This protocol outlines the steps needed to generate a model system in which the transcription of an endogenous gene of interest can be conditionally controlled in live animals or cells using enhanced lac repressor and/or tet activator systems.
Method Article
This protocol outlines the steps needed to generate a model system in which the transcription of an endogenous gene of interest can be conditionally controlled in live animals or cells using enhanced lac repressor and/or tet activator systems.
Here we describe a protocol for implementing the REMOTE-control system (Reversible Manipulation of Transcription at Endogenous loci), which allows for reversible and tunable expression control of an endogenous gene of interest in living model systems. The REMOTE-control system employs enhanced lac repression and tet activation systems to achieve down- or upregulation of a target gene within a single biological system. Tight repression can be achieved from repressor binding sites flexibly located far downstream of a transcription start site by inhibiting transcription elongation. Robust upregulation can be attained by enhancing the transcription of an endogenous gene by targeting tet transcriptional activators to the cognate promoter. This reversible and tunable expression control can be applied and withdrawn repeatedly in organisms. The potency and versatility of the system, as demonstrated for endogenous Dnmt1 here, will allow more precise in vivo functional analyses by enabling investigation of gene function at various expression levels and by testing the reversibility of a phenotype.
Genetic knockout or transgenic approaches have been effective means to study gene function in animal models. However, expression regulation by these approaches is dichotomous (on/off), non-temporal, and thus is not capable of revealing the complete functional spectrum of a gene. Conditional Cre/LoxP technologies have allowed spatio-temporal inactivation or activation of gene function, but their dichotomous nature continues to pose limitations, such as cell lethality and irreversibility1,2,3. In order to fill this void, conditional knockdown approaches have been developed using tet-regulated shRNA or miRNA4. However, off-target effects remain a concern for RNAi5 and have been challenging to control in vivo. More recently, CRISPR/Cas-mediated transcriptional-control technologies have introduced a more versatile approach to achieving both up- and downregulation of endogenous gene expression and demonstrated their utilities6,7. However, the effectiveness of CRISPR/Cas-mediated transcriptional control is as yet unclear in vivo, and the reversibility of KRAB-based repression remains to be seen, as strong repression by KRAB and its interacting protein KAP1 has been shown to induce permanent gene silencing8,9.
In order to address these limitations, we have developed a novel transcriptional regulatory system capable of conditionally controlling endogenous gene expression in a reversible and tunable manner in mice using engineered prokaryotic binary transcriptional regulatory systems10. Prokaryotic binary transcriptional regulatory systems with regulatory ligands, such as lac and tet, have enabled such reversible and tunable expression control11,12,13,14. However, the inadequate repression potency of the current binary systems has impeded their broad adoption for controlling endogenous gene expression in mammals. We developed an enhanced lac repression system sufficiently potent for the repression of endogenous genes and employed a novel strategy of targeting tet transcriptional activators directly to the cognate promoter of an endogenous gene to achieve robust upregulation (Figure 1)10. With this technology, we have achieved nearly two orders of magnitude expression control of the endogenous Dnmt1 gene in a tunable, inducible, and reversible manner10. Here we provide step-by-step instructions for its in vivo application to other genes and organisms using mice as a model species.

Figure 1: Overview of the REMOTE-control system. The transcription of an endogenous target gene can be regulated using engineered lac repressor and tet activator systems. The target gene promoter or intron is engineered to contain operators for the tight-binding LacIGY repressor and/or the rtTA-M2 activator. R indicates Repron (Repression intron), which contains 12 symmetric lac operators (S) plus a partial rabbit beta-globin intron. T indicates tet operator. The repressor and/or activator is/are expressed from a tissue-specific promoter. The expression of the target gene can then be reversibly tuned to the desired expression level by administration of IPTG (isopropyl β-D-1-thiogalactopyranoside, an antagonist of the LacIGY repressor) or Doxycycline (Dox). This figure has been modified from Lee et al.10 Please click here to view a larger version of this figure.
Before beginning this protocol, review Table 1 to identify the relevant steps for the desired control of gene expression. For example, to engineer a mouse that enables reversible downregulation of “Gene X”, complete sections 1, 3, and 4 of the below protocol. Table 1 also summarizes the needed components of the REMOTE-control system.
| Desired Expression Change | Repression only | Activation only | Both Repression and Activation |
| Relevant Sections of Protocol | 1, 3-4 | 2-4 | 1-4 |
| REMOTE-control Sequence Needed in Target Gene | Repron ("Repression intron"; 12 symmetric lac operators plus a partial rabbit beta-globin intron) | Tet operator(s) | Repron and Tet operator(s) |
| REMOTE-control Sequence Location | Intron | Promoter | Intron & Promoter |
| Activator/Repressor Needed for Desired Control | LacIGY Repressor | rtTA-M2 Activator | LacIGY Repressor and rtTA-M2 Activator |
| Regulatory Ligands | IPTG | Doxycycline | IPTG and/or Doxycycline |
Table 1: Overview of REMOTE-control components.
All animal procedures were conducted with the approval of the Institutional Animal Care and Use Committee (IACUC) of the University of Southern California and the Van Andel Research Institute and in compliance with the Guide for the Care and Use of Laboratory Animals from the National Institutes of Health15.
1. Modify the gene of interest for repression by REMOTE-control
2. Modify the gene of interest for upregulation by REMOTE-control
3. Develop activator- and/or repressor-expressing mice
4. Manipulate gene expression in vivo
The repression capability of the REMOTE-control system has been demonstrated in two different approaches thus far. In the first approach, lac repressor binding sites were inserted at the endogenous promoter of the Dnmt1 gene. In the second approach, which is recommended by this protocol, the repressor binding sites were inserted into a downstream intron to avoid the potential risk of affecting promoter function by the insertion and thereby to simplify application of the REMOTE-control system. Both approaches resulted in successful repression (Figure 2A,B and Figure 3A-C)10. Dnmt1 expression was repressed to 15% of the unregulated levels using the promoter-based approach (Figure 2A). This tight repression was reversed in a dose-dependent manner by treating mice with varying amounts of IPTG (Figure 2A). The observed Dnmt1 repression was validated at the protein level by immunostaining (Figure 2B). We did not observe any noticeable difference in Dnmt1 expression between Dnmt1+/+ and Dnmt1LO/LO mice, confirming that our lac operator insertion had not disrupted normal promoter function10. The intron-based approach achieved more than 90% repression from operators located several kilobases downstream of the transcription start site by attenuating transcription elongation (Figure 3A, B)10. This intron-based approach was further validated on seven additional robust promoters (Figure 3C). Invariably tight repression was achieved from all of the promoters tested. No correlation between the residual expression levels and the strengths of the promoters was observed, suggesting that the repression capacity of our intron-based repression system exceeds the transcriptional potency of all of the robust promoters we tested (Figure 3C).
The in vivo upregulation capability of the REMOTE-control system was also demonstrated on the Dnmt1 gene. We introduced two copies of the tet operator into the Dnmt1 promoter, together with lac operator sequences, to allow for either upregulation or downregulation depending on which effector protein is present. Robust upregulation and downregulation of Dnmt1 expression, close to two orders of magnitude (10% to 650%), were achieved in ESCs containing the modified endogenous Dnmt1 allele (Dnmt1LGT) (Figure 4A)10. Both regulations were fully reversible and inducible by IPTG and Dox treatments, respectively (Figure 4A). We next introduced the Dnmt1LGT modification into the mouse germline to test the in vivo upregulation capability of the REMOTE-control system. Strong upregulation of Dnmt1 was observed from the liver, spleen, and kidney, whereas no detectable upregulation in the heart was observed (Figure 4B)7. The cell cycle-dependent expression pattern of Dnmt1 and the scarcity of proliferative cells in the heart may underlie this observation10,56. It remains to be seen whether this limitation can be overcome by increasing the expression level of the activator or the number of its binding sites.

Figure 2: In vivo repression of Dnmt1 by the LacIGY repressor. (A) Mice with lac operators (LO) inserted into the Dnmt1 promoter, with or without expression of LacIGY, were treated with various doses of IPTG. qRT-PCR analysis of Dnmt1 expression shows the dose-dependent reversal of Dnmt1 repression in vivo by IPTG treatment. Each bar represents data from a different mouse. Data represent mean ± SEM (n = 3). (B) Immunostaining of Dnmt1 protein in colonic crypts of mice provided drinking water with or without 160 mM IPTG for 3 weeks. This figure has been modified from Lee et al.10 Please click here to view a larger version of this figure.

Figure 3: In vivo and in vitro repression of various promoters by the REMOTE-control system. (A) An early version of the Repron sequence (R*) was inserted into an intron downstream of the Villin promoter in a Villin-mKate2 transgenic mouse (VilmKate2). qRT-PCR analysis of mKate2 expression in the small intestine of mice with or without the LacIGY repressor is shown. Each bar represents data from a different mouse. (B) Confocal mKate2 images of the small intestine with and without LacIGY expression. (C) Six symmetric lac operators (S) were inserted between various promoters and a luciferase reporter. Reporters (50 ng/well in 96-well plate) and repressor plasmids were transiently introduced into NIH/3T3 cells in a 1:1 molar ratio. Luciferase values were assessed 24 h after transfection. These in vitro data represent the percent of luciferase expression in LacIGY-expressing cells relative to those expressing non-functional LacI (NFlacI). T-tests were used to determine statistical significance. Data represent mean ± SEM (n = 3). *P ≤ 0.05, **P ≤ 0.01. This figure has been modified from Lee et al.10 Please click here to view a larger version of this figure.

Figure 4: Down- and/or upregulation of Dnmt1 expression in vitro and in vivo. (A) The complete REMOTE-control system was engineered in cultured ESCs by gene targeting and electroporation approaches. Maximal repression of Dnmt1 expression was achieved with no treatment while maximal activation was achieved by both IPTG and Dox treatment. Data represent mean ± SEM (n = 3). *P ≤ 0.05, **P ≤ 0.01 (Welch’s t-tests). (B) In vivo activation of Dnmt1 by the REMOTE-control system, as demonstrated by immunostaining of Dnmt1 protein in various tissues from REMOTE-control mice. The LGT allele represents promoter modification of Dnmt1 to contain lac operator and tet activator binding sites. Mice were treated with a normal or Dox-containing diet (5000 mg/kg Doxycycline Hyclate) for one month. This figure has been modified from Lee et al.10 Please click here to view a larger version of this figure.

Supplementary Figure 1: Example of landing pad insertion into murine Dnmt1 intron 1. (A) Schematic of DNA template for landing pad insertion, adapted from Quadros et al. (2015)31. Heterotypic loxP sites, JT15 and Lox2272, are separated by a short spacer sequence (sp) and flanked on each side by 60-bp of DNA that is homologous to the target genomic region. (B) Sample DNA template for landing pad insertion into the Dnmt1 intron using the following sgRNA: CTAGTACCACTCCTGTACCG (which targets the reverse strand). The selected intronic region was bioinformatically informed by step 1.1, and the sgRNA was identified using CRISPOR29. (C) Example of PCR primer design for assessing insertion of the landing pad. PCR primers were designed outside of the homology arms of the template to confirm integration into endogenous Dnmt1. The wildtype PCR amplicon is 213 bp; upon insertion, it becomes 291 bp. Please click here to view a larger version of this figure.
A critical step and potential limitation of the REMOTE-control system is the challenge associated with the insertion of the repressor and/or activator binding sites without affecting target gene expression. Our original repression approach, as applied to the Dnmt1 gene, involved insertion of lac repressor binding sites within transcriptionally critical regions of a promoter. In order to reduce the risk of affecting promoter function and thus to improve the general applicability of the REMOTE-control system, we developed an intron-based repression approach. The potency of our enhanced lac system allowed us to tightly repress the transcription of all the strong promoters we tested at operators located hundreds to several kilobases downstream of the transcription start sites (Figure 3A–C)10. Importantly, the levels of repression were independent of the transcriptional strengths of the promoters (Figure 3A–C)10. This suggests that the repression capacity of our intron-based repression system exceeds the transcriptional strength of the tested promoters. In this intron-based approach, it is likely that the repression is mediated through physical interference between two components, the transcription elongation machinery and the lac repressors57. This simple repression mechanism and the demonstrated robustness of the intron-based method may render this approach generally applicable to different genes, tissues, and organisms.
The upregulation by the REMOTE-control system requires the transactivator binding sequences to be in proximity to the target gene promoter, which entails a risk of affecting promoter function. However, we found that the position of binding sequences can be outside of the transcriptionally critical region. Both Dnmt1 and EF1α promoters were robustly upregulated from tet operators located a couple of hundred bases upstream of the transcription start sites10. This relaxed constraint greatly reduces the chance of affecting promoter function of a target gene in the absence of the transactivator. Increasing the number of binding sequences and/or use of stronger transactivators could help further reduce the risk by enabling upregulation from sites farther away from the transcription start site.
Our REMOTE-control system provides elegant control of the level, timing, and location of endogenous gene expression, allowing for testing the reversibility of a phenotype and the consequences of different expression levels, which are not readily achievable by current in vivo gene expression-control technologies. It is important to note that in most gene expression analyses, including ours, expression values represent the average of a population of cells among which considerable variation can be found. This heterogeneity may influence cellular decision-making processes, such as differentiation or apoptosis58. Though the precision of gene expression control could likely be further improved by additional genetic circuit engineering59, the observed potency of our current system will allow useful investigation of gene function in many biological contexts. In addition, a high degree of target specificity is expected because of the complexity of the operator sequences as well as the large evolutionary distance between mammals and the originating species of the regulatory components60. Furthermore, transgenic mouse lines of repressors and activators can be developed and employed for any endogenous gene. For example, existing tet transactivator mouse models can be adapted to accomplish upregulation of a target gene in the desired mouse tissues. We recently developed a transgenic line that can drive robust tissue-specific expression of our enhanced lac repressor in multiple tissue types when combined with existing Cre lines by introducing the lacIGY gene into the Hipp11 locus48 under the control of a Lox-STOP-Lox element (unpublished). This line would substantially facilitate the tissue-specific application of the REMOTE-control system.
Gene upregulation by the REMOTE-control system provides several advantages in comparison to current inducible transgenic approaches. It does not require generation of multiple transgenic lines to test for position effects of the insertion, as it utilizes the endogenous locus. Additionally, this approach is well-suited for upregulation of genes with strong baseline expression because it enhances expression from an already robust promoter, whereas conventional transgenic models rely on minimal viral promoters. Lastly, the tissue specificity, cell-cycle control, and splicing variants of a target gene may be retained upon upregulation by our approach, as it preserves elements of natural regulation such as innate cis-regulatory elements. The advent of CRISPR/Cas-mediated gene-targeting technology will greatly facilitate the application of this technology in diverse model systems.
PWL serves on the Scientific Advisory Boards of AnchorDx and Progenity, Inc.
We thank the late Dr Heidi Scrable for her generous gift of the mammalian lacI gene construct (Mayo Clinic, Rochester, MN), Dr Daniel Louvard (Institut Curie, Paris, France) for providing the Villin promoter, and Dr Laurie Jackson-Grusby (Children’s Hospital, Boston, MA) for her contributions to the early stages of this technology development. We are grateful for Dr Nancy Wu and Dr Robert Maxson for their assistance in generating the transgenic and knockout mice. We thank the members of the Laird laboratory for helpful discussions and support. This work was supported by the National Institutes of Health [R01 CA75090, R01 DA030325, R01 CA157918, and R01 CA212374 to P.W.L. and 1F31CA213897-01A1 to N.A.V.S].
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| B6C3F1/J | The Jackson Laboratory | 100010 | https://www.jax.org/strain/100010 |
| Cas9 Protein | PNA Bio | CP04 | http://www.pnabio.com/products/CRISPR_Cas9.htm?gclid=EAIaIQobChMIsoG8pLL33QIVBr7ACh0naQ4dEAAYAiAAEgKyHvD_BwE |
| CRISPOR | Haeussler et al. 2016 | http://crispor.tefor.net/ | |
| Doxycycline-Containing Mouse Diet | Envigo | Varies by concentration | https://www.envigo.com/products-services/teklad/laboratory-animal-diets/custom-research/doxycycline-diets/ |
| ENCODE Database | Stanford University | https://www.encodeproject.org/ | |
| iCre mRNA synthesis plasmid (pBBI) | Addgene | 65795 | https://www.addgene.org/65795/ |
| IPTG | GoldBio | I2481C | https://www.goldbio.com/search?isSearch=Y&q=iptg |
| pGL3-Basic | Promega | E1751 | https://www.promega.com/products/reporter-assays-and-transfection/reporter-vectors-and-cell-lines/pgl3-luciferase-reporter-vectors/?catNum=E1751 |
| SVM-BPfinder | Regulatory Genomics, Pompeu Fabra University | http://regulatorygenomics.upf.edu/Software/SVM_BP/ | |
| TiProD: Tissue specific promoter Database | Department of Bioinformatics, UMG, University of Göttingen | http://tiprod.bioinf.med.uni-goettingen.de | |
| UCSC Genome Browser | University of California Santa Cruz | https://genome.ucsc.edu/ |