale Veränderung im Auftrag Rang relative Häufigkeit von Bakterien und Pilzen in Reaktion auf Fungizid Exposition. Metagenomische Klassifizierung der mikrobiellen Lebensgemeinschaften mit (ein) 16 und (b) ITS basiert Zündkapseln Klicken Sie bitte hier, um eine größere Version dieser Figur.

Primerpaar Primer-Typ Primer Sequenz
28KJ/28 B Anlage GGC GGT AAA TTC CGT CC /
CGT CCG TGT TTC AAG ACG
ITS1 / ITS5.8 Pilz TCC GTA GGT GAA CCT GCG G /
KNEBEL ATC CGT TGT TGA AAG TT
16 s vorwärts / rückwärts Verschachtelte bakterielle 5'-ACACTCTTTCCCTACACGACGCTCTTCCGATCTCCTACGGGNGGCWGCAG-3 "/
5'-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGACTACHVGGGTATCTAATCC-3 "
ITS1F Grundierung / ITS4 Verschachtelte pilzartige 5'-ACACTCTTTCCCTACACGACGCTCTTCCGATCTTTCGTAGGTGAACCTGCGG - 3'
5'-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTCCTCCGCTTATTGATATGC - 3'
Adapter-Primer 5'-AATGATACGGCGACCACCGAGATCTACAC [55555555]
ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3 "
5'-CAAGCAGAAGACGGCATACGAGAT [77777777]
GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT -3 "

Tabelle 1: Liste der Primer-Paaren und Primer-Sequenzen, die in DNA Verstärkung verwendet. Siehe Text für Referenzen.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Untersuchungen über die Auswirkungen der Fungizide auf die Bienengesundheit blieben ein erforschten Aspekt des Schädlings-Management-Strategien. Unsere Studie zielt darauf ab, diese Wissenslücke zu überbrücken, mithilfe einer Reihe von ergänzenden Techniken, die explizit die potenziellen Faktoren Biene Rückgänge zu isolieren. Planung, Begründung und Darstellung dieser Experimente sind nachfolgend aufgeführt.

Es ist darauf zu achten, dass keine Bienen erlaubt sind, um das Netz der Käfig Experimente, zu entkommen, da das Demografie-Analyse gefährden würde. Es ist auch wichtig, dass die künstliche Nester ausreichend Isolierung vor Regen und direkter Sonneneinstrahlung zu schützen. Darauf sollte geachtet werden, so dass Fungizide nicht direkt auf die Nester besprüht werden. Die Kolonien sollte vorgesehen werden, mit Zucker Wasser Harnblasen ergänzen Nektar gesammelt und Austrocknung zu verhindern.

Für das Labor Fütterungsversuche basiert, sollte strengere aseptische Bedingungen beibehalten werden, um Kontaminationen zu vermeiden, wenn die Pollen Mahlzeiten vorbereiten. Im Handel gekaufte Pollen gepudert werden muss und UV vor Gebrauch sterilisiert. Bienenstock Hygiene einzuhalten, um Befall von äußeren Parasiten wie Speisekammer Motten und Schaben zu verhindern. Flüssigkeit Blase sollte mit sterilisierten Zuckerlösung zu verhindern Austrocknung ergänzt werden. Für Vorbehandlung Volkszählung, sollte darauf geachtet werden nicht zu den Stress die Bienen durch übermäßige Handhabung und halten sie außerhalb der hived, für längere Zeiträume.

Als DNA-Ertrag hängt von dem Alter und Art des Ausgangsmaterials, müssen nur frische oder gut gefrorene Proben in DNA-Extraktion und Verstärkung verwendet werden. Probengewicht für DNA-Extraktion sollte 0,25 gm nicht überschreiten, da diese DNA-Ertrag zu senken. DNA-Erträge sollten mit Gelelektrophorese quantifiziert werden. Im Vorfeld elektrophoretischen Quantifizierung der isolierten DNA ist von entscheidender Bedeutung, bevor Sie fortfahren mit qPCR Reaktionen auf effiziente Verstärkung47zu gewährleisten.

Für die metagenomischen Analyse eine umfassendere Analyse der mikrobiellen Dynamik erhalten Sie durch die Begrenzung der Höhe der kommentierten Sequenzen (durch eine Lockerung der Bruchteil der tolerierbaren Unterschiede zwischen Sequenzen) und Verringerung der Zahl der taxonomischen Gruppen, wie sowie zusammenführen diejenigen für die relative Häufigkeit deutlich geringer ist (< 2 %).

Die konservative Stichprobengröße (N = 5, denn beide Fungizid behandelt und Käfig Studie Nesselsucht unbehandelt) können die Abweichungen in Daten, die in zukünftigen Studien minimiert werden durch größere Replikation aufzublasen. Höhere Auflösung und statistische Aussagekraft der Ergebnisse hinzu, die Bienenvölker censused und wog werden vor und nach Fungizid. Durchführung des Experiments Käfig über einen längeren Zeitraum wird die Produktion von neuen Königinnen, ermöglichen, als eine zusätzliche Antwortvariable dienen kann. Mit diesen Änderungen des aktuellen Protokolls werden zukünftige Studien mehr Details über Bienenstock Populationsdynamik bieten.

Des hydrophoben Charakters des Pollens schreckt seine effektive Mischung mit Wasser. Pulverisieren und Sichtung der Pollen-Granulat zu einem feinen Pulver, hilft bei der Mischprozess. Die Menge an Pollen Pulver kann eingestellt werden, um die gewünschte Konsistenz zu erreichen. Darauf sollte geachtet werden, mischen Sie die Flüssigkeit (Wasser oder Fungizid), um eine homogene Verteilung der Wirkstoffe und auch Lieferung an die Sammlerinnen zu erreichen.

Da überschüssiges DNA PCR-Reaktionen hemmen kann, empfiehlt es sich, diese Probe wiegen sollte nicht mehr als 0,25 g. übermäßige vortexen sollte vermieden werden, da diese DNA, Senkung der Ertrag schert. Niedrige DNA-Ertrag kann auch über längere Zeit auf den Puffer, Lyse zurückzuführen. Bakterielle Primer sollte vorzugsweise aus der V7-V9-Region der 16 s rRNA gewählt werden, um unspezifische Verstärkung der Chloroplast DNA48zu minimieren. Darüber hinaus bieten die Sequenzierung anderer Gene, wie die 18 s ribosomalen RNA gen ein besseres Verständnis für die mikrobielle Vielfalt Pollen sowie der demografischen Veränderungen auf Fungizid Auslastung.

Angesichts der Menge von Bibliotheken mit Mothur zu verarbeiten, kann Rechenzeit beträchtlich hoch sein. Entfernen von Singletons, beim Vergleich von Sequenzen gegeneinander (wenn computing-Ressourcen begrenzt sind, entfernen Sie diese vor der Chimäre Filtration) kann die erforderliche Zeit für die Berechnung der operativer taxonomischer Einheiten deutlich sinken.

Die Käfig-Experimente beschränken die natürliche Reichweite der Bienen (im Gegensatz zu, so dass sie weit über die Landschaft Futter), und es ist unklar, der Grad, auf die solche Einschränkungen der Antwortvariablen beeinflussen können. Obwohl die Behandlung und Eindämmung der Käfige die gleiche Palette von biotischen und abiotischen Variablen auftreten, ist es logistisch unmöglich zu kontrollieren für die Mikroumgebung innerhalb jeder Käfig.

Das wahre Ausmaß der mikrobielle Wechselwirkungen innerhalb der Gemeinschaft ist viel zu komplex und komplizierte, durch experimentelle Versuche zu replizieren. Während unsere Daten wahrscheinlich eine Teilmenge der gesamten mikrobiellen Diversität innerhalb von Pollen-Bestimmungen zu dokumentieren, ist es der erste Einblick in die Wechselwirkungen, die zwischen Bakterien und Pilzen in die Anwesenheit/Abwesenheit von Fungiziden durchsetzen kann.

Verwendung alternative Datenbanken zum Ausrichten von49 Sequenzen oder Vorhersage metabolische Funktionszustände basierend auf Pollen bakteriellen Vielfalt50 bieten einen umfassenderen Blick auf die Pollen Microbiome. Schließlich ist um die metabolische und funktionale Dynamik mikrobieller Gemeinschaften nach Fungizid Anwendung besser zu charakterisieren, kompletten Genoms von Pollen Microbiome notwendig.

Käfig-Experimente mit im Handel erworbenen Nesselsucht bieten eines der besten Rahmenbedingungen um Antwortvariablen in einer semi-kontrollierten Umgebung zu messen. Verursacht minimale Änderung der Bienen natürlichen Ökologie (Futtersuche Effizienz, Sozialstruktur, Nachkommen Pflege), Käfig Experimente minimieren, die Erfindung und Stress, eingeführt durch die künstliche Umgebung und manuelle Handhabung im Labor-basierte Experimente.

Nach bestem Wissen und Gewissen hat noch keine Studie durchgeführt, um Bewertung der Auswirkungen von Fungiziden auf mikrobielle Gemeinschaft Dynamik innerhalb der Pollen-Bereitstellung von Hummeln. Exposition gegenüber Fungiziden kann eine oder mehrere gefährdete Arten, stören den ökologische Waffenstillstand zwischen Pilzen und Bakterien beseitigen. Mit Feld und Labor-basierten Studien als ein Schmelztiegel dieser Interaktionen spielen, soll diese Studie zeigen, dass die Vernichtung der ansässigen mikrobielle Spezies das ökologische Gleichgewicht der Pollen Microbiome pervertieren kann die Bienengesundheit Kompromiss wiederum kann.

Kultur-abhängige Techniken wie Verdünnung und Beschichtung auf Standardmedien erfassennur ein Bruchteil der Mikroflora aus einer bestimmten Umgebung. Dies kann zu einer groben Unterrepräsentierung der mikrobiellen Diversität, und unculturable Mikroben können unentdeckt51gehen. Um die Breite der Mikroorganismen zu studieren, müssen Wissenschaftler auf kulturunabhängig Techniken, verlassen die integrativen und umfassenden, z.B. metagenomischen Analyse und Sequenzierung der nächsten Generation sind. Diese Studie soll zeichnen stark von dieser leistungsfähigen molekularen Methoden, höhere Auflösung in den Pollen Microbiome als traditionelle Kultur-basierte Techniken allein zu erhalten.

Ergebnisse aus dieser Studie ergaben sich profunde Verluste in der Zahl der Arbeitnehmer innerhalb von Bumble Bee Kolonien Fungizid ausgesetzt. Für eine Hummel Biene Kolonie um erfolgreich zu sein müssen die Arbeiter, ausreichende Ressourcen bereitzustellen und Pflege für die Mutter-Königin und besonders für die Entwicklung der Larven. Letztlich ist das Ziel der Kolonie Ressource erfassen (Pollen und Nektar) zu maximieren, so dass möglichst viele Tochter-Königinnen wie möglich vom Ende des Sommers hergestellt werden können. Gesunde Tochter-Königinnen sind das Maß der Eignung für eine Kolonie. Größere Reduktionen bei Arbeitern, dann effektiv unterbietet die Kolonie Fähigkeit, Königinnen für das folgende Jahr zu produzieren. In dieser Studie nicht nur wurden Arbeiter Zahlen deutlich gesenkt, aber die Mutter-Königinnen aus das Fungizid behandelt Bienenstöcke mit niedrigeren Biomasse, vermutlich durch unzureichende Versorgung mit Lebensmitteln durch die Nahrungssuchenden präsentiert. Angesichts der Komplexität der mikrobielle Wechselwirkungen innerhalb von Pollen-Bestimmungen, ist es schwer, die genaue interaktive Effekte zwischen Pilzen und Bakterien, die einen Beitrag zu dieser Muster zu erkennen. Jedoch Ergebnisse abgeleitet von replizierten und wiederholte Experimente wie hier beschrieben liefern wichtige Einblicke in die wechselnden Symbiosen zwischen diesen beiden mikrobiellen Gruppen (egal, ob es sich dabei um wettbewerbsfähig, mutualistische oder Kommensalen) in Reaktion auf Xenobiotika Stress und ihre nachgelagerten Auswirkungen auf die Pollen Microbiome.

Durch den Einsatz von leistungsfähigen molekulare Werkzeuge kann die ökologischen Komplexität der Pollen Microbiome besser gelöst werden. Das Vorverständnis offenbart eine Fülle von natürlich vorkommenden Bakterien und Pilzen, tragen gemeinsam zur Kolonie Fitness zu erhalten. Insbesondere sind die Hefen, die isoliert von Pollen-Bestimmungen wurden bekannt, bakterizide und fermentative Eigenschaften tragen, die beide entscheidend für die Entwicklung der Larven Bienen sind. Ökologische Vereinigungen sind ein hohes Maß an Mutualism zwischen Bienen und ihre Pollen Microbiome andeutend. Pollen-Bestimmungen, stellen daher eine emergente Vielfalt Wirkung, herbeigeführt durch den Anbau einer mikrobiellen Gemeinschaft bestehend aus funktionalen Schlüsselpositionen. In Ermangelung dieser wichtigsten Symbionten scheint die Pollen-Bereitstellung zu unbekannten Grad beeinträchtigt werden. Weiterarbeit in dieser Richtung wird wahrscheinlich erklären die Funktionsvielfalt dieser Mikroben und ihre Rolle als Biene Symbionten zu entlarven.

Neuere Forschung hat den Begriff der Fungizide als unschädlich für Bienen19,24,52,53,54entlarvt. Das Ziel dieser Forschung ist es, die Mechanismen fahren Fungizid Auswirkungen auf Bienen, damit beleuchtet die Ursache-Wirkungs-Beziehung zwischen Fungizid Einsatz und Biene Rückgänge zu isolieren. Die Hypothesen Zentrum rund um das Konzept, dass Biene-Mikrobe Symbiosen sind deutlich durch Fungizid Rückstände Pollen geändert wird. Letztlich wird diese Arbeit erneut Rahmen wie Fungizide sind angesehen und in der Landwirtschaft und städtischen Umgebungen verwendet. Vor dem Hintergrund der aktuellen Krise der globalen Bestäuber erzeugt Forschungsvorhabens neues Wissen über einheimische Biene Ökologie, im Zusammenhang mit landwirtschaftlichen Produktionsverfahren. Fungizide bleiben die letzten Agrochemie-Gruppe effektiv von Vorschriften, die Begrenzung der Anwendungen zu Pflanzen während der Blüte ausgenommen werden. Infolgedessen sind sowohl verwaltete als auch wilde Bienen konsequent Fungizide ausgesetzt. Eine wachsende Zahl von Literatur legt nahe, dass Fungizide sind zwar nicht tödlich für Bienen auf Kontakt, bei erhöhten Dosen, Belichtung ziemlich schädlich ist, führt zu höheren larval Sterblichkeit21 und Sammler Verhalten verändert. Es wird erwartet, dass diese Arbeit die Mechanismen leuchtet durch die Fungizide Bestäuber schaden. Darüber hinaus wird dieser Forschung bilden die Grundlage für klüger Pest Managementpolitik und Züchter von best Management Practices informieren. Diese Arbeiten werden auch maßgeblich bei der Bereitstellung von Leitlinien für verbesserte Pestizide Spritzen, die Pestizid-Gesetze und Vorschriften beeinflussen können. Ganz allgemein werden diese Ergebnisse relevant für alle verwalteten Ökosystem in der blühenden Pflanzen von Pollen sammelnden besucht werden Insekten. Mit globalen Schätzungen der Biene-spezifische Bestäubung Dienstleistungen, außerordentlich hohe55,56, wenn diese Arbeit den Rückgang der Bienenvölker mildern, die möglichen Auswirkungen erheblich sein.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren haben nichts preisgeben.

Acknowledgments

Die Autoren danken der University of Wisconsin Biotechnologie Center DNA Sequenzierung Anlage für Bereitstellung Amplifikation und Sequenzierung Einrichtungen und Dienstleistungen, Caitlin Carlson, Jennifer Knack, Jake Otto und Max Haase für die Bereitstellung technischen Hilfe molekulare Analyse. Diese Arbeit wurde von USDA-Agricultural Research Service angeeignet Mittel (aktuelle Research Information System #3655-21220-001) unterstützt. Weiterer Unterstützung wurde von der National Science Foundation (unter Grant Nr. bereitgestellt. Deb-1442148), DOE Great Lakes Bioenergy Research Center (DOE Office of Science BER DE-FC02-07ER64494), und der USDA National Institute of Food und Landwirtschaft (Luke Projekt 1003258). C.T.H. ist ein Pew Gelehrter in den biomedizinischen Wissenschaften und ein Alfred Toepfer Faculty Fellow, bzw. von der Pew Charitable Trusts und der Alexander von Humboldt-Stiftung unterstützt.

Materials

Name Company Catalog Number Comments
Natupol Beehive Koppert USRESM1 16 hives
Propiconazole 14.3 Quali-Ppro 60207-90-1 Propiconazole 14.3%
Abound Syngenta 4033540 Azoxystrobin 22.9%
Chlorothalonil Syngenta 3452 Fungicide used for trials
Pollen granules Bee rescued B004D5650C 3X 16oz bottles, pollen for trials
Bacterial strains for inoculation Currie Lab
Yeast strains for inoculation Hittinger lab
Primer pairs UW Biotech Center
DNA Isolation Kit Mo Bio 12830-50 Commercial DNA isolation kit
Qubit dsDNA HS Assay Kit Thermo Fisher Q32851 DNA quantification tool
Select Master Mix for CFX Thermo Fisher 4472952 Used to perform real-time PCR using SYBR GreenER dye.
Real-Time PCR Detection System Bio Rad 1855196 Instrument used for PCR amplification
PCR Clean-Up Kit, Axygen 10159-696 Used for efficient removal of unincorporated dNTPs, salts and enzymes
DNA 1000 Kit Agilent 5067-1504 Used for sizing and analysis of DNA fragments
MiSeq Sequencer Illumina Used for next-generation sequencing
Assorted glassware (beaker, flasks, pipettes, test tubes, repietters) VWR

DOWNLOAD MATERIALS LIST

References

  1. Potts, S. G., Biesmeijer, J. C., Kremen, C., Neumann, P., Schweiger, O., Kunin, W. E. Global pollinator declines: Trends, impacts and drivers. Trends Ecol Evolut. 25, (6), 345-353 (2010).
  2. Vanengelsdorp, D., Meixner, M. D. A historical review of managed honey bee populations in Europe and the United States and the factors that may affect them. J Invertebr Pathol. 103, Suppl 1. S80-S95 (2010).
  3. Ellis, J. D., Evans, J. D., Pettis, J. Colony losses, managed colony population decline, and Colony Collapse Disorder in the United States. J. Apic. Res. 49, (1), 134-136 (2010).
  4. Vanbergen, A. J. Insect Pollinators Initiative. Threats to an ecosystem service: pressures on pollinators. Front Ecol Environ. 11, (5), 251-259 (2013).
  5. Cameron, S. A., et al. Patterns of widespread decline in North American bumble bees. Proc. Natl. Acad. Sci. U.S.A. 108, (2), 662-667 (2011).
  6. Szabo, N. D., Colla, S. R., Wagner, D. L., Gall, L. F., Kerr, J. T. Do pathogen spillover, pesticide use, or habitat loss explain recent North American bumblebee declines? Conser Lett. 5, (3), 232-239 (2012).
  7. Klein, A. -M., et al. Importance of pollinators in changing landscapes for world crops. Proc R Soc Lond [Biol]. 274, (1608), 303-313 (2007).
  8. Sánchez-Bayo, F., Goulson, D., Pennacchio, F., Nazzi, F., Goka, K., Desneux, N. Are bee diseases linked to pesticides? - A brief review. Environ Int. 89, 7-11 (2016).
  9. Kwong, W. K., Moran, N. A. Gut microbial communities of social bees. Nature Rev. Microbiol. 14, (6), 374-384 (2016).
  10. Engel, P., et al. The Bee Microbiome: Impact on Bee Health and Model for Evolution and Ecology of Host-Microbe Interactions. mBio. 7, (2), e02164-e02115 (2016).
  11. Henry, M., et al. A common pesticide decreases foraging success and survival in honey bees. Science. 336, (6079), New York, N.Y. 348-350 (2012).
  12. Pettis, J. S., vanEngelsdorp, D., Johnson, J., Dively, G. Pesticide exposure in honey bees results in increased levels of the gut pathogen Nosema. Die Naturwissenschaften. 99, (2), 153-158 (2012).
  13. Williamson, S. M., Wright, G. A. Exposure to multiple cholinergic pesticides impairs olfactory learning and memory in honeybees. J. Exp. Biol. 216, (10), 1799-1807 (2013).
  14. Artz, D. R., Pitts-Singer, T. L. Effects of fungicide and adjuvant sprays on nesting behavior in two managed solitary bees, Osmia lignaria and Megachile rotundata. PLoS ONE. 10, (8), (2015).
  15. Johnson, R. M., Wen, Z., Schuler, M. A., Berenbaum, M. R. Mediation of Pyrethroid Insecticide Toxicity to Honey Bees (Hymenoptera: Apidae) by Cytochrome P450 Monooxygenases. J. Econ. Entomol. 99, (994), 1046-1050 (2006).
  16. Pilling, E. D., Bromleychallenor, K. A. C., Walker, C. H., Jepson, P. C. Mechanism of synergism between the pyrethroid insecticide lambda-cyhalothrin and the imidazole fungicide prochloraz, in the honeybee (Apis mellifera L). Pest Biochem Physiol. 51, (1), 1-11 (1995).
  17. Iwasa, T., Motoyama, N., Ambrose, J. T., Roe, R. M. Mechanism for the Differential Toxicity of Neonicotinoid Insecticides in the Honey Bee Mechanism for the differential toxicity of neonicotinoid insecticides in the honey bee, Apis mellifera. Crop Protection. (2016).
  18. Mullin, C. A., et al. High levels of miticides and agrochemicals in North American apiaries: implications for honey bee health. PLoS One. 5, (3), e9754 (2010).
  19. Pettis, J. S., Lichtenberg, E. M., Andree, M., Stitzinger, J., Rose, R., Vanengelsdorp, D. Crop pollination exposes honey bees to pesticides which alters their susceptibility to the gut pathogen Nosema ceranae. PLoS One. 8, (7), e70182 (2013).
  20. David, A., et al. Widespread contamination of wildflower and bee-collected pollen with complex mixtures of neonicotinoids and fungicides commonly applied to crops. Environ Int. 88, 169-178 (2016).
  21. Zhu, W., Schmehl, D. R., Mullin, C. A., Frazier, J. L. Four common pesticides, their mixtures and a formulation solvent in the hive environment have high oral toxicity to honey bee larvae. PLoS One. 9, (1), e77547 (2014).
  22. Simon-Delso, N., Martin, G. S., Bruneau, E., Minsart, L. A., Mouret, C., Hautier, L. Honeybee colony disorder in crop areas: The role of pesticides and viruses. PLoS ONE. 9, (7), (2014).
  23. Park, M. G., Blitzer, E. J., Gibbs, J., Losey, J. E., Danforth, B. N. Negative effects of pesticides on wild bee communities can be buffered by landscape context. Proc R Soc Lond [Biol]. 282, (1809), (2015).
  24. van Engelsdorp, D., et al. "Entombed Pollen": A new condition in honey bee colonies associated with increased risk of colony mortality. J Invertebr Pathol. 101, (2), 147-149 (2009).
  25. Bernauer, O. M., Gaines-Day, H. R., Steffan, S. A. Colonies of bumble bees (Bombus impatiens) produce fewer workers, less bee biomass, and have smaller mother queens following fungicide exposure. Insects. 6, (2), 478-488 (2015).
  26. Tu, C. M. Effect of fungicides, captafol and chlorothalonil, on microbial and enzymatic activities in mineral soil. J Environ Sci Health B. 28, (B28), 67-80 (1993).
  27. Huang, C. -Y., Ho, C. -H., Lin, C. -J., Lo, C. -C. Exposure effect of fungicide kasugamycin on bacterial community in natural river sediment. J Environ Sci Health B. 45, (5), 485-491 (2010).
  28. Artigas, J., et al. Effects of the fungicide tebuconazole on microbial capacities for litter breakdown in streams. Aquat. Toxicol. 122, 197-205 (2012).
  29. Goerzen, D. W. Microflora associated with the alfalfa leafcutting bee, Megachile rotundata (Fab) (Hymenoptera: Megachilidae) in Saskatchewan, Canada. Apidologie. 22, (5), 553-561 (1991).
  30. Anderson, K. E., Sheehan, T. H., Eckholm, B. J., Mott, B. M., DeGrandi-Hoffman, G. An emerging paradigm of colony health: Microbial balance of the honey bee and hive (Apis mellifera). Insectes Sociaux. 58, (4), 431-444 (2011).
  31. Crotti, E., et al. Microbial symbionts of honeybees: a promising tool to improve honeybee health. N. Biotechnol. 30, (6), 716-722 (2013).
  32. Koch, H., Schmid-Hempel, P. Socially transmitted gut microbiota protect bumble bees against an intestinal parasite. Proc. Natl. Acad. Sci. U.S.A. 108, (48), 19288-19292 (2011).
  33. Anderson, K. E., et al. Microbial ecology of the hive and pollination landscape: bacterial associates from floral nectar, the alimentary tract and stored food of honey bees (Apis mellifera). PloS One. 8, (12), e83125 (2013).
  34. Evans, E. C., Spivak, M. Effects of Honey Bee (Hymenoptera: Apidae) and Bumble Bee (Hymenoptera: Apidae) Presence on Cranberry (Ericales: Ericaceae) Pollination. J Econ Entomol. 99, (3), 614-620 (2006).
  35. Goulson, D., et al. Can alloethism in workers of the bumblebee, Bombus terrestris, be explained in terms of foraging efficiency? Anim. Behav. 64, (1), 123-130 (2002).
  36. ThermoFisher Scientific. User Guide: Qubit dsDNA HS Assay Kits. Available from: https://tools.thermofisher.com/content/sfs/manuals/Qubit_dsDNA_HS_Assay_UG.pdf 3-6 (2010).
  37. Khadempour, L., LeMay, V., Jack, D., Bohlmann, J., Breuil, C. The Relative Abundance of Mountain Pine Beetle Fungal Associates Through the Beetle Life Cycle in Pine Trees. Microbial Ecol. 64, (4), 909-917 (2012).
  38. Dorn-In, S., Hölzel, C. S., Janke, T., Schwaiger, K., Balsliemke, J., Bauer, J. PCR-SSCP-based reconstruction of the original fungal flora of heat-processed meat products. Int J Food Microbiol. 162, (1), 71-81 (2013).
  39. Klindworth, A., et al. Evaluation of general 16S ribosomal RNA gene PCR primers for classical and next-generation sequencing-based diversity studies. Nucleic Acids Res. 41, (1), (2013).
  40. White, T., Bruns, T., Lee, S., Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR protocols: a guide to methods and applications. 18, (1), 315-322 (1990).
  41. Illumina. 16S Metagenomic Sequencing Library Preparation: Preparing 16S Ribosomal RNA Gene Amplicons for the Illumina MiSeq System. Available from: http://ngs.biodiv.tw/NGSCore/wp-content/uploads/Documents/16s-metagenomic-library-prep-guide-15044223-b.pdf (2017).
  42. Kõljalg, U., et al. Towards a unified paradigm for sequence-based identification of fungi. Mol Ecol. 22, (21), 5271-5277 (2013).
  43. Wang, Q., Garrity, G. M., Tiedje, J. M., Cole, J. R. Naïve Bayesian Classifier for Rapid Assignment of rRNA Sequences into the New Bacterial Taxonomy. Appl. Environ. Microbiol. 73, (16), 5261-5267 (2007).
  44. Team, R. C. R: A language and environment for statistical computing [Computer software]. R Foundation for Statistical Computing. Vienna, Austria. (2015).
  45. Kaltenpoth, M., Engl, T. Defensive microbial symbionts in Hymenoptera. Funct Ecol. 28, (2), 315-327 (2014).
  46. Gerth, M., Saeed, A., White, J. A., Bleidorn, C. Extensive screen for bacterial endosymbionts reveals taxon-specific distribution patterns among bees (Hymenoptera, Anthophila). FEMS Microbiol Ecol. 91, (6), (2015).
  47. Smith, C. J., Osborn, A. M. Advantages and limitations of quantitative PCR (Q-PCR)-based approaches in microbial ecology. FEMS Microbiol Ecol. 67, (1), 6-20 (2009).
  48. Kim, M., Morrison, M., Yu, Z. Evaluation of different partial 16S rRNA gene sequence regions for phylogenetic analysis of microbiomes. J Microbiol Methods. 84, (1), 81-87 (2011).
  49. DeSantis, T. Z., et al. Greengenes, a Chimera-Checked 16S rRNA Gene Database and Workbench Compatible with ARB. Appl. Environ. Microbiol. 72, (7), 5069-5072 (2006).
  50. Langille, M. G. I., et al. Predictive functional profiling of microbial communities using 16S rRNA marker gene sequences. Nature Biotechnol. 31, (9), 814-821 (2013).
  51. Malik, S., Beer, M., Megharaj, M., Naidu, R. The use of molecular techniques to characterize the microbial communities in contaminated soil and water. Environ Int. 34, (2), 265-276 (2008).
  52. Ladurner, E., Bosch, J., Kemp, W. P., Maini, S. Assessing delayed and acute toxicity of five formulated fungicides to Osmia lignaria and Apis mellifera. Apidologie. 36, (3), 449-460 (2005).
  53. Huntzinger, C. I., James, R. R., Bosch, J., Kemp, W. P. Fungicide Tests on Adult Alfalfa Leafcutting Bees (Hymenoptera: Megachilidae). J Econ Entomol. 101, (4), 1088-1094 (2008).
  54. Gradish, A. E., Scott-Dupree, C. D., Shipp, L., Harris, C. R., Ferguson, G. Effect of reduced risk pesticides for use in greenhouse vegetable production on Bombus impatiens (Hymenoptera: Apidae). Pest Manag. Sci. 66, (2), 142-146 (2010).
  55. Calderone, N. W. Insect pollinated crops, insect pollinators and US agriculture: trend analysis of aggregate data for the period 1992-2009. PloS One. 7, (5), e37235 (2012).
  56. Ollerton, J., Winfree, R., Tarrant, S. How many flowering plants are pollinated by animals? Oikos. 120, (3), 321-326 (2011).
Empirische, metagenomischen und Computertechniken beleuchten die Mechanismen, durch welche Fungizide Kompromiss Bienengesundheit
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Steffan, S. A., Dharampal, P. S., Diaz-Garcia, L., Currie, C. R., Zalapa, J., Hittinger, C. T. Empirical, Metagenomic, and Computational Techniques Illuminate the Mechanisms by which Fungicides Compromise Bee Health. J. Vis. Exp. (128), e54631, doi:10.3791/54631 (2017).More

Steffan, S. A., Dharampal, P. S., Diaz-Garcia, L., Currie, C. R., Zalapa, J., Hittinger, C. T. Empirical, Metagenomic, and Computational Techniques Illuminate the Mechanisms by which Fungicides Compromise Bee Health. J. Vis. Exp. (128), e54631, doi:10.3791/54631 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter