Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Meksika Cavefish işlevinde Gene manipülasyon

doi: 10.3791/59093 Published: April 22, 2019

Summary

Evrimsel modeli sistem Astyanax mexicanusgenler manipülasyon yaklaşımları açıklar. Üç farklı teknikler açıklanmıştır: Tol2-aracılı transgenesis, CRISPR/Cas9 ve nakavt morpholinos kullanarak ifade kullanarak genom hedeflenen manipülasyon. Bu araçları doğrudan soruşturma yüzey ve mağaralarda yaşayan biçimler arasında varyasyon yatan genlerin kolaylaştıracaktır.

Abstract

Mağara hayvanlar evrimsel mekanizmaları ve göz dejenerasyon, albinizm, uyku kaybı, hyperphagia ve duyusal işleme de dahil olmak üzere çok sayıda karmaşık özellikleri değişiklikleri altta yatan genetik Üsler araştırıyor için zorlayıcı bir sistemi sağlar. Dünyanın dört bir yanından cavefish türün morfolojik ve davranışsal özelliklerin farklı mağara sistemleri arasında paylaşılan çevresel baskılar nedeniyle bir yakınsak evrim görüntüler. Çeşitli mağara tür laboratuvar ortamında inceledik. Meksika tetra, Astyanax mexicanus, kör ve görme biçimleri, karmaşık özellikleri evrimi temel biyolojik ve moleküler süreçlerini benzersiz anlayışlar sağlamıştır ve gelişmekte olan bir modeli sistemi olarak iyi hazır. Farklı biyolojik süreçlerin evrimi düzenleyen aday genler A. mexicanus tespit edilen süre, bir rol bireysel genler için doğrulamak için yeteneği sınırlandırılmış durumda. Transgenesis ve gen düzenleme teknoloji uygulanması önemli bu engeli aşmak için ve karmaşık özellikleri evrimi temel mekanizmaları incelemek için potansiyele sahiptir. Burada, A. mexicanusgen ifade değiştirmek için farklı bir metodoloji açıklayın. Morpholinos, Tol2 transgenesis, kullanımı bir yaklaşım içerir ve gen düzenleme sistemleri, yaygın olarak kullanılan Zebra balığı ve diğer balık modelleri, A. mexicanusişlevinde gen işlemek için. Bu protokollerin ayrıntılı açıklamalar için zamanlanmış üreme yordamlar, döllenmiş yumurta, iğne ve genetiği değiştirilmiş hayvanlar yelpazesi topluluğu içerir. Bu yöntembilimsel yaklaşımlar çeşitli özellikleri A. mexicanusevrimi altta yatan genetik ve sinirsel mekanizmalar incelenmesi için izin verir.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Darwin'in Türlerin kökeni1beri bilim adamları nasıl özellikleri örümceklerle yanıt olarak tanımlanan çevre ve ekolojik baskılar, mağara organizmalar2sayesinde şeklinde içine derin anlayışlar kazandı. Nehirler boyunca Meksika ve Güney Teksas yaşayan gözlü atalarının 'yüzey' nüfus ve coğrafi olarak izole olasılığını en az 29: Sierra del Abra yaşayan türetilen mağara morphs Meksika tetra, A. mexicanus, oluşur ve diğer alanlarda kuzeydoğu Meksika3. Mağara ilişkili özellikleri bir dizi de dahil olmak üzere değiştirilmiş oksijen tüketimi, depigmentasyon, gözleri kaybı ve beslenme ve davranış4,5,6yiyecek arama değişmiş A. mexicanusiçinde tespit edilmiştir, 7,8,9. A. mexicanus sunar iyi tanımlanmış bir evrimsel geçmişi, ekolojik çevre detaylı karakterizasyonu ve varlığı nedeniyle yakınsak evrim mekanizmaları bağımsız soruşturma için güçlü bir model mağara gelişti nüfus10,11. Birçok göz kaybı da dahil olmak üzere cavefish içinde bulunması, kaybı uyku, beslenme, okul kaybı arttı, saldırganlık, azaltılmış ve stres yanıt azaltılmış, birden çok kez kez kullanan bağımsız kökenleri ile geliştiğini mağara kaynaklı özellikleri farklı genetik yolları arasında8,12,13,14,15mağaralar. Bu evrim A. mexicanus sistemi, güçlü bir yönüdür ve daha genel bir soru nasıl genetik sistemlerinin içgörü benzer fenotipleri oluşturmak için üzgün sağlayabilir tekrar.

Gen fonksiyonu mekanik incelenmesi için genetik teknolojisi uygulama ( A. mexicanusde dahil olmak üzere) birçok balık türlerinin sınırlı iken, Zebra balığı son gelişmeler genetik teknoloji geliştirme balık için bir temel sağlar 16,17,18,19,20. Çok sayıda araç içinde Zebra balığı gen ekspresyonu işlemek için yaygın olarak kullanılan ve bu yordamları uygulanması uzun standart hale. Örneğin, morpholino oligos (MOs) enjeksiyon tek hücreli aşamada seçerek RNA engeller ve geliştirme21,22sırasında kısa bir zamansal pencere için çeviri engeller. Buna ek olarak, yaklaşımlar, gen düzenleme gibi düzenli olarak kümelenmiş interspaced kısa palindromik yineler (CRISPR) / CRISPR ilişkili protein 9 (Cas9) ve transkripsiyon harekete geçirmek gibi efektör nükleaz (TALEN), tanımlanmış silme üretimi için izin ya da bazı durumlarda, eklemeler bir rekombinasyon genleri19,20,23,24içinde aracılığıyla. Transgenesis kararlı gen ifade veya işlev bir hücre tipi belirli şekilde işlemek için kullanılır. Tol2 sistemi transposase coinjecting tarafından Transjenik hayvanlar oluşturmak için kullanıldığı ve etkili biçimde mRNA bir transgene25,26içeren bir Tol2 DNA plazmid ile. Tol2 sistemi medaka transgenik construct17 istikrarlı germline eklemeler oluşturmak için Tol2 transposase kullanır. Tol2 transgenics üreten Tol2 entegrasyon siteleri ve mRNA ile Tol2 transposase17için çekilmiş bir transgene içeren bir plazmid coinjecting içerir. Bu sistem içinde Zebra balığı transgenik çizgiler bir dizi oluşturmak için kullanılan ve kullanımı son zamanlarda cichlidleri, killifish, stickleback de dahil olmak üzere ek acil sistemleri modellemek için genişletti ve daha yakın zamanlarda, Meksika cavefish27, 28,29,30.

Cavefish özelliği evrim elucidating mekanizmaları için büyüleyici bir biyolojik sistem olmakla birlikte, tam kapasitesini evrimsel bir model olarak tamamen harnessed değil. Bu kısmen genetik işlemek için bir yetersizlik nedeniyle olmuştur ve hücresel işlev doğrudan31. Karmaşık özellikleri düzenleyen aday genler nicel özellik loci (QTL) çalışmaları kullanarak tespit edilmiştir, ama bu aday genler doğrulanmasını zor32,33,34oldu. Son zamanlarda, morpholinos, CRISPR ve TALEN sistemleri ve Tol2kullanımı kullanarak düzenleme gen kullanarak geçici nakavt-aracılı transgenesis özellikleri35,36,37 sayısı altta yatan genetik temeli araştırmak için kullanılmıştır ,38. Uygulama ve standardizasyon bu tekniklerin gen işlev tanımlı hücre nüfus, etiketleme, manipülasyon dahil olmak üzere biyolojik özellikleri, moleküler ve sinirsel temelleri sorguya manipülasyonlar için izin verir ve fonksiyonel gazeteciler ifade. Başarılı uygulama gen veya hücresel fonksiyon işlemek için bu genetik araçların acil modeli sistemlerinde gösterdi ise detaylı iletişim kuralları hala A. mexicanusiçinde eksik.

A. mexicanus yanıt olarak değişen ortamın evrim mekanizmaları kritik içgörü sağlamak ve yeni genlerin farklı özellikleri düzenleyen tanımlamak için fırsat sunuyoruz. Bir dizi faktöre A. mexicanus kurulan genomik araçları kolayca balık laboratuvarları, büyük damızlık boy korumak yeteneği de dahil olmak üzere kurulan genetik modellerinde, mevcut uygulamak için son derece uysal bir model olduğunu gösteriyor, şeffaflık, sıralı genom ve tanımlı davranış deneyleri39. Burada, morpholinos, transgenesis ve A. mexicanusyüzey ve mağara nüfus gen düzenleme kullanımı için bir metodoloji açıklayın. A. mexicanus bu araçların daha geniş uygulama cavefish ve yüzey balık gelişimsel, fizyolojik ve davranışsal farklılıkları evrimi temel moleküler süreçleri mekanik bir soruşturma için izin verir.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Morpholino oligo tasarım

Not: A. mexicanus dizileri Ensembl genom tarayıcı (https://www.ensembl.org) yanı sıra, ulusal biyoteknoloji Merkezi bilgi (NCBI) gen ve NCBI SRA (https://www.ncbi.nlm.nih.gov) aracılığıyla kullanılabilir. Bir morpholino kullanılmak üzere her iki yüzeyi ve mağaralarda yaşayan formu tasarlarken, bu aşamada, bu genetik bölgeleri olarak morpholinos için hedefler önlenebilir bu yüzden morphs arasında herhangi bir genetik varyasyon belirlemek için önemlidir. Morpholino hedef site içindeki herhangi bir Polimorfik varyasyon etkisiz bağlamaya yol açabilir. Tasarım, Zebra balığı gibi diğer balık sistemleri benzer ve daha önce A. mexicanus21,36,40. etkin bir şekilde çalışmak gösterilmiştir

  1. Çeviri-engelleme morpholinos tasarımı
    Not: Çeviri engelleme morpholinos endojen başlangıç sitesine bağlama tarafından çeviri engellemek ve steric hinderance aracılığıyla mRNA sıra bağlayıcı üzerinden translasyonel makine engel.
    1. ATG başlangıç sitesi ile başlayan hedef gen kodlayıcı bölge tanımlamak.
    2. Hedef dizinin ilk 25 baz çifti kopyalama ve yapıştırma tarafından sıralaması bir metin düzenleyicisi veya laboratuvar dizüstü kayıt oluşturun.
    3. Online yazılım (örneğin, http://reverse-complement.com) veya el ile çeviri kullanarak, hedef sırasının ters tamamlayıcı oluştur. Elde edilen ters tamamlayıcı bir metin düzenleyicisi veya laboratuvar defter kaydedin.
    4. Bir morpholino geriye doğru tamamlayıcı dizisi ile morpholino oligonucleotides üreten bir satın alın. Malzemeler tablo şirketlerin görmek.
  2. Ek yeri engelleme morpholinos tasarımı
    Not: Splice engelleme morpholinos'ın porno versiyonunu engellemek ve, böylece, bir olgun mRNA molekülünün oluşumunu önlemek. Nakavt Polimeraz zincir tepkimesi (PCR) ile doğrulama istendiğinde bu başlangıç siteler iyi tanımlanmış değildir zaman nakavt veya daha uygun bir yaklaşım için alternatif bir yöntem sağlar. Ek yeri engelleme morpholinos (PT ATG engelleme) üzerinde bu avantajı nedir o exon dışlama veya intron dahil kolayca ters transkriptaz (RT) ile değerlendirildi-PCR ve boyutu farklılıklar bir jel üzerinde görüntülenir. Morpholino etkinlik yapılması gereken belirlemek için RT-PCR ve Jel Elektroforez standart laboratuvar yordamları kullanarak.
    1. Hedef gen pre-mRNA sırasını tanımlayın. A. mexicanus genom intron exon sınırları33belirlemek için NCBI veya Ensembl ile mevcut bilgilerden yararlanın.
    2. EXoN-intron (splice donör) veya intron exon sınır (splice alıcısı) siteleri intron eklenmesi veya exon dışlama için hedef.
      Not: Spliceosome normalde 5' splice sitesinde intron ve '''' AG dizisi 3' (U2 hedef) intronic splice sitesinde "GU" sıra (U1 hedef) hedefler. Normal şartlar altında gerçekleşmesi için uygun boşluklarına ayıran pre-mRNA sıra bu hedef sitelerde spliceosome U1 ve U2 alt birimleri bağlamak. Eğer bir morpholino tarafından da bu hedef sıralarının engellenir, ancak, spliceosome siteye bir intron dışlama veya exon mRNA sırayla neden sonraki kullanılabilir U1 veya U2, devam edecek. Bu planlama/optimizasyon, hedef gen21niteliğine bağlı olarak içerecektir. Genellikle, bir iç U1 sitesi engelleme splice exon eksizyon neden sonraki kullanılabilir U1 sitesi için yeniden yönlendirir. Çünkü başka hiçbir site için ek yeri yeniden yönlendirmek için alternatif olarak, ilk veya son splice junction engelleme bir intron neden olur. Sıra yazılım kapanımlar karşı çeşitli istisnalar etkisini tahmin etmek için kullanın. Öngörüler potansiyel frameshifts veya erken kodon olarak mRNA bozulması için daha etkili bir hedef site gösteren işaret ediyor olabilir.
    3. Bir kez hedef site tanımlanır, bir metin düzenleyicisi veya laboratuvar kitapta kendi sırasını kaydedin. Hedef site 25 baz çifti (bp) uzun olduğundan emin olun.
    4. Online yazılım (örneğin, http://reverse-complement.com) veya el ile çeviri kullanarak, hedef sırasının ters tamamlayıcı oluştur. Bir metin düzenleyicisi veya laboratuvar kitapta kendi sırasını kaydedin.
    5. Bir morpholino geriye doğru tamamlayıcı dizisi ile morpholino oligonucleotides üreten bir satın alın. Malzemeler tablo örnek şirketlerin görmek.

2. enjeksiyon için Morpholinos

Not: Çeşitli konsantrasyonları veya MO enjeksiyon birimlerini enjekte için en iyi konsantrasyon kurmak için yapılması gerekecektir. Tipik enjeksiyonları miktarları 400-800 pg mo vardır Morpholino nakavt etkisi için 6 gün postinjection devam edebilir.

  1. Hisse senedi morpholino elde edilir. Hisse senedi morpholino lyophilized geldi. İstediğiniz hisse senedi toplama (örneğin, 4 mM) kullanmak için steril H2O önceki ile hidrat. -20 °C kullanmak kadar saklamak.

3. CRISPR gRNA tasarım, tüp bebek transkripsiyon ve hazırlık

  1. CRISPR gRNA tasarım
    Not: gRNAs daha önce yayınlanan araştırma kullanarak Varshney ve ark.40 ve Wierson ve ark.41tarafından üretildi.
    1. Genom tarayıcı, faiz gen kodlayıcı bölge tanımlayın. Genomik sırası kullanılarak 20 bp nükleotit hedef sıralama ile başlayan bir GG için arama yaparak gRNA hedef sıra bir exon içinde belirlemek ve PAM sırası (NGG) tarafından takip. Sonra Başlat (ATG) hedef olacak gen bölgesi.
      Not: GG ile bir hedef sıra 5' uç, gen, bir veya ikisinin g'istenen exon bulunamazsa s birinci ve ikinci nükleotit dizisinin 5' sonunda için yedek olabilir. Ancak, iki G's gerekir dahil oligo bu T7 transkripsiyon için gerekli olarak.
    2. Tasarım ve gene özgü Oligonükleotid sipariş (oligo A: 5'-TAATACGACTCACTATAGGNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGC-3'). PAM sıra T7 organizatörü dizisi (kırmızı) ve bir ikinci Oligonükleotid (mavi) tavlamak için kullanılan bir örtüşme sırası arasında olmadan gene özgü 20 bp gRNA hedef sırası (kalın) ekleyin. Tavlama ve (bkz. Adım 3.2.1) bu oligo A ve ikinci oligo yükseltmek (oligo B: 5'-GATCCGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTT AACTTGCTATTTCTAGCTCTAAAAC-3') transkripsiyon için kullanılan gRNA şablon oluşturmak için.
      Not: Oligo B her tepki için aynıdır ve sadece 1 x sipariş.
  2. gRNA hazırlık ve transkripsiyon
    1. Tavlama ve oligos yükseltmek. GRNA verim artışı için yükseltmek için aşağıdaki astar içerir: 5'-TAATACGACTCACTATA-3' (T7 astar) ve 5'-GATCCGCACCGACTCGGTG-3' (3' gRNA astar). Thermococcus kodakaraensis (KOD) polimeraz kullanarak bir PCR gerçekleştirin.
      Not: oligo A ve oligo B her iki astar için 10 döngüleri iyi bir verim için önerilir. Detaylı bir protokol Wierson vd.41yılında bulunabilir.
    2. Piyasada bulunan tüp bebek transkripsiyon kitleri ( Tablo malzemelerigörmek) kullanarak gRNA uyarlamak. Bu üretici'yapılan değişiklikler aracılığıyla yapılır s Protokolü Klaassen vd.42tarafından yayınlandı.
    3. Çökelti, yıkama ve gRNA Klaassen ve ark.42tarafından açıklandığı gibi resuspend.
      Not: GRNA suyun içinde RNase free yıkımı önlemek için resuspended gerekir.
    4. Kayıt bir Spektrofotometre kullanarak belirlenebilir gRNA konsantrasyonu. Üzerinde bir özel jel 2 µL çalıştırarak RNA kalitesini değerlendirmek. Aliquot RNA ve donma/çözülme önlemek için saklamak-80 °C kadar enjeksiyonlar hemen önce.
  3. Cas9 hazırlık ve transkripsiyon
    1. Cas9 mRNA transkripsiyonu (bkz. Tablo reçetesi) piyasada bulunan tüp bebek transkripsiyon Kitleri kullanarak daha önce43açıklandığı gibi. Nls-Cas9-nls sürüm43kullanın.
    2. GRNA konsantrasyonu kaydedebilir ve üzerinde bir özel jel 2 µL çalıştırarak kalitesini değerlendirmek. Birden çok donma-çözülme başlatıldıkları doğar, ve aliquots-80 °C. ayrışma önlemek için aliquot RNA

4. Tol2 yapıları, Tol2 transposase ve transgenesis hazırlanması

  1. Tol2 transgene yapıları enjeksiyon için hazır olun.
    Not: Biz başarıyla Yayınlandı/kullanılabilir Zebra balığı kullanılan ve A. mexicanusiçinde medaka oluşturur. Bu yapıları dizisi homoloji yüksek düzeyi nedeniyle büyük olasılıkla A. mexicanusiçinde tamamen işlevsel (AddGene deposuna bakın ve Zebra balığı bilgi ağı [ZFIN] için mevcut yapıları veritabanları). Zebra balığı organizatörü parçaları kullanıldığında beklenen dokularda transgenes belirttiler A. mexicanus.
    1. Tol2 yapıları elde etmek veya bir doku özgü organizatörü, istenen transgene ve Tol2 silah (bkz: Kwan vd.44) ile plazmid oluşturun. Aldıktan sonra sıra plazmid doğrulamak için bu seçeneği oluşturun.
    2. Bir midiprep'üreticiye göre yapıları için gerçekleştirmek s yönergeleri. Son plazmid RNase free H2O içinde elute, konsantrasyonu ile Spektrofotometre belirlemek, 100-konsantrasyonu seyreltik 300 ng /μL ve aliquot ve depo yapıları-20 °c
  2. Tol2 transposase plazmid sindirmek ve mRNA sentez.
    1. Tol2 mRNA45oluşturmak için şablon olarak Tol2 transposase plazmid (pCS-zT2TP) bir kopyasını edinin.
    2. Midiprep adet zT2TP üretici'göre s kurallar oluşturun. Düşük miktarda su RNase free veya arabellek (~ 50 μL) içinde elute. -20 °c de aliquots saklamak
    3. Restriksiyon enzimi kullanarak Tol2 plazmid sindirmek.
      1. Bir kısıtlama Özet Tablo 1kullanarak dairesel pCS-zT2TP plazmid 10 µg üzerinde gerçekleştirin.
      2. Reaksiyon 2-50 μL tepkiler içine split ve gecede, 37 °C termal cycler içinde reaksiyonlar kuluçkaya.
      3. Ertesi gün, enzim tarafından Isıtma 65 °C 20 dk için devre dışı.
      4. Hemen ardından üreticileri' yönergeleri için piyasada bulunan PCR arıtma kitleri ( Tablo malzemelerigörmek) kullanarak Özet doğrusallaştırılmış plazmid arındırmak. Plazmid RNase free H2O 15 μL içinde elute ve bir Spektrofotometre kullanarak ürün konsantrasyonu belirlemek.
      5. Sindirilir plazmid 1 μL çalıştırın ve % 1.5 özel tarih kesilmemiş plazmid 1 μL jel doğrusallaştırılmış plazmid onaylamak için.
    4. Tol2 mRNA tüp bebek bir transkripsiyon gerçekleştirin.
      1. 1 µg doğrusallaştırılmış pCS-zT2TP plazmid transkripsiyon için bir şablon olarak kullanmak. Üreticinin'takip s yönergeleri için tüp bebek transkripsiyon ( Tablo 2' de açıklandığı gibi Malzemeler tablobakınız).
      2. 37 °C termal cycler üretici'başına içinde s yönergeleri kuluçkaya.
      3. Dnaz 1 µL eklemek, kuluçkaya 37 °C termal cycler üretici'başına içinde s yönergeleri.
      4. Lityum klorür yağış transkripsiyon kiti Protokolü başına gerçekleştirin. RNA Pelet ~ 20-30 μL RNase free H2O. içinde resuspend
      5. Bir Spektrofotometre kullanarak ürün konsantrasyonu belirlemek ve RNA Kalite kayıt.
      6. ~ 100 300 ng µL/-ve aliquot ürün seyreltik tekrarlanan donma-çözülme önlemek için 5-10 μL örnek içine. Onları-80 °C kullanmak kadar saklamak.
        Not: 1-kontrol etmek mümkündür 2 µL arıtılmış Tol2 mRNA smear/grup Jel Elektroforez ile için.

5. microinjections

  1. Enjeksiyon için genel araçları hazırlanması
    Not: Bu bölümdeki yordamları Kowalko vd.46tarafından ayrıntılı olarak tarif var ve küçük değişiklikler ile genel bir bakış burada sunulmuştur.
    1. Enjeksiyon plakaları dökerek sıcak %3 özel bir 100 mL Petri kabına balık sistem suda çözünmüş tarafından oluşturmak. Dikkatle kuyular Balık yumurtaları için yapmak için taze döktü özel bir yumurta enjeksiyon kalıp koyun. Kalıp yan agar 45° açıyla yerleştirin ve sonra yavaş yavaş özel düşürebilir; yavaş yavaş düşürücü bir açıyla kalıp kalıp altında kapana hava önler. Özel katılaşmış bir kez yavaşça kalıp çıkarın. Tabakları, mühürlü 4 °C ilâ 1 hafta saklanır.
    2. Çekme borosilikat cam kılcal bir elektrot/iğne çektirme'üreticiye göre enjeksiyon için gelen s yönergeleri iğneler. Bu iletişim kuralı pipet çektirme farklı olur; Ancak, bir örnek program iğne çekerek Tablo 3' te bulunabilir.
      Not: iğne en iyi duruma getirme uzun olan iğne eğmek yerine temiz bir şekilde yumurta nüfuz enjeksiyonlar için önemlidir.
    3. Geçişli büyük cam Pipetler yumurta transferi için açılış için yumurta büyük bu yüzden standart cam Pipetler kırarak olun. Bunsen burner kullanarak, kırık cam sonuna pürüzsüz hale gelinceye kadar aleve kırık Pipetler sonu açarak Lehçe.
  2. Üreme Kur
    Not: A. mexicanusıslahı için kullanılan birçok farklı protokoller vardır. Detaylı bir iletişim kuralı için bkz: Borowsky39. 1 hafta önce enjeksiyonları üreme Kurulum programını başlatın.
    1. 1 günde iki ya da üç kadın ve üç-dört erkek tutulan 24 ± 1 °C. bir tek 10 galon tank yerleştirin
    2. Gün 1-7, ~ 3 x bir gün için besleme artırın. Siyah solucanlar ve tuzlu su karides gibi canlı gıda diyet içerir emin olun.
    3. 6 gününde ayarla 27 °için C. tank sıcaklıklar değişebilir Lab bir tek tank ısıtıcı ekleyin; Bu nedenle, bu 2-3 °C göreceli olarak normal tank sıcaklık artış olacaktır.
    4. Enjeksiyon gece akşam (zeitgeber [ZT] 9-11) olduğunu, gün 7, akşam iyice suya batırılmış sünger ile tank temizleme ve aşırı yemek veya enkaz iyi kafes net kullanarak veya bir sifon kaldırın.
    5. 7. gün gecesi ZT15 yüzey balık yumurta için kontrol edin ve her 15-30 dk kadar ZT18 kontrol etmeye devam. Cavefish, ZT17, yumurta için kontrol edin ve her 15-30 dk kadar ZT20 kontrol etmeye devam.
      Not: Times 14:10 tarihinde temel alan zeitgeber zaman kullanarak s açık: koyu döngüsü. Üreme kez tahminidir ve bireysel labs tam zaman belirlemeniz gerekir. Sonra yakında serbest/onları tek hücreli aşamada enjekte için döllenmiş yumurta toplamak için çok önemlidir.
  3. Tek hücreli sahne yumurta toplama
    1. Üreme beklenen gece tankları her 15-30 dk ve monitör için yumurta deponun dibinde inceleyin. Yumurta yaklaşık 1 mm çapında ölçme saydam görünür.
    2. Net bir ince mesh balık yumurta toplamak ve taze balık sistem su dolu bir cam kase için aktarmak için kullanın. Yumurta yumurta tek hücreli aşamada olduğunu doğrulamak için mikroskop altında incelemek.
    3. Cam Pipetler kullanarak, tek hücreli yumurta enjeksiyon tabakaları bana aktarın. Cam Pipetler yumurta plastik için sopa olacak gibi bu aşamada gereklidir.
    4. Bir pipet kullanarak, dikkatle yumurta özel enjeksiyon plaka bölümünde 5.1 kuyu içine yayın. Prewarmed (oda sıcaklığında) enjeksiyon plaka satırlarının yumurta maksimum yineleyerek doldurmak (30-40 satır başına ve beş satır kadar). Tam satır yumurta enjeksiyonlar sırasında hareket etmesini engellemek yardım. Balık sistem su küçük bir miktar ile enjeksiyon tabakta enjeksiyonları performans kadar sulu yumurta tutun.
  4. Pico-enjeksiyon kurulum ve genel enjeksiyon en iyi duruma getirme yönergeleri
    1. Ya da jel-yükleme pipet kullanarak enjeksiyon iğneler kılcal veya standart micropipette ipuçları kullanma ve 2-4 µL bolus sonuna ekleme içinde uygun ipuçları tamamlanmıyor. Sonra iğne dolu, enjeksiyon iğne itibaren aşırı uzunluğu kırpmaya forseps kullanabilirsiniz.
    2. Microinjections bir picoliter microinjector bağlı bir micromanipulator monte bir iğne kullanarak gerçekleştirin.
    3. 0.03 enjeksiyon zamanını ayarlamak s ve ~0.0 psi basınçta dışarı. Enjeksiyon basıncı değişir buna göre iğneler arasında küçük farklılıklar ile çok ~1.0 nL enjeksiyon bolus elde etmek için en iyi duruma getirme.
      Not: Enjeksiyon basıncı genellikle ~ 10-30 psi aralığında olduğunu.
    4. Mineral yağ enjekte ve bolus ölçme enjeksiyon bolus standartlaştırmak ~ 1-elde etmek için bir slayt mikrometre ile 1,5 nL enjeksiyon birim boyutu. Bolus ses düzeyini azaltmak veya artırmak için enjeksiyon basıncı (PSI) ayarlayın.
    5. Su en laboratuvar mendil kullanarak yumurta kapalı çizin.
      Not: Astyanax yumurta koryon Zebra balığı yumurta nüfuz biraz zor olduğunu. Biz yumurta üst kapalı su çizim yardımcı olur iğne penetrasyon içine yumurta kolaylaştırmak bulabilirsiniz. Plaka optimizasyonu ~ 200 yumurta tek bir plaka üzerinde izin verebilirsiniz.
    6. Her yumurta iğne ile nüfuz ve doğrudan sarısı enjekte için micromanipulator kullanın. Sarısı içinde konumlandırılmış bir kez yumurta ekleme düğmesini veya enjeksiyon ayak pedalı basarak enjekte.
      Not: ~ 15 dk içinde tam bir tabak enjekte edilebilir. Tek hücreli sahne için ~ 40 dakika sürer.
  5. Morpholinos enjeksiyon
    Not: Morpholino toksisite neden olmadan nakavt için gerekli miktarda gen hedef optimize edilmiş olması gerekir; Ancak, bir 400 pg başlatmak için uygun bir bölgedir.
    1. Morpholino 400 sayfa başına yumurta zerk edilecek morpholino hazırlıkları. Morpholino buz çözme. Enjeksiyon çözüm morpholino (at istenen konsantrasyonu), RNase free H2O veya Danieau'oluşan s çözüm ve fenol red (son hacminin % 10). Bir örnek için bkz: Tablo 4.
    2. 1 enjekte nL embriyo başına.
  6. CRISPR enjeksiyon
    1. GRNA 25 pg ve Cas9 mRNA toplam 300 pg embriyo enjekte RNA hazırlıkları. Örnek CRISPR/Cas9 enjeksiyon karışım için bkz: Tablo 5.
    2. 2 enjekte nL gRNA/Cas9, mRNA embriyo embriyo içine doğrudan başına.
  7. Enjeksiyon Tol2 transposase ve Tol2 çevrili plazmid transgenesis
    1. Transposase çözülme mRNA ve Tol2 plazmid buz üzerinde. Birleştirme Cas9 mRNA (at 25 ng/µL), istenen Tol2 yapı (25 ng /μL) ve suda RNase free fenol red (% 10 son hacim). Bir örnek Tol2 transgenesis enjeksiyon karışım için bkz. Tablo 6.
    2. Enjeksiyon çözüm ve iğneler mRNA bozulması önlemek için buz üzerinde tutun. 1'de enjekte birim başına embriyo nL.

6. yetiştirme ve eleme balık enjekte

  1. Enjekte balık yetiştiriciliği
    1. Yumurta enjekte sonra hemen onları ~ 200 mL ile balık sistem su dolu cam kase (10 x 5 cm) aktarın. Yumurta kolayca durulanır dolu kase içine enjeksiyon tabak daldırma tarafından balık su ve yumurta bir pipet ile durulama.
    2. ~ 50-80 enjekte embriyo kaseye ve onları arka 22-24 °C.
    3. Enjekte balık 2 kase temiz x günlük ve günlük olarak su ~ %20 değişim ölü embriyo kaldırın.
    4. Ek yetiştirme daha önce yayımlanmış protokolleri39uygun olarak gerçekleştirilir.
  2. Morpholino enjekte bireylerin Eleme
    1. Bir stereomicroscope için fenotipleri ekran altında hayvanlar görselleştirin. Morpholinos etkisini ~ 5 gün postinjection21' e kadar devam edebilir.
    2. 4 gün postinjection, davranış fenotipleri ölçmek.
  3. CRISPR indels için eleme
    1. Hedef site çevresinde genomik DNA yükseltmek için tasarım astar. Böylece hedef PCR ürünü yaklaşık 100-astar tasarım 125 bp.
      Not: Örneğin, oca2 odağı için gRNA hedef site çevreleyen bölge ileriye doğru astar 5'-CTCCTCTGTCAGGCTGTGC-3 kullanarak güçlendirilmiş ' ve ters astar 5'-GAAGGGGATGTTGTCTATGAGC-3' 105 PCR ürün uzunluğu için kan basıncı.
    2. Embriyo kurban veya kurumsal hayvan protokolüne göre küçük yetişkin balık fin.
    3. Embriyo veya disseke yüzgeçleri PCR tüpler içine toplamak ve DNA ayıklamak ve PCR. örnek PCR protokolleri için gene özgü astar Ma vd.35bulunabilir gerçekleştirin.
    4. 5 mutagenesis için değerlendirmek çalıştırmak için µL PCR ürünün % 3 özel jel 70 V 3 h. vahşi-tipi (nonmutagenized) DNA için ayrı bir grup olarak bir PCR ürünü neden olur. Mutant DNA jel smeary bandında neden olur.
    5. Mutant gen sırasını belirlemek için TA klon PCR ürün üretici'göre s yönergeler, almak kolonileri ve miniprep kültürler. Sıralama için elde edilen DNA gönderin.
    6. Kurmak ve satırları mutant gen aktarımı balık korumak için yetişkin enjekte balık vahşi tipli balık ve ekran 5-10 embriyolar herhangi bir döl aşağıdaki adımları 6.3.1-6.3.6 gen mutasyona uğramış bir gen taşıyan belirlemek için çapraz.
      Not: Farklı F1 kişi aynı F0 kurucusu balık farklı mutasyon taşıyabilir. Mutant satırlarının dışarı çerçeve vardır allelleri üretmek için öngörülen mutasyonlar elde etmek için sıralanamadı emin olun.
    7. PCR smeary grup tahlil (adımları 6.3.1-6.3.6) kullanarak veya mutant ve vahşi-türü bantları (şekil 2C) yükseltmek alleli özgü PCR astar tasarımı bir mutant gen taşıyan balık tanımlayın.
    8. Balık bir satırı oluşturulduğunda, homozygose mutant gen resesif fenotipleri için test etmek için.
  4. Transgenik olumlu bireyler için eleme
    Not: bir floresan makinesi içeren yapıları kullanarak tarama transgenik olumlu bireyler için verimlilik düzeyini artırmak için önerilir. Ancak, standart PCR yöntemleri eleme-ebilmek var olmak kullanılmış için iletim ekran.
    1. Doku-spesifik floresan proteinler arasında F0 balık 2 gün postinjection, gibi erken bir epifluorescence kapsam dissekan görselleştirin.
      Not: F0 larva ifadede Mozaik, ve pozitif bireylerin bir dizi ifade fenotipleri olabilir.
    2. Pozitif bireyler F0 kurucusu balık tutmak.
    3. F0s olgunluk ulaştığınızda, aynı nüfus/laboratuvar stoktan türetilmiş nontransgenic bireylere kurucu balık backcross. 6.2. adımda açıklandığı gibi aynı iletişim kuralını kullanarak ekran F1 çoluk çocuk.
      Not: F1 larva ifadede üniforma ve F1 kardeşler arasında tutarlılığı sağlar.
    4. Tol2 entegrasyon sitesi-aracılı değildir ve entegrasyon kurucuları arasında değişir, seçin beri F1 kardeşler ve tek bir F0 kurucusu elde pozitif ifade F1 kardeşler F2s oluşturmak için elde. Bu yavru istikrarlı bir çizgi için temel olacaktır.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Mağaralarda yaşayan A. mexicanus birden fazla nüfus az uyku ve onların yüzey-konut conspecifics14göre artan uyanıklık/etkinlik gösterir. Hipokretin/Oreksin (HCRT) anestezi (film) artırmak için davranır, son derece korunmuş bir peptit ve HCRT yolu anomalileri Narkolepsi insanlar ve diğer memeliler47,48neden. Daha önce o mağaranın göstermiştir A. mexicanus bu peptid artan bir ifade cavefish38uyku kaybı altında yatan düşündüren HCRT peptid, ifade artmıştır. MO nakavt hcrt ifade doğrudan artan hcrt ifade cavefish uyku kaybı arabuluculuk etkisini incelemek için güçlü bir yaklaşım sağlar.

Hcrt ifade ve uyku arasındaki ilişkiyi incelemek için çeviri engelleme morpholino tasarlanmıştır. ATG dahil olmak üzere exon, MO hedefleri ilk 25 bp sitesini (şekil 1A,B) başlatın. Bir denetim olarak piyasada bulunan şifreli MO denetim (şekil 1B) kullanılmaktadır. NCBI üzerinde patlama algoritmasıyla, genom (veri gösterilmez) boyunca her iki MO için hiçbir hedef kapalı etkileri vardır doğruladı. A. mexicanus yüzey balık ve Pachón cavefish yetiştirilen ve yumurtalarını toplanmış ve daha sonra MO 400 pg ile tek hücreli aşamada (şekil 1 c,D) 1 bir nL hacmindeki enjekte. Balık için 4 dpf kaldırdı ve etkinlik ve uyku davranış için ölçülür.

Mağara A. mexicanus denetimle sergilenen MO önemli ölçüde daha Lokomotor aktivite enjekte ve uyku düşük yüzey balık de şifreli MO ile (şekil 1E,F) enjekte göre bir 24 Saat süre içinde hiçbir etkisi düşündüren sonuçlar her morphotype daha önce yayımlanmış etkinlik ve uyku desenleri ile tutarlı olarak morpholino enjeksiyon kontrol (t 5.021, df = 88, p < 0,0001 =). HCRT-MO enjeksiyon yüzey balık denetim enjekte balık için karşılaştırıldığında küçük uyku etkisi vardı (t 0.17, df = 88, p > 0,99 =). Buna ek olarak, hcrt nakavt MO enjeksiyon yoluyla mağaralarda yaşayan balık uyku üzerinde önemli bir etkisi vardı. Pachón cavefish larva misiIIerden bir azalma daha az Lokomotor aktivite gösterdi ve neredeyse iki kat Pachón larva (1E rakam,F; kontrol daha fazla uyku t 2.694, df = 88, p < 0,05 =). Lokomotor aktivite ve MO-nakavt yüzey ve mağaralarda yaşayan balık uykusunda karşılaştırma karşılaştırılabilir hareket ve uyku tutarları (şekil 1E, F) saptandı. Bu veri hcrt ifade ve uyku kaybı arasında doğrudan bir bağlantı sağlamak ve evrimsel türetilmiş mağaralarda yaşayan morphs uyku kaybı biyolojik mekanizmaları sorguya çekmek için bir yöntem sağlar.

Pigmentasyon kaybı mağara organizmalar bir özelliğidir ve birden çok mağaralarda yaşayan Astyanax nüfus pigmentasyon kaybı gösterilmektedir. Molino ve Pachón cavefish içinde albinizm oca2 mutasyonların albinizm cavefish6altında yatan düşündüren oküler albinizm 2 (oca2), gen içeren bir genomik bölgesine QTL eşleme kullanma eşlenmiş.

OCA2 albinizm Pachón mağara morphs için sorumlu odağı olarak doğrulamak için CRISPR/Cas9 bu bölgede yüzey balık nüfus mutasyona gen düzenleme kullanılmaktadır. Ondan beri eXoN 21 Molino balık6' silmek, biz bir gRNA gen (şekil 2A) bu bölgeyi hedeflemek için tasarlanmıştır. GRNA hedef sıra ve PAM (kalın), dahil olmak üzere genomik, 5'-GGTCATGTGGGTCTCAGCTTTGG-3 sırasıdır '. (Olmadan PAM dizisi) bu hedef sırası hedeflenen mutagenesis için bir gRNA oluşturmak için kullanılmıştır. Yüzey doğurmak çiftleşmek için yapılmış ve sonuçta elde edilen embriyolar tek hücreli aşamada toplanmıştır. Bir hücreli sahne embriyo Cas9 mRNA ve gRNA hedefleme oca2ile enjekte edildi ve enjekte hayvanlar yetişkinlik43için yetiştirildik. Enjekte yetişkin vahşi tipi yüzey balığı çiftleşmek için yapılmış ve bu haçlar gelen embriyo mikrop-line iletim, adım 6.3.1 primerler kullanılarak belirlemek için genotyped. Biz bir mutant oca2 gen sıralı ve 2 bp germ hattı aktarılan silme oca2 (şekil 2B,C) içinde bir tespit. Genotipleme kolaylaştırmak için biz Jel Elektroforez (şekil 2E) tarafından takip PCR kullanarak alleli özgü astar vahşi tipi ve mutant gen (2D rakam) ve genotyped balık, belirlemek için tasarlanmıştır. Biz incrossed yüzey balık bu oca2 mutant gen için heterozigoz. Ortaya çıkan döl Pigmente veya albino (şekil 2F-Ben). Albino bireyler homozigoz mutant (şekil 2E) Pigmentli kişilerin vahşi-türü veya oca2 odağı, heterozigoz bulunmuştur. Bu veriler oca2 gen odağı ve A. mexicanus cavefish içinde albinizm arasında doğrudan bir bağlantı sağlar.

Temel nöronal belirleyici morphs arasında belirsiz kalır henüz uyku, beslenme ve stres gibi sayısız davranışları A. mexicanus cavefish yüzey conspecifics göre farklıdır. Bütün beyin kalsiyum görüntüleme değiştirilmiş sinirsel aktivite ve değiştirilmiş davranışı arasındaki bağıntıları incelenmesi için güçlü bir tarafsız yaklaşım sağlar. Biz yüzey balık ve cavefish genetik olarak kodlanmış kalsiyum göstergesi, GCaMP6s, bir bulunabilen nöronal ifade ile Zebra balığı araştırmalarda yaygın olarak kullanılan reaktifler kullanarak oluşturulan. ELAV benzeri nöron özel RNA-bağlayıcı protein 3 (elavl3) endogenously merkezi sinir sistemi49 boyunca yeni farklılaştırılmış nöronlar ile ifade edilir ve Zebra balığı içinde ifade sinir sistemi50çoğunluğu boyunca proteinlerin sürücü için kullanılır. Biz ~2.8 kb Zebra balığı elavl3 organizatörü transkripsiyon akıntıya karşı genetik olarak kodlanmış kalsiyum göstergenin GCaMP6s (bir füzyon yeşil flüoresan protein [GFP], calmodulin ve M13, myosin peptid serisinden içeren bir Tol2 yapı elde ışık-zinciri kinaz), çevrili Tol2 siteleri ile 5' ve 3' ucunda (Tol2 -elavl3:GCaMP6s-Tol2)51.

A. mexicanus yüzey balık ve Molino cavefish yetiştirilen ve elde edilen embriyo ile 25 ng/μL Tol2 -elavl3:GCaMP6s, tek hücreli aşamada coinjected-Tol2 yapı ve 25 ng/μL Tol2 transposase mRNA (şekil 3A). 24-48 dpf larva GCaMP6s geçici nöronal ifade için gösterildi. GCaMP6s bir ifade ile bu enjekte (F0) embriyolar yetişkinliğe kaldırdı ve yüzey balık veya cavefish aynı soyundan türetilmiş vahşi-türü yetişkin ile backcrossed. Elde edilen F1 yetişkin için istikrarlı bir ifade GCaMP6s ifade gösterildi ve o larva istikrarlı satırları (şekil 3B,C) oluşturmak için muhafaza. Çünkü her F1 yetişkin istikrarlı bir ifade ile büyük olasılıkla Tol2 -elavl3entegre vardır: GCaMP6s-Tol2 farklı genomik sitelerdeki her F1 atanmış farklı bir formda. Bu yaklaşımı kullanarak, biz kararlı F1s nöronal aktivite mağara davranış değişiklikleri arabuluculuk farklılıkları ortaya çıkarmak için görüntüleme böylece etkinleştirme canlı kalsiyum Molino cavefish halka (şekil 3B,C) ve yüzey balık için üretilip çevre (şekil 3 C,D). Ayrıca, bu yaklaşım karakterize ve A. mexicanus gen işlevinde işlemek için birçok ek transgenes ifade için zemin bırakır.

Figure 1
Resim 1: Hcrt Morpholino nakavt etkinliğini azaltır ve artar cavefish uykusunda. (A) kodlama sırası ATG başlangıç sitesi de dahil olmak üzere, Hcrt, morpholino hedefleri ilk 25 kan basıncı çeviri engelleme. (B) Hcrt morpholino oligo (MO) ve kontrol dizilerini. (C) ~ 200 tek hücreli yumurta enjeksiyon için özel yumurta kalıplar üzerinde hizalaması. (D) mikroenjeksiyon 1.0 nL ile fenol kırmızı sinyal görüntüleme için enjeksiyon karışımı. Ölçek çubuğu 0.5 mm. (E) Hcrt , Morpholino nakavt azaltır etkinlik (kat edilen toplam mesafeyi) Pachón cavefish = (t 5.021, df = 88, p < 0,0001 =) değil, yüzey balık (t 1.318, df = 88, p = > 0,72). (F) nakavt Pachón cavefish uykusunda artırır (t 2.694, df = 88, p < 0,05 =) ama yüzey balık üzerinde hiçbir etkisi yoktur (t 0.17, df = 88, p > 0,99 =). Ölçek çubuğu = 1 mm. Hata çubukları panelleri E ve F ortalama standart hatasını gösterir. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 2
Resim 2: CRISPR gen-düzenleme oca2 yüzey-konut içinde albinizm tanıttı A. mexicanus. (A)şeması oca2 kodlama bölgeler ve gen CRISPR-aracılı düzenleme exon 21 Hedefleme Rehberi RNA (gRNA). (B) vahşi tipi Oca2 + ve (C) mutant Oca2 - gen Kromatografik sıralama. B panelinde kırmızı bir kutu kayıp Masası'nda Ctasvir mutant Oca2 - Gen 2 bp sırasını gösteren. (D) hedef CRISPR 2 bp silme, dağıtmak Oca2 işlevi sunar. Astar içinde F0 çoluk çocuk 2 bp silme genotypic ile taranması için tasarlanmıştır. (E) PCR ve Jel Elektroforez Oca2 , vahşi tipi yüzey balık (Grup boyutu 134 = kan basıncı) ve çoluk çocuk F0 CRISPR enjeksiyonlu (Grup boyutu = 133 bp). Bireyler homozigoz veya heterozigoz Oca2 (Oca2 +) vahşi-türü varyant için Pigmentli, F0s 2 bp silmek için homozigoz ise (Oca2 -) albinizm liman. (F) tüm vücut resimleri vahşi-türü yüzey balık ve (G) CRISPR-aracılı albinizm ile yüzey balık. Ölçek çubuğu = 5 mm. (H ve ben) Magnified görünüm panellerinde F ve G, sırasıyla tasvir bireyler başkanları. Ölçek çubuğu 2 mm. = Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 3
Şekil 3: pan-nöronal GCAMP6s Tol2 transgenesis beyin aktivitesi içinde canlı görüntüleme sağlar A. mexicanus. (A) Tol2-aracılı transgenesis A. mexicanusiçinde. Coinjection Tol2 mRNA ve Tol2 -elav3l: GCAMP6s-Tol2 plazmid entegre F0 kurucuları transgene GCAMP6s. Vahşi tipli balık orijinal stok backcrossing F1 bireyler GCAMP6s istikrarlı bir pan-nöronal ifade ile verir. (B ve C) ortaya çıkan yavrular için bir sabit ifadesi diseksiyon ve confocal mikroskobu kullanılarak ekranlı. Kararlı TgAsty(elav3l: GCaMP6s) F1 bireyler hem yüzey-(tasvir Masası'nda B) ve (C panelinde tasvir) mağaralarda yaşayan morphotypes için kurulmuştur. Ölçek çubuğu 200 mikron =.  Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Reaktif Birim veya tutarı
PCS-zT2TP plazmid DNA 10.0 μg X μl
NF'leri CutSmart arabellek 10.0 μl
NotI-HF enzim 2.0 μl
Nükleaz ücretsiz H2O X μl
BSA 1.0 μl
Toplam 100 μl

Tablo 1: Kısıtlama Tol2 plazmid özünü.

Reaktif Birim veya tutarı
Doğrusallaştırılmış pCS-zT2TP plazmid DNA 1.0 μg X μl
10 x reaksiyon arabellek 2.0 μl
2 x NTP/kapak 10.0 μl
SP6 enzim karışımı 2.0 μl
RNase free H2O X μl
Toplam ≤20 μl

Tablo 2: In vitro Tol2 mRNA sentezi.

Ayar adı Ayar değeri
Isı 510
Çekme 55
Hız 100
Zaman 40
Basınç 500
Rampa 534

Tablo 3: Örnek Protokolü pipet çekerek. 

Reaktif Birim veya tutarı
Morpholino (dondurucu stok @ 4mM) 1.0 μl
Nükleaz ücretsiz H2O ya da Danieau'nın çözüm 17,0 μl
Fenol Red 2.0 μl
Toplam 20 μl

Tablo 4: Morpholino enjeksiyon karışım.

Reaktif Birim tutarı
gRNA (100ng/μl @ son çalışma konsantrasyonu) 1 μl
Cas9 mRNA (1200ng/μl @ son çalışma konsantrasyonu) 1 μl
RNase free H2O 2 μl
Toplam 4 μl

Tablo 5: Örnek CRISPR/Cas9 enjeksiyon karışım.

Reaktif Birim tutarı
Tol2 plazmid (25ng/μl @ son çalışma konsantrasyonu) X μl
Tol2 mRNA (25ng/μl @ son çalışma konsantrasyonu) X μl
Fenol Red 1.0 μl
RNase free H2O X μl
Toplam 15 μl

Tablo 6: Örnek Tol2 transgenesis enjeksiyon karışım

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Burada, morpholinos, CRISPR/Cas9 gen düzenleme ve transgenesis metodoloji kullanarak gen işlevini değiştirmek için bir metodoloji verdiğimiz. Genetik teknoloji zenginliği ve Zebra balığı bu sistem optimizasyonu büyük olasılıkla bu araçlar kolaylığı52ile transfer içine A. mexicanus sağlayacaktır. Son bulgular-si olmak kullanılmış bu yaklaşımlar A. mexicanusama bu sistem30,36,42 farklı morfolojik, gelişim ve davranış özellikleri soruşturma atıl kalır , 53.

Morpholinos nakavt genlerin ifade için Zebra balığı araştırmalarda yaygın olarak kullanılmaktadır. Yaklaşım facile ve içinde ifade köşenize sağlam sonuç. Ancak, hedef kapalı etkileri yaygın olarak belgelenmiş22,53olmuştur; Böylece, hangi morpholinos için enjekte edilmiş hayvanlar için herhangi bir beklenmedik fenotipleri22,55dikkatle izlenmelidir. Mümkün olduğunda, CRISPR/Cas9-aracılı nakavt yaklaşımlar gibi diğer yöntemleri kullanarak morpholino nakavt elde edilen sonuçlar doğrulanması gerektiğini. Morpholinos gen ekspresyonu sağlam nakavt için izin verirken, morpholino-aracılı nakavt geçici. Böylece, Yetişkin fenotipleri analiz bu yöntemi kullanırken mümkün değildir.

Mutagenesis CRISPR/Cas9-aracılı belirli genler doğrudan manipülasyon sunmaktadır. Ayrıca, morpholino-aracılı, köşenize yetişkinlik mutant fenotipleri analiz için CRISPR/Cas9 mutagenesis sağlar. CRISPR/Cas9 hedef kapalı etkilerini önlemek için birçok nesiller mutant satırları outcrossed ve mümkün olduğunda, birden fazla gen elde edilen ve test. CRISPR/Cas9 sistem de vurmak için gen düzenleme yaklaşımlar kullanmak için potansiyel sağlar-gen veya belirli genetik değişiklikler üretmek için. CRISPR/Cas9 sistemi içinde Zebra balığı eksojen DNA'ın kesin entegrasyonlar üretmeye ve hassas nokta mutasyonlar19,20,56,57,58, oluşturmak için kullanılmıştır 59. cavefish genom sıralama ile Şimdi tek nükleotid polimorfizmleri (SNPs) veya başka ince genetik değişiklikler yüzey balık ve cavefish nüfus33arasında tanımlamak mümkündür. CRISPR/Cas9 gen düzenleme uygulama allelleri yüzey balık ve cavefish, veya cavefish, bu genetik değişiklikler farklı gelişim süreçlerinde rol incelemek için farklı nüfus arasında değişimi için fırsat sağlar.

Bu protokol için açıklanan transgenesis yaklaşımlar işlevi kazanç Etütler ve biyolojik süreçlerin genetik olarak değiştirmek için Araçlar üretmek için bir basit ve güçlü yöntemi sağlar. Tol2 sistem Zebra balığı araştırmalarda yaygın olarak kullanılır ve A. mexicanusiçinde aynı şekilde güçlü olduğunu göstermiştir. Ayrıca, Zebra balığı organizatörü kullanır ve A. mexicanusendojen ifadede beyannamedir Zebra balığı oluşturuldu bir transgenik yapı gösterdi. A. mexicanus içinde (veri gösterilmez) beklendiği gibi Zebra balığı dört diğer Organizatör o sürücü doku özgü ifade izole bulduk. Zebra balığı rehberleri A. mexicanuskendi korunmuş ifade desenleri özetlemek, bu genetik araçların çoğu doğrudan Zebra balığı mexicanus A. için değişiklik A. ile gerek kalmadan transfer edilebilir gösteriyor mexicanus promotors. Ayrıca, A. mexicanus33sıralama teknolojileri peşin ile burada açıklanan transgenik yaklaşımlar güçlü bir gelecek arttırıcılar ve değişim arasında bir rol oynayabilir rehberleri incelenmesi için izin verir yüzey ve mağara formları. Son olarak, Zebra balığı değerli yaptık biyolojik süreçlerin genetik manipülasyon için güçlü araçlar A. mexicanus60,61,62,63eşit derecede önemlidir. Çeşitli davranış özellikleri, beslenme, uyku gibi farklılıklar stres ve saldırganlık, A. mexicanus yüzey ve mağaralarda yaşayan biçimler arasında kapsamlı bir şekilde belgelenmiş12,14,15 olmuştur ,38,64, henüz temel nöronal ilişkilendirir iyi anlaşılmış değil. Tg(elavl3:GCaMP6s) gibi araçlar nasıl nöronal aktivite beyin çapında farklılıkları davranış farklılıkları ile ilişkilendirmek ve nasıl beyin vardır içine benzersiz bir fikir evrimsel değişiklik teklif bir diseksiyon çalışmasına izin verir.

Birlikte ele alındığında, A. mexicanus morfolojik ve davranışsal özellikleri çeşitli evrimi soruşturma için önde gelen bir model haline hazırlanıyor. A. mexicanus karmaşık biyolojik süreçlerin çeşitli farklılıkları genetik özelliği evrim mekanizmalarının araştırılması için bir platform sağlar. Gen işlevini değiştirmek için araçlar uygulama bu organizma içine göz dejenerasyon, nörogelişimsel bozuklukları ve uykusuzluk ile ilgili biyolojik hastalıkları araştırmak için uygulanan bir model geliştirmek yardımcı olabilir.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarlar ifşa gerek yok.

Acknowledgments

Yazarlar Sunishka Thakur onun yardımı Genotipleme ve Şekil 2' de tasvir oca2 mutant balık görüntüleme için teşekkür ederiz. Bu eser Ulusal Bilim Vakfı (NSF) Ödülü 1656574 A.C.K. için NSF Ödülü 1754321 JK ve A.C.K. ve ulusal kurumları Sağlık (NIH) Ödülü R21NS105071 A.C.K. ve E.R.D. tarafından desteklenmiştir

Materials

Name Company Catalog Number Comments
Fish breeding & egg supplies
Fine mesh fish net Penn Plax BN4
Fish tank heater Aqueon 100106108
Egg traps Custom made NA Design and create plastic grate to place at bottom of tank to protect eggs
Glass pipettes Fisher Scientific 13-678-20C
Pipette bulbs Fisher Scientific 03-448-21
Agarose Fisher Scientific BP160-500
Egg molds Adaptive Science Tools TU-1
Morpholino supplies
Control Morpholino Gene Tools, LLC Standard control olio
Custom Morpholino Gene Tools, LLC NA
Phenol Red Sigma Aldrich P0290-100ML
CRISPR supplies
Cas9 Plasmid AddGene 46757
GoTaq DNA Polymerase Promega M3001
KOD Hot Start Taq EMD Millipore 71-842-3
Primers Integrated DNA Technologies Custom
T7 Megascript Kit Ambion/Thermofisher AM1333
miRNeasy Kit Qiagen 217004
mMessage mMachine T3 kit Ambion/Thermofisher AM1348
MinElute Kit Qiagen 28204
Tol2 transgenesis supplies
pCS-zT2TP plasmid Kawakami et al., 2004 Request from senior author
CutSmart Buffer New England Biolabs B7204
NotI-HF Restriction Enzyme New England Biolabs R3189
PCR purification Kit Qiagen 28104
SP6 mMessenger Kit Ambion/Thermofisher AM1340
Microinjection supplies
Glass Capillary Tubes Sutter Instruments BF100-58-10
Pipette puller Sutter Instruments P-97
Picoinjector Warner Instruments PLI-100A
Micromanipulator World Precision Instruments M3301R
Micromanipulator Stand World Precision Instruments M10
Micmanipulator Base World Precision Instruments Steel Plate Base, 10 lbs

DOWNLOAD MATERIALS LIST

References

  1. Darwin, C. On the Origin of Species by Means of Natural Selection. D. Appleton and Company. (1859).
  2. Culver, D. C., Pipan, T. The Biology of Caves and Other Subterranean Habitats. Oxford University Press. New York, NY. (2009).
  3. Mitchell, R. W., Russell, W. H., Elliott, W. R. Mexican Eyeless Characin Fishes, Genus Astyanax: Environment, Distribution, and Evolution. (1977).
  4. Huppop, K. Oxygen consumption of Astyanax fasciatus (Characidae, Pisces): A comparison of epigean and hypogean populations. Environmental Biology of Fishes. 17, 299-308 (1986).
  5. Moran, D., Softley, R., Warrant, E. J. Eyeless Mexican Cavefish Save Energy by Eliminating the Circadian Rhythm in Metabolism. PLoS ONE. 9, (9), e107877 (2014).
  6. Protas, M. E., et al. Genetic analysis of cavefish reveals molecular convergence in the evolution of albinism. Nature genetics. 38, 107-111 (2006).
  7. Wall, A., Volkoff, H. Effects of fasting and feeding on the brain mRNA expressions of orexin tyrosine hydroxylase (TH), PYY and CCK in the Mexican blind cavefish (Astyanax fasciatus mexicanus). General and Comparative Endocrinology. 183, 44-52 (2013).
  8. Aspiras, A., Rohner, N., Marineau, B., Borowsky, R., Tabin, J. Melanocortin 4 receptor mutations contribute to the adaptation of cavefish to nutrient-poor conditions. Proceedings of the National Academy of Sciences. 112, (31), 9668-9673 (2015).
  9. Yoshizawa, M., Gorički, Š, Soares, D., Jeffery, W. R. Evolution of a behavioral shift mediated by superficial neuromasts helps cavefish find food in darkness. Current Biology. 20, (18), 1631-1636 (2010).
  10. Jeffery, W. R. Regressive Evolution in Astyanax Cavefish. Annual Review of Genetics. 43, 25-47 (2009).
  11. Gross, J. B. The complex origin of Astyanax cavefish. BMC Evolutionary Biology. 12, 105 (2012).
  12. Elipot, Y., Hinaux, H., Callebert, J., Rétaux, S. Evolutionary shift from fighting to foraging in blind cavefish through changes in the serotonin network. Current Biology. 23, (1), 1-10 (2013).
  13. Kowalko, J. E. J., et al. Loss of schooling behavior in cavefish through sight-dependent and sight-independent mechanisms. Current Biology. 23, (19), 1874-1883 (2013).
  14. Duboué, E. R. E. R., Keene, A. C. A. C., Borowsky, R. L. R. L. Evolutionary convergence on sleep loss in cavefish populations. Current Biology. 21, (8), 671-676 (2011).
  15. Chin, J. S., et al. Convergence on reduced stress behavior in the Mexican blind cavefish. Developmental Biology. (2018).
  16. Scheer, N., Campos-Ortega, J. A. Use of the Gal4-UAS technique for targeted gene expression in the zebrafish. Mechanisms of Development. 80, (2), 153-158 (1999).
  17. Kawakami, K., Shima, A., Kawakami, N. Identification of a functional transposase of the Tol2 element, an Ac-like element from the Japanese medaka fish, and its transposition in the zebrafish germ lineage. Proceedings of the National Academy of Sciences. 97, (21), 11403-11408 (2000).
  18. Balciunas, D., et al. Enhancer trapping in zebrafish using the Sleeping Beauty transposon. BMC Genomics. (2004).
  19. Auer, T. O., Duroure, K., De Cian, A., Concordet, J. P., Del Bene, F. Highly efficient CRISPR/Cas9-mediated knock-in in zebrafish by homology-independent DNA repair. Genome Research. 24, (1), 142-153 (2014).
  20. Kimura, Y., Hisano, Y., Kawahara, A., Higashijima, S. I. Efficient generation of knock-in transgenic zebrafish carrying reporter/driver genes by CRISPR/Cas9-mediated genome engineering. Scientific Reports. 4, (2014).
  21. Bill, B. R., Petzold, A. M., Clark, K. J., Schimmenti, L. A., Ekker, S. C. A Primer for Morpholino Use in Zebrafish. Zebrafish. 6, (1), 69-77 (2009).
  22. Nasevicius, A., Ekker, S. C. Effective targeted gene “knockdown” in zebrafish. Nature Genetics. (2000).
  23. Sander, J. D., et al. Targeted gene disruption in somatic zebrafish cells using engineered TALENs. Nature Biotechnology. (2011).
  24. Huang, P., et al. Heritable gene targeting in zebrafish using customized TALENs. Nature Biotechnology. (2011).
  25. Kawakami, K. Transposon tools and methods in zebrafish. Developmental Dynamics. 234, (2), 244-254 (2005).
  26. Urasaki, A., Morvan, G., Kawakami, K. Functional dissection of the Tol2 transposable element identified the minimal cis-sequence and a highly repetitive sequence in the subterminal region essential for transposition. Genetics. 174, (2), 639-649 (2006).
  27. Juntti, S. A., Hu, C. K., Fernald, R. D. Tol2-Mediated Generation of a Transgenic Haplochromine Cichlid, Astatotilapia burtoni. PLoS ONE. 8, (10), (2013).
  28. Harel, I., Valenzano, D. R., Brunet, A. Efficient genome engineering approaches for the short-lived African turquoise killifish. Nature Protocols. 11, (10), 2010-2028 (2016).
  29. Erickson, P. A., Ellis, N. A., Miller, C. T. Microinjection for Transgenesis and Genome Editing in Threespine Sticklebacks. Journal of Visualized Experiments. (111), e54055 (2016).
  30. Elipot, Y., Legendre, L., Père, S., Sohm, F., Rétaux, S. Astyanax transgenesis and husbandry: how cavefish enters the laboratory. Zebrafish. 11, (4), 291-299 (2014).
  31. Keene, A., Yoshizawa, M., McGaugh, S. Biology and Evolution of the Mexican Cavefish. Academic Press. New York, NY. (2015).
  32. Casane, D., Rétaux, S. Evolutionary Genetics of the Cavefish Astyanax mexicanus. Advances in Genetics. 95, 117-159 (2016).
  33. Mcgaugh, S., et al. The cavefish genome reveals candidate genes for eye loss. Nature Communications. 5, 5307 (2014).
  34. Yoshizawa, M., et al. Distinct genetic architecture underlies the emergence of sleep loss and prey-seeking behavior in the Mexican cavefish. BMC Biology. 13, (1), (2015).
  35. Ma, L., Jeffery, W. R., Essner, J. J., Kowalko, J. E. Genome editing using TALENs in blind Mexican cavefish, Astyanax mexicanus. PLoS ONE. 10, (3), (2015).
  36. Bilandzija, H., Ma, L., Parkhurst, A., Jeffery, W. A potential benefit of albinism in Astyanax cavefish: downregulation of the oca2 gene increases tyrosine and catecholamine levels as an alternative to melanin synthesis. PLoS ONE. 8, (11), e80823 (2013).
  37. Alie, A., et al. Developmental evolution of the forebrain in cavefish: from natural variations in neuropeptides to behavior. eLife. 7, e32808 (2018).
  38. Jaggard, J. B., et al. Hypocretin underlies the evolution of sleep loss in the Mexican cavefish. eLife. 7, e32637 (2018).
  39. Borowsky, R. Handling Astyanax mexicanus eggs and fry. Cold Spring Harbor Protocols. 3, (11), (2008).
  40. Varshney, G. K., Sood, R., Burgess, S. M. Understanding and Editing the Zebrafish Genome. Advances in Genetics. 92, 1-52 (2015).
  41. Wierson, W. A., et al. GeneWeld: a method for efficient targeted integration directed by short homology. BioRxiv. (2018).
  42. Klaassen, H., Wang, Y., Adamski, K., Rohner, N., Kowalko, J. E. CRISPR mutagenesis confirms the role of oca2 in melanin pigmentation in Astyanax mexicanus. Developmental Biology. (2018).
  43. Jao, L. E., Wente, S. R., Chen, W. Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Proceedings of the National Academy of Sciences of the United States of America. 110, (34), 13904-13909 (2013).
  44. Kwan, K. M., et al. The Tol2kit: A multisite gateway-based construction Kit for Tol2 transposon transgenesis constructs. Developmental Dynamics. 236, (11), 3088-3099 (2007).
  45. Kawakami, K., et al. A transposon-mediated gene trap approach identifies developmentally regulated genes in zebrafish. Developmental Cell. 7, (1), 133-144 (2004).
  46. Kowalko, J., Ma, L., Jeffery, W. Genome Editing in Astyanax mexicanus Using Transcription Activator-like Effector Nucleases (TALENs). Journal of Visualized Experiments. (112), e54113 (2016).
  47. Nishino, S., Ripley, B., Overeem, S., Lammers, G. J., Mignot, E. Hypocretin (orexin) deficiency in human narcolepsy. Lancet. (2000).
  48. Lin, L., et al. The sleep disorder canine narcolepsy is caused by a mutation in the hypocretin (orexin) receptor 2. Cell. (1999).
  49. Park, H. C., et al. Analysis of upstream elements in the HuC promoter leads to the establishment of transgenic Zebrafish with fluorescent neurons. Developmental Biology. 227, (2), 279-293 (2000).
  50. Higashijima, S., Masino, M. A., Mandel, G., Fetcho, J. R. Imaging Neuronal Activity During Zebrafish Behavior With a Genetically Encoded Calcium Indicator. Journal of Neurophysiology. (2003).
  51. Vladimirov, N., et al. Light-sheet functional imaging in fictively behaving zebrafish. Nature Methods. 11, (9), 883-884 (2014).
  52. Halpern, M. E., et al. Gal4/UAS transgenic tools and their application to zebrafish. Zebrafish. 5, (2), 97-110 (2008).
  53. Jaggard, J. B., Stahl, B. A., Lloyd, E., Prober, D. A., Duboue, E. R., Keene, A. C. Hypocretin underlies the evolution of sleep loss in the Mexican cavefish. bioRxiv. 7, e32637 (2018).
  54. Bedell, V. M., Westcot, S. E., Ekker, S. C. Lessons from morpholino-based screening in zebrafish. Briefings in Functional Genomics. (2011).
  55. Robu, M. E., et al. p53 activation by knockdown technologies. PLoS Genetics. (2007).
  56. Hisano, Y., et al. Precise in-frame integration of exogenous DNA mediated by CRISPR/Cas9 system in zebrafish. Scientific reports. 5, 8841 (2015).
  57. Prykhozhij, S., et al. Optimized knock-in of point mutations in zebrafish using CRISPR/Cas9. Nucleic Acids Res. 46, (17), (2018).
  58. Tessadori, F., et al. Effective CRISPR/Cas9-based nucleotide editing in zebrafish to model human genetic cardiovascular disorders. Disease Model Mechanisms. 11, (10), (2018).
  59. Armstrong, G., Liao, M., You, Z., Lissouba, A., Chen, B., Drapeau, P. Homology Directed Knockin of Point Mutations in the Zebrafish tardbp and fus Genes in ALS Using the CRISPR/Cas9 System. PLoS ONE. 11, (3), (2016).
  60. Friedrich, R. W., Jacobson, G. A., Zhu, P. Circuit Neuroscience in Zebrafish. Current Biology. 20, (8), (2010).
  61. Friedrich, R. W., Genoud, C., Wanner, A. A. Analyzing the structure and function of neuronal circuits in zebrafish. Frontiers in Neural Circuits. 7, (2013).
  62. Scott, E. K., et al. Targeting neural circuitry in zebrafish using GAL4 enhancer trapping. Nature Methods. 4, (4), 323-326 (2007).
  63. Asakawa, K., Kawakami, K. Targeted gene expression by the Gal4-UAS system in zebrafish. Development Growth and Differentiation. (2008).
  64. Lloyd, E., et al. Evolutionary shift towards lateral line dependent prey capture behavior in the blind Mexican cavefish. Developmental Biology. (2018).
Meksika Cavefish işlevinde Gene manipülasyon
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Stahl, B. A., Jaggard, J. B., Chin, J. S. R., Kowalko, J. E., Keene, A. C., Duboué, E. R. Manipulation of Gene Function in Mexican Cavefish. J. Vis. Exp. (146), e59093, doi:10.3791/59093 (2019).More

Stahl, B. A., Jaggard, J. B., Chin, J. S. R., Kowalko, J. E., Keene, A. C., Duboué, E. R. Manipulation of Gene Function in Mexican Cavefish. J. Vis. Exp. (146), e59093, doi:10.3791/59093 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter