Method Article

Dissection of Larval Zebrafish Gonadal Tissue

DOI:

10.3791/55294

April 26th, 2017

* These authors contributed equally

In This Article

Summary

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Here, we present a protocol for isolating gonadal tissue of larval zebrafish, which will facilitate investigations of zebrafish sex differentiation and maintenance.

Abstract

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Although wild zebrafish possess a ZZ/ZW sex-determination system, domesticated zebrafish have lost the sex chromosome. They utilize a polygenic sex determination system, where several genes distributed throughout the genome collectively determine the sex identities of individual fish. Currently, the genes involved in regulating gonad development and how they work remain elusive. Normally, isolating gonadal tissue is the first step to examine the sex developmental processes. Here, we present a procedure to isolate gonadal tissue from 17 dpf (days post fertilization) and 25 dpf zebrafish larvae. The isolated gonadal tissue may be subsequently examined by morphology and gene expression profiling.

Introduction

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The major female sex determinant in wild zebrafish chromosome 4 is lost or modified in the domesticated zebrafish (i.e. common lab strains)1. Instead, they have a polygenic sex determination system accompanied by environmental factors such as temperature, hypoxia, food availability and population density. The detailed mechanisms of zebrafish sex development are not fully understood. Fundamental questions such as when zebrafish sex determination occurs, what the primary sex determination signal(s) is/are, and which genes regulate the first step of gonad transformation remain to be answered2,3.

In the process of zebrafish sex development, several important stages have been recognized. In the early stage of development, starting from 4 hpf (hours post fertilization) primordial germ-cells (PGCs) undergo specification, migration to genital ridge and proliferation. PGC numbers and reciprocal interactions between germ cells and somatic cells are important for gonad differentiation4. At 13 dpf (days post fertilization), the gonads are in the undifferentiated stage. By 17 dpf, the gonads develop into bi-potential ovaries in both future females and males. The apoptosis-dependent transition from ovary to testis begin at 21 to 25 dpf and may continue for several weeks. By 35 dpf, the sex of the gonad has been determined and sex-specific gamete production is underway in both ovaries and testes5,6,7.

To date, diverse candidate genes and mechanisms of sex determination have been proposed. Proteomics and transcriptomic analysis have isolated many genes with sexually dimorphic expression and these genes have been utilized to study sex differentiation in zebrafish8,9,10. For example, in larval zebrafish, the cyp19a1a gene is specifically expressed in the ovary but not in the testis11,12. In addition, amh gene is weakly expressed in the ovarian follicle granulosa cells, but strongly in testis Sertoli cells13. In contrast, vasa gene is continuously expressed in the germ cells of both female and male zebrafish, making it a suitable gonad marker14,15.

Investigating gonadal gene expression levels is critical to understand the molecular mechanism of sex determination and differentiation especially in the bi-potential ovary stage3,9. However, the small size of larval zebrafish and correspondingly small gonads complicate the isolation of gonadal tissue for further molecular analysis. Previous studies used dissected whole trunk region between the opercula and anal pore16. This preparation, although containing gonads, consists of multiple tissues and organs. Alternatively, transgenic animals with gonad-specific GFP expression such as vasa: EGFP were used for gonadal tissue isolation via fluorescence activated cell sorting (FACS) and laser capture micro-dissection17,18. But their widespread application is limited. Here, we describe a simple procedure to isolate gonadal tissue from larval zebrafish at 17 dpf and 25 dpf. We demonstrate the position of the gonads with respect to other organs and isolate the morphologically intact gonads from the surrounding tissues. We further show the gonad-specific genes such as vasa and cyp19a1a are highly expressed in the isolated gonads compared with the trunk tissue through quantitative PCR (qPCR) analysis. The present protocol allows identification, isolation, RNA purification and amplification of gonadal specific genes from larval zebrafish, thereby enabling subsequent molecular analysis of gonadal tissue19.

Access restricted. Please log in or start a trial to view this content.

Protocol

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Zebrafish experiments were approved by the Fudan University Institutional Animal Care and Use Committee. Zebrafish were raised and bred according to standard procedures20.

1. Preparations

  1. Cultivate 17 dpf and 25 dpf larval zebrafish
    1. Transfer 2 male and 2 female adult zebrafish (healthy, 3 to 6 months old, laboratory AB strain) to a crossing tank in the late afternoon before the crossing day. Separate the males and females with a barrier. The next morning, refresh the tank water and remove the barrier to allow them to mate. Collect eggs in 100 mm Petri dishes 1 to 2 h after fertilization.
    2. Keep about 40 embryos in a 100 mm plate with 40 mL embryo medium (EM) at 28.5 °C during the early development period (4 days) and refresh the EM twice a day. Transfer larvae to 1 L tanks (40 larvae to 300 mL system water) and feed with live rotifers (full supply, twice a day) after 5 dpf. Feed live brine shrimp instead of rotifer diet after 10 dpf. Transfer the fish into re-circulating water system at 14 dpf21.
    3. Raise larval zebrafish in the re-circulating water system till 17 dpf or 25 dpf. Ensure the light/dark cycle is 14/10 h and pH value of system water is about 7.2. Measure the body length of 17 dpf (5.5 to 6.8 mm) and 25 dpf (8 to 11 mm) larvae22.
  2. Prepare 2% agar plates for the dissection.
    1. Add 4 g agar to 200 mL sterile water. Heat the mixture in a microwave oven until it turns transparent.
    2. Cool the agar solution for about 15 min, then pour it into 60 mm diameter Petri dishes (approximately 1/3 volume of the plate). Store the solidified agar plates at 4 °C.

2. Protocol 1: Dissect the Gonadal Tissue of 17 and 25 dpf Larvae

  1. Add crushed ice into the tank to anesthetize 17 dpf larvae. Transfer the anesthetized larvae to a 100 mm chilled Petri dish with 30 mL cold Ringer's solution. Keep the fish incubated in the chilled Ringer's solution for at least 15 min to fully anesthetize the larvae.
  2. Transfer the larvae to a precooled agar plate with a small plastic spoon. Submerge the entire fish body in 10 mL chilled Ringer's solution and gently lay it on its side.
  3. Do the following operations under the vision field of 25X stereo microscope. Clamp the fish trunk with tweezers for stabilization. Rip the abdomen longitudinally from the anus to the heart with another pair of tweezers. Gently remove the skin and muscles on one side of the body to expose the internal organs.
  4. Remove the mass of organs ventral to the swim bladder carefully. Avoid damaging the gonad attached to the swim bladder.
  5. Cut off the connection between the swim bladder and anterior body. Pull out the entire swim bladder and gonadal tissue gently.
    NOTE: In most cases, the gonadal tissue at 17 dpf contains surrounding epithelial tissue and protonephridium. They are not easily separated from each other, but at 25 dpf it can be easily separated. The gonad is also connected to the anus. A junction with left and right gonad connected to each other at the anus will be clearly visible.
  6. Use tweezers to carefully separate the gonadal tissue from the swim bladder and clean up the surrounding adipose tissues.
  7. Immediately transfer the isolated gonadal tissue to a prechilled 1.5 mL centrifuge tube containing 200 µL Ringer's solution. Keep the tube on ice until all gonadal tissues are separated from the larvae.
  8. Dissect the gonads of 25 dpf larvae as described in steps 2.1 -  2.7.

3. Protocol 2: Analyze Gene Expression of the Isolated Gonadal Tissues

  1. Extract total RNA from the larval gonadal tissues.
    1. Transfer the isolated gonadal tissues to a new RNase-free 1.5 mL tube and remove Ringer's solution. Add 100 µL lysis solution. Vortex until the tissues are completely lysed.
    2. Perform the total RNA extraction procedure according to the manufacturer's instructions.
    3. Add 1/10 volume of 10x DNase I buffer and 1 µL of DNase I to the RNA solution and mix gently. Incubate for 20 min at 37 °C.
    4. Add 1/10 volume DNase inactivation reagent to the RNA solution. Incubate for 10 min at 70 °C. Measure the concentration of the total RNA using a spectrophotometer. Store at -20 °C.
  2. Perform first-strand cDNA synthesis
    1. Use an oligo(dT)-linker primer to perform first-strand cDNA synthesis following the manufacture's protocol. Add 1 to 2 µg of RNA to a total reaction volume to 20 µL.
    2. Incubate the reaction solution for 90 min at 45 °C. Terminate the reaction by heating at 70 °C for 5 min.
    3. Add 1 µL RNase H to the cDNA solution to remove the residual RNA. Mix gently and centrifuge for 10 s at ~ 13,000 x g. Incubate for 20 min at 37 °C. Add 20 µl nuclease free water. Store at -70 °C.
  3. Perform fluorescent quantitative PCR
    1. Perform qPCR on a cycler system with a fluorescent dye. Use the following PCR cycling conditions: 35 cycles at 95 °C for 15 s, Tm-5 °C for 15 s, 68 °C for 30 s. Use primer sequences as follows: amh (fwd: GTGGATGGCAGCAGTACGAC; rev: GCGGAGAGGTGGAAGAGAGAATG), cyp19a1a (fwd: GTCCTGTTGTCTCCTACTGTCG; rev: CATTTGAGTTGAATATGATGCCCTG), nanos3 (fwd: GCTCGGTGTACGCCAAATCAACAT; rev: CCAAGTGAAAACACAACACCAGTGC), vasa (fwd: ATCGCATAGGAAGAACTGGACGCT; rev: CCAAGTGAAAACACAACACCAGTGC) and β-actin (fwd: AGTGCGACGTGGACATCCGTA; rev: GCACTTCCTGTGGACGATGGA)19.

Access restricted. Please log in or start a trial to view this content.

Results

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Dissections of the gonads were performed on AB strain larval zebrafish. Figure 1 shows typical gonadal tissue of larval zebrafish at 17 dpf and 25 dpf. Firstly, the skin and muscles of one side of the abdomen is cut to expose the internal organs. After removing the mass of internal organs, the swim bladder together with the gonad remain in the trunk. The gonad was attached to the ventral side of swim bladder (arrow in Figure 1B

Access restricted. Please log in or start a trial to view this content.

Discussion

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The zebrafish has become a powerful model and is extensively used in development and disease-related research. The methods for isolation of organs in adult zebrafish such as brain, heart, gonad, and kidney, have been well documented23,24,25. Due to the small size and dynamic remodeling of the gonadal tissues in the larval zebrafish, isolation of gonadal tissue is a challenging task. Previous studies used whole dissected trunk ti...

Access restricted. Please log in or start a trial to view this content.

Disclosures

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The authors declare that they have no competing financial interests.

Acknowledgements

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

We thank C Zhang for fish care. This work was supported by the National Natural Science Foundation of China (31171074, 31371099 and 31571067 to GP) and by the Pujiang Talent Project (09PJ1401900 to GP).

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
Cell culture dish 100 mmCorning430167For embryo incubation
20x EMFor a 1 L needed: add 17.5 g NaCl, 0.75 g KCl and 2.9 g CaCl·2H2O; then add 0.41 g KH2PO4, 0.412 g Na2HPO4 anhydrous and 4.9 g MgSO4·7H2O.
1x EMDilute 20x EM in distilled water
AGAROSE G-10Gene121985For preparing the 2% agar plates
Trizol ReagentInvitrogen15596-026For RNA isolation
Meter glassShen Bo250 mlFor preparing the 2% agar plates
Microwave OvenMideaM1-211AFor heating the AGAR
Tweezer DUMONT#5INOXWorld Precision Instrument500341For dissection
StereomicroscopeMoticSMZ168For dissection
Pure water equipmentMillipore
Ringer’s solutionFor a 1 L needed: Add 6.78 g NaCl, 0.22 g KCl, 0.26 g CaCl2 and 1.19 g Hepes; then fill to 1 L; Adjust pH to 7.2. Sterilize by filtration and keep in an autoclaved clear polycarbonate container.
Transfer pipetteSamco202, 204
Metal bathQiLinbeierModel GL-150
MicroscopeLeica M205 FAFor photomicrograph
CentrifugeEppendorf5417R
Micro Scale RNA Isolation KitAmbionAM1931For RNA isolation from gonad tissues
Dnase ISigmaAMPD1-1KTFor DNA digestion in the RNA solution
RevertAid First Strand cDNA Synthesis KitThermo Scientific#K1631For first-strand cDNA synthesis
Rnase HThermo Scientific#EN0202For digesting the residual RNA in the cDNA solution.
SYBR Green Realtime PCR Master MixTOYOBOQPK-201This product is a Taq DNA polymerase-based 2x master mix for real-time PCR and  applicable for intercalation assay with SYBR Green I.
SpectrophotometerNe DropOD-2000+Measuring the concentration of the total RNA
MastercyclerEppendorfAG 22331 Hamburggene expression profiling

References

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,
  1. Wilson, C. A., et al. Wild sex in zebrafish: loss of the natural sex determinant in domesticated strains. Genetics. 198 (3), 1291-1308 (2014).
  2. Liew, W. C., Orban, L. Zebrafish sex: a complicated affair. Genomics. 13 (2), 172-187 (2014).
  3. Orban, L., Sreenivasan, R., Olsson, P. Long and winding roads: Testis differentiation in zebrafish. Mol. Cell. Endocrinol. 312 (1-2), 35-41 (2009).
  4. Blaser, H., et al. Transition from non-motile behaviour to directed migration during early PGC development in zebrafish. J. Cell Sci. 118, 4027-4038 (2005).
  5. Wang, X. G., Orban, L. Anti-Müllerian hormone and 11 β-hydroxylase show reciprocal expression to that of aromatase in the transforming gonad of zebrafish males. Dev. Dynam. 236 (5), 1329-1338 (2007).
  6. Siegfried, K. R., Nüsslein-Volhard, C. Germ line control of female sex determination in zebrafish. Dev. Biol. 324 (2), 277-287 (2008).
  7. Uchida, D., Yamashita, M., Kitano, T., Iguchi, T. Oocyte apoptosis during the transition from ovary-like tissue to testes during sex differentiation of juvenile zebrafish. J. Exp. Biol. 205 (Pt 6), 711-718 (2002).
  8. Groh, K. J., Schönenberger, R., Eggen, R. I. L., Segner, H., Suter, M. J. F. Analysis of protein expression in zebrafish during gonad differentiation by targeted proteomics. Gen. Comp. Endocr. 193, 210-220 (2013).
  9. Siegfried, K. R. In search of determinants: gene expression during gonadal sex differentiation. J. Fish Biol. 76 (8), 1879-1902 (2010).
  10. Small, C. M., Carney, G. E., Mo, Q., Vannucci, M., Jones, A. G. A microarray analysis of sex- and gonad-biased gene expression in the zebrafish: evidence for masculinization of the transcriptome. BMC Genomics. 10, 579(2009).
  11. Chiang, E. F., Yan, Y. L., Guiguen, Y., Postlethwait, J., Chung, B. Two Cyp19 (P450 aromatase) genes on duplicated zebrafish chromosomes are expressed in ovary or brain. Mol. Biol. Evol. 18 (4), 542-550 (2001).
  12. Kishida, M., Callard, G. V. Distinct cytochrome P450 aromatase isoforms in zebrafish (Danio rerio) brain and ovary are differentially programmed and estrogen regulated during early development. Endocrinology. 142 (2), 740-750 (2001).
  13. Rodríguez-Marí, A., et al. Characterization and expression pattern of zebrafish anti-Müllerian hormone (amh) relative to sox9a, sox9b, and cyp19a1a, during gonad development. Gene Expr.Patterns. 5 (5), 655-667 (2005).
  14. Krovel, A. V., Olsen, L. C. Expression of a vas::EGFP transgene in primordial germ cells of the zebrafish. Mech Dev. 116 (1-2), 141-150 (2002).
  15. Krovel, A. V., Olsen, L. C. Sexual dimorphic expression pattern of a splice variant of zebrafish vasa during gonadal development. Dev. Biol. 271 (1), 190-197 (2004).
  16. Tzung, K. W., et al. Early depletion of primordial germ cells in zebrafish promotes testis formation. Stem Cell Reports. 4 (1), 61-73 (2015).
  17. Hsiao, C., Tsai, H. Transgenic zebrafish with fluorescent germ cell: a useful tool to visualize germ cell proliferation and juvenile hermaphroditism in vivo. Dev. Biol. 262 (2), 313-323 (2003).
  18. Jorgensen, A., Nielsen, J. E., Morthorst, J. E., Bjerregaard, P., Leffers, H. Laser capture microdissection of gonads from juvenile zebrafish. Reprod Biol Endocrinol. 7, 97(2009).
  19. Chen, S., Zhang, H., Wang, F., Zhang, W., Peng, G. nr0b1 (DAX1) mutation in zebrafish causes female-to-male sex reversal through abnormal gonadal proliferation and differentiation. Mol. Cell. Endocrinol. 433, 105-116 (2016).
  20. Westerfield, M. The Zebrafish Book: A Guide for The Laboratory Use of Zebrafish (Danio rerio). , Eugene: University of Oregon Press. University of Oregon. (2000).
  21. Liew, W. C., et al. Polygenic sex determination system in zebrafish. PLoS One. 7 (4), e34397(2012).
  22. Parichy, D. M., Elizondo, M. R., Mills, M. G., Gordon, T. N., Engeszer, R. E. Normal table of postembryonic zebrafish development: staging by externally visible anatomy of the living fish. Dev Dyn. 238 (12), 2975-3015 (2009).
  23. Gupta, T., Mullins, M. C. Dissection of Organs from the Adult Zebrafish. J. Vis Exp. (37), (2010).
  24. Arnaout, R., Reischauer, S., Stainier, D. Y. R. Recovery of Adult Zebrafish Hearts for High-throughput Applications. J. Vis Exp. (94), (2014).
  25. Gerlach, G. F., Schrader, L. N., Wingert, R. A. Dissection of the Adult Zebrafish Kidney. J. Vis Exp. (54), (2011).
  26. Yoon, C., Kawakami, K., Hopkins, N. Zebrafish vasa homologue RNA is localized to the cleavage planes of 2- and 4-cell-stage embryos and is expressed in the primordial germ cells. Development. 124 (16), 3157-3165 (1997).
  27. Braat, A. K., Speksnijder, J. E., Zivkovic, D. Germ line development in fishes. Int. J. Dev. Biol. 43 (7), 745-760 (1999).
  28. Huang, H. Y., Ketting, R. F. Isolation of zebrafish gonads for RNA isolation. Methods Mol Biol. 1093, 183-194 (2014).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Tags

Zebrafish Gonadal TissueLarval Zebrafish DissectionGonadal Tissue IsolationZebrafish Sex DevelopmentGonad Marker AnalysisRNA Extraction ProtocolQPCR Gene ExpressionStereomicroscope DissectionAgar Plate PreparationRinger s Solution

Related Articles