Presented here is a protocol to use the CRISPR-Cas9 system for reducing the production of a protein in the adult honeybee brain to test antibody specificity.
Method Article
Presented here is a protocol to use the CRISPR-Cas9 system for reducing the production of a protein in the adult honeybee brain to test antibody specificity.
Cluster Regularly Interspaced Short Palindromic Repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) is a gene editing technique widely used in studies of gene function. We use this method in this study to check for the specificity of antibodies developed against the insect GABAA receptor subunit Resistance to Dieldrin (RDL) and a metabotropic glutamate receptor mGlutR1 (mGluRA). The antibodies were generated in rabbits against the conjugated peptides specific to fruit flies (Drosophila melanogaster) as well to honeybees (Apis mellifera). We used these antibodies in honeybee brain sections to study the distribution of the receptors in honeybee brains. The antibodies were affinity purified against the peptide and tested with immunoblotting and the classical method of preadsorption with peptide conjugates to show that the antibodies are specific to the corresponding peptide conjugates against which they were raised. Here we developed the CRISPR-Cas9 technique to test for the reduction of protein targets in the brain 48 h after CRISPR-Cas9 injection with guide RNAs designed for the corresponding receptor. The CRISPR-Cas9 method can also be used in behavioral analyses in the adult bees when one or multiple genes need to be modified.
The recently discovered CRISPR/Cas9 system is a powerful tool that has been used to alter genomic DNA in various model systems and organisms. It has accelerated biomedical research and major technological breakthroughs by making genome modification more efficient and robust than previous methods1. Native to S. pyogenes bacteria, the system relies on a Cas9 endonuclease, whose activity leads to double-stranded breaks (DSBs) in DNA, and a guide RNA (gRNA) that directs the Cas9 protein to a specific, sequence-dependent location2. Double-stranded breaks generated by CRISPR/Cas9 can be repaired via non-homologous end-joining (NHEJ), an error-prone process that can lead to frameshifts, or homology direct repair when a donor template is present. The gRNA itself consists of a target-specific CRISPR RNA (crRNA) and a universal trans-activating crRNA (tracrRNA) which can be chemically synthesized and delivered with purified Cas9 nuclease as a ribonucleoprotein complex (RNP)2,3. Fluorescent labeling of the gRNA or Cas9 nuclease can allow for the detection and intracellular visualization of molecular components via fluorescent microscopy4.
In our present work, we take advantage of the CRISPR-Cas9 system to reduce the protein levels in adult honeybee brains. We studied the metabotropic glutamate receptor (mGluR) and anti-mGlutR1 receptor antibodies and the GABAA receptor subunit RDL and anti-RDL antibodies. We developed a simple method to reduce the amount of protein in the brain of the adult honeybee and used it to drive additional tests of the antibodies developed against the corresponding proteins. Monitoring the fluorescence of CRISPR-Cas9 allowed us to estimate the areas and cells involved in the reduction of the protein.
Using this method, we also characterized the anti-mGlutR1 antibodies that were made in rabbits against the conjugated peptide. The honeybee genome encodes a highly conserved AmGluRA (named mGlutR1 according to NCBI nomenclature) metabotropic glutamate receptor5. The honeybee mGlutR1 gene has four predicted splice variants according to the NCBI database. It has been reported that it is expressed in the central nervous system (CNS) of both pupal and adult bee stages and it is involved in long-term memory formation5. Antibodies developed against mGlutR1 can be an essential tool for studying of the glutamatergic system in the learning and memory process in honeybees.
In our studies, we also characterized anti-RDL antibodies developed in rabbits immunized with conjugated peptides from the Apis mellifera RDL receptor subunit. The honeybee Rdl gene, AmRdl (XM_006565102.3, NCBI database), has 14 predicted splice variants. A partially cloned fragment has been reported in the NCBI database AF094822.1. The RDL receptor function and its physiology is well studied in insects6,7,8, including honeybees9,10,11. Antibodies developed against anti-RDL can be an essential tool for studying the GABAergic system in the learning and memory process in honeybees.
An earlier study on the role of octopamine and tyramine receptors used RNAi injected into the brain with a subsequent test of the amount of protein by Western blot12,13. However, RNAi has some significant limitations. There is only a short time window after RNAi injection within which a reduction of protein occurs13. CRISPR-Cas9 was used very recently in honeybee embryos to delete or modify genes in the entire animal14,15,16. We reported the use of CRISPR-Cas9 to reduce the amount of the protein in the adult honeybee. We developed this approach for honeybees because of the ability to couple it to behavioral studies of learning and memory under controlled laboratory conditions17.
In the present work, we developed antibodies against two receptors and tested them on the adult honeybee brain sections after the protein was reduced by CRISPR-Cas9 injection. At the same time, we established an experimental design that allows use of the method for behavioral experiments.
The protocol described here follows the animal care guidelines of Arizona State University.
1. Total Protein Isolation from Brains of Apis mellifera
NOTE: Use Apis mellifera New World Carniolan foragers of unknown age for this experiment.
2. Western Blotting19
3. Immunocytochemical Procedures
4. Test of RDL and mGlutR1 Protein Expression by Immunocytochemistry (section 3) in Honeybee Brain After Injection of the Corresponding CRISPR-Cas9 System
5. Injection Procedure
6. qPCR-based Drop-off Assay to Evaluate the Modified Genomic RDL DNA 48 H After CRISPR Cas9 RNPRDLmix Injection
and 
7. Relative Quantification of RDL RNA 48 H After RNPRDLmix Injection
8. qPCR Based drop-off Assay to Evaluate the Modified Genomic DNA 48 H After RNPmGlutR1mix Injection
and 
9. Quantification of mGlutR1 RNA 48 h After RNPmGlutR1mix Injection
Anti-RDL antibody tests
The antibodies were produced against the RDL peptide conjugates as shown in Figure 1A. The first step in characterizing the anti-RDL antibodies is to check the homogenate of the protein extracted from the bee brain using a Western blot with anti-RDL antibodies and a HRP-labeled goat anti-rabbit IgG secondary antibody (Figure 1A, insert). Both anti-RDL antibodies recognized the band located at ~50-60 kD (arrow), corresponding to the estimated weight of the RDL subunit isoform proteins. To demonstrate that anti-RDL antibodies recognized the peptide in the brain slices, we used a preadsorption control (Figure 1B,C). When antibodies were preincubated with conjugated peptides, the staining on the section was absent. This demonstrated that the anti-RDL antibodies recognized the conjugated peptide against which they were raised. In order to demonstrate that the anti-RDL antibodies recognize the protein in the fixed brain tissue, we used CRISPR-Cas9 to knock out the RDL gene that produces the RDL protein in the cells. Figure 1D1-3, shows control frontal bee brain sections that were labeled with anti-RDL antibodies. This bee was not injected with RDL-CRISPR-Cas9 RNP. In Figure 1D1, anti-RDL labels neuropils in the frontal section of the bee brain. The same frontal section in Figure 1D2 shows the absence of fluorescence from ATTO550, because the RDL-CRISPR-Cas9 complex was not injected.
Figure 1E1-E3 shows a brain section from a bee injected with RDL-CRISPR-Cas 9 and then processed with the same amount of antibodies as the control brain in Figure 1D1-D3. The anti-RDL staining was significantly reduced in the whole brain 48 h after the injection, and the distribution of the ATTO550 staining in the brain (Figure 1E2) shows the success of the RDL-CRISPR-Cas 9 injections in the bee median ocelli. The multiple scattered cells of the brain exhibit ATTO550. The successful injection of RDL-CRISPR-Cas 9 reduced the protein expression compared with the control (Figure 1E1-3). From eight immunostained bee brains, only one brain had a high level of distribution of the RDL-CRISPR-Cas9 in the cells of mushroom body, protocerebrum, and antennal lobe, whereas other brains had cell staining with ATTO550 in the mushroom body calyx, central complex, but not antennal lobe. It is important to note that in these bees, reduction anti-RDL immunostaining was not as dramatic as in the brain shown in Figure 1E1.
Next, to estimate the level of the modified RDL gDNA in the bees 48 h after RDL-CRISPR-Cas9 injection, we performed a qPCR drop-off test, where the drop-off probe was designed to match the area of one of the RDL gRNAs. In these experiments, in the bee brains injected with RDL-CRISPR-Cas 9, the relative reduction of the fluorescence corresponded to the number of the modified gDNA in the samples. In our tests the area corresponding to this guide in gDNA in 12 bees injected with RDL-CRISPR-Cas9 were 64 % ± (mean ± 30 %SD) compared with gDNA in noninjected bees (Figure 3A).
Next, to estimate the level of the RDL RNA in the bees 48 h after injection, we performed qRT-PCR in a separate group of bees (Figure 3B). We compared the level of RDL RNA of RDL-CRISPR-Cas 9 injected bees (n = 19) with the level of RNA in bees that were not injected (n = 12). In these experiments, the relative reduction of the mRNA RDL was 59% ± (mean ± 15% SE) compared with the level of RNA in non-injected bees. When we examined the level of RDL RNA in each bee individually, only 13 bees out of 19 bees showed a significant reduction of the RNA. These data indicate that injection of RDL-CRISPR-Cas9 through the ocelli might not always reach a large number of brain cells, which confirms the data with RDL immune-stained RDL-CRISPR-Cas9 injected bees. In these preparations, only one bee out of 8 had RDL CRISP-Cas9 in many brain cells (mushroom body, protocerebrum, and antennal lobe) compared with other bee brains, where the distribution of the RDL-CRISPR-Cas9 was concentrated in cells in the protocerebrum (mushroom body calyx and central complex) but not the antennal lobe (Figure 4A-D).
Anti-mGlutR1 antibodies tests
We used the anti-mGlutR1 antibodies produced in rabbit against conjugated peptides specific to Drosophila melanogaster (Figure 2A). The sequence of this peptide shows a 94% identity with the bee peptide (CLSDKTRFDYFARTVPPD) Figure 2A. First, we checked the antibodies against the bee brain protein using immunoblotting. The bee brain homogenate was separated by 10% SDS-PAGE and electrophoretically transferred from to a nitrocellulose membrane and stained with anti-mGlutR1. The insert in Figure 2A shows two bands with estimated weights (103 and 83 kD) corresponding to two isoforms. When we tested this antibody on honeybee brains, we found that they label neuropilar profiles and cells in the bee brain sections as illustrated in Figure 2B,D. After preadsorption of the anti-mGlutR1 antibody with conjugated-mGlutR1 peptide, the specific staining disappeared in the bee brain slice (Figure 2C). This confirms that anti-mGlutR1 antibodies recognize the peptide (Figure 2C). Next, we injected a mix of mGlutR1-CRISPR-Cas9 in the median ocelli and used the control noguideRNA. In control bees (n = 7), the fluorescence from ATTO550 was not concentrated in the cells. Some brains had scattered fluorescence ATTO550 labeling. Thus, the control preparation in Figure 2D1-3 shows anti-mGlutR1 staining in the brain but not the ATTO550 fluorescence. When mGlutR1-CRISPR-Cas9 was injected into the ocelli and taken up by many cells, the level of fluorescence of the secondary antibodies was significantly reduced in the area that uptakes the functional mGlutR1RNP (Figure 2E1-3). The bees were monitored for 48 h, and one bee from each experimental condition was found dead. Thus, in this experiment, we checked seven control bees and eight CRISPR-Cas9 bees. All the bees injected with CRISPR-Cas9 had cells that took in mGlutR1-CRISPR-Cas9. Most of these cells were in the mushroom body calyx, central complex, and posterior protocerebrum. Only two bees out of seven showed ATTO550 labeling in many cells in the mushroom body, central complex, and the antennal lobe. An example of one of these bees is shown in Figure 2E. The reduction of the level of mGlutR1 staining in these preparations was significant. The other five bees have ATTO550 labeling corresponding to the successful delivery of the mGlutR1 CRISPR-Cas9 in the mushroom body and posterior protocerebrum but not in the antennal lobes.
Next, to estimate the level of the modified mGlutR1 gDNA in the bees 48 h after injection, we performed a qPCR-based drop-off test, where the drop-off probe was designed to be in the area near the mGlutR1 guide. In these experiments, in the bee brains injected with mGlutR1-CRISPR-Cas 9, the relative modification of gDNA in 12 bees were 59% ± (mean ± 33 %SD) compared with gDNA in noninjected bees (Figure 3A).
These results were also confirmed by qRT-PCR tests in a different group of bees, where we estimated the mGlutR1 RNA levels using qRT-PCR in the bees 48 h after injections with RNPmGlutR1mix (Figure 3B). We compared the level of mGlutR1 RNA of the mGlutR1-CRISPR-Cas9 injected bees (n = 6) with the RNA levels in bees that were not injected (n = 6). In these experiments, the relative reduction of the mRNA mGlutR1 in injected bees was 53% ± (mean ± 18% SE) compared with uninjected bees (Figure 3B).
The section from four different bees that expressed the RNP RDL-CRISPR-Cas9 in Kenyon cell of mushroom body is shown in Figure 4A-D. The example bee with ATTO550 fluorescence in the mushroom body and the antennal lobe is shown in Figure 4E,F.
| Guides | Sequences | gRNA | RNP |
| [guideRNA:tracrRNA] | [gRNA:Cas9 Nuclease] | ||
| RDL_Guide1 | ACCGTAACGCGACCCCCGCT | GRDL1 | RRDL1 |
| RDL_Guide2 | AACGTCGATCGACTTGACGT | GRDL2 | RRDL2 |
| RDL_Guide3 | CCATGACGAAACACGTGCCC | GRDL3 | RRDL3 |
| mGlu_Guide 1 | CGAAAGTTATCTGACGGTGT | GMGL1 | RMGL1 |
| mGlu_Guide 2 | TTCAACGAGAGCAAGTTCAT | GMGL2 | RMGL2 |
| mGlu_Guide 3 | GCAAACGTCGGTAGGAGTGA | GMGL3 | RMGL3 |
Table 1: Nucleotide sequences of guides designed for RDL and mGlutR1.

Figure 1: Characterization of anti-RDL antibodies. (A) Schematic of the RDL subunit, where the pink circles indicate the localization of peptide 2 (extracellular CVNEKQSYFHIATTSNEFIRI-amide) in the N-terminus and peptide 1 (intracellular CVRFKVHDPKAHSKGGTL-amide) in the C-terminus. The insert in A shows the bands in the Western blot of honeybee brain extracts processed with corresponding anti-RDL antibodies (one with anti-RDL pep1 and anti-RDL pep2). Each immunoblot shows the apparent size of the protein ~50-60 kD, corresponding to the estimated weights of the various isoform of the RDL subunits. (B,C) Preadsorption of the anti-RDL antibodies with conjugated peptide 1. The image in C shows a reduction in staining in the section when the antibodies were preincubated with conjugated peptide 1. The fan-shaped body (Fb) and Ellipsoid body (eb) are central complex structures in the brain. M = medial lobe of mushroom body. (D1-3) Anti-RDL staining of a control, uninjected bee brain section after 48 h. Green indicates the anti-RDL positive profile in the brain. (D2) This bee was not injected and does not contain ATTO550 fluorescence. (D3) Merged images from D1 and D3. (E1-3) The injection of RDL-CRISPR-Cas9 reduced anti-RDL staining after 48 h. (E2) ATTO550 fluorescence in the cell nuclei indicated successful RDL-CRISPR-Cas9 delivery. (E3) The merged image of anti-RDL (green) and ATTO550 (red). Scale bar = 100 μm (B-E). Please click here to view a larger version of this figure.

Figure 2: Characterization of anti-mGlutR1 antibodies. (A) Schematic of GCPR mGluR that shows the Drosophila melanogaster peptide used for immunization. For comparison, the Apis mellifera peptide is shown below. The circle indicates the localization of the peptide in the N-terminus of the mGlutR1 receptor extracellular domain. The insert in A shows that the anti-mGlutR1 antibodies recognized two bands in the Western blot of bee brains ~103 kD and ~83 kD that correspond to the estimated weights of known isoforms. (B,C) Preadsorption control of the anti-mGlutR1 antibody in two consecutive sections of the antennal lobe glomeruli. Image of anti-mGlutR1 in the antennal glomeruli section in C shows the reduction of the staining as a result of preincubation of the anti-mGlutR1 peptide with the anti-mGlutR1 antibody. This procedure causes the antibody to precipitate out of solution, which abolishes staining in comparison with B (control, absence of the peptide in the preincubation). (D1) shows staining of anti-mGlutR1 in a bee brain slice after a control injection in the median ocellus. This injection lacked the mGlutR1 gRNA that enables the knock down of mGlutR1 receptors by CRISPR-Cas9, and thus the staining of the anti-mGlutR1 antibody was not reduced (green). (D2) The Absence of ATTO550 fluorescence indicates the absence of functional CRISPR-Cas9 in the brain. (D3) Merged images of anti-mGlutR1 and ATTO550. (E1-E3) show the staining of anti-mGlutR1 in a brain section where mGlutR1 has been permanently knocked down 48 h after injection with mGlutR1-CRISPR-Cas 9 in the median ocellus. Thus, the staining in this brain is greatly reduced due to the successful knockout of the mGlutR1 in many cells. (E2) ATTO550 staining in many cell nuclei in the bee brains indicates that injection of mGlut1-CRISPR-Cas 9 was successful. (E3) Merged image of ATTO550 (red) and anti-mGlutR1 (green). Scale bar = 10 μm (B,C); 100 μm (D,E). Please click here to view a larger version of this figure.

Figure 3: Evaluation of modified gDNA and expression of mRNA of RDL and mGlutR1 mRNA in bee brains 48 h after injection with 345 nL of corresponding RPN CRISPR-Cas9. (A) The qPCR-based drop-off assay test to evaluate the amount of gDNA with a modify area were calculated using 2-ΔΔCt method and normalized against control, uninjected brains. The data are expressed as mean + SD. (B) TheqRT-PCR test was used to evaluate the amount of mRNA in CRISPR-Cas9 injected and uninjected bees. AmActin was used as a reference gene. The relative gene expression was calculated using 2-ΔΔCt methods and normalized against control, uninjected brains. The data are expressed as mean + SE. Please click here to view a larger version of this figure.

Figure 4: Example of the distribution of RNP CRISPR-Cas9 in bee brains via ATTO550 fluorescence. (A-D) The brain sections from four different bees that expressed the RNP RDL-CRISPR-Cas9 in the Kenyon cell of the mushroom body. (E,F) Example of two brains 48 h after injection with RNPmGlutR1 CRISPR-Cas9. Scale bar = 150 μm (A-F). Please click here to view a larger version of this figure.
Characterization of the anti-RDL and anti-mGlutR1
First, we characterized the anti-RDL and anti-mGlutR1 antibodies by immunoblot and pre-adsorption on the slices of fixed honeybee brains. Each antibody was made to recognize all its known isoforms, and Western analysis show they recognize bands that correspond to their predicted molecular weights. Next, both antibodies were blocked by the conjugated peptide against which they were produced on honeybee brain sections.
One of the first aims in our study was to establish that the antibodies produced against the specific conjugated peptide are specific to its protein in fixed brain tissue. For that purpose, we took advantage of the CRISPR-Cas9 system. We designed specific guides for honeybee RDL and mGlutR1 and used each of them to make CRISPR-Cas9 labeled with the fluorescent probe ATTO550. For each receptor, we injected a mixture of three different CRISPR-Cas9 ribonucleoproteins in the ocelli to reduce the amount of the targeted protein in the adult honeybee brain by eliminating the corresponding gene in cells that took up our designed Cas9 system. In our study, we accomplished this step.
One of the first crucial steps for the success of these experiments is designing the appropriate guide RNAs. We recommend designing up to five guide RNAs, located at the beginning, middle, and the end of the gene sequence. In our preliminary work, we tested them in various combinations on three to five bees. We also tried different concentrations of injections, as well as times after injection, and various mixtures of RNP in the injections. We dissected out brains and processed them using anti-RDL and anti-mGlutR1 antibodies. In these initial tests, we established the appropriate combination, post-injection time, as well as the concentration and amount of CRISPR-Cas9 for injection. These initial tests were the basis for setting up the experiments that we described in detail here.
The aim was two-fold: 1) to demonstrate in a bee that our antibody staining was reduced after treatment with CRISPR-Cas9 and 2) to work through the best experimental conditions for behavioral studies. Thus, we show that if many cell nuclei contain CRISPR-Cas9 48 h after injection, the reduction of the anti-RDL and anti-mGlutR1 staining is significant. Additionally, that demonstrates that the tested antibodies specifically recognize the mGlut1 and RDL protein in the honeybee brain preparation and that they can be used for localization studies in the honeybee brain.
Experimental setting CRISPR-Cas9 for behavioral study
Next, we set up the experiments so that CRISPR-Cas9 could be used in behavioral studies. Eight or nine honeybees were collected for control and experimental treatments. They were behaviorally tested before and after injection, and then their brains were processed for ATTO550 and/or immunocytochemistry to determine the brain regions that showed reduction of the target protein. Here it is essential to note that the number of bees taken for one set of experiments was limited to no more than 8-9 bees for the control and experimental conditions. This way both conditions could be tested on the same day. Also, once we prepared the CRISPR-Cas9 mixtures for injection, we never froze them. The CRISPR-Cas9 mixture did not change in potency when used 3 days in a row and kept at 4-8 °C. However, we did not test it after 3 days.
As we described in the Results section for both sets of experimental injections and for both antibodies, only three bees from 16 tested showed a large distribution ATTO550 in the mushroom body, protocerebrum, and antennal lobes. In all other bees, the distribution of CRISPR-Cas9 was limited to the mushroom body, central complex, and/or posterior protocerebrum. It is essential to understand for any behavioral studies that using this injection method the reduction of target protein will be restricted only to the mushroom body in most of the bees. It will not extend to the antennal lobe or subesophageal ganglion. Thus, the injection technique that we use is suitable to study the effect of the reduction of receptors in the mushroom body and central complex in behavioral experiments, while a different method of introducing CRISPR-Cas9 will be more appropriate for studying other brain regions.
In conclusion, our study demonstrated the successful application of CRISPR-Cas9 as a control for antibody staining in the brain. For both antibodies (anti-RDL and anti-mGlutR1), when the uptake of mGlutR1-CRISPR-Cas9 or RDL-CRISPR-Cas9 was successful, the level of corresponding antibody staining was also reduced significantly. Also, it is essential to note that injection in the ocelli led to a distribution of CRISPR-Cas9 in the brain that was not homogenous. The distribution varied from a minimal area surrounding the ocelli and mushroom body to many cells in the whole brain. The variability of the mGlutR1-or RDL-CRISPR-Cas9 uptake by the cells was likely due to variation in the injections. Our data show that the CRISPR-Cas9 system works in honeybees, but the method of injection needs to be improved to reduce the variability of CRISPR-Cas9 uptake across individual bee brains. Within these restrictions, it is now possible to employ this technique to manipulate genes in adult bees for behavioral experiments.
The authors have nothing to disclose.
This work was supported by the following awards to BHS: Human Frontiers Science Program; NIH NIGMS (R01 GM113967); NSF Ideas Lab (1556337). The peptide and antibodies for DmGluRA were designed in the laboratory Dr. Serge Birman (Marseille, Luminy, France) when IS was supported by Programme d'Urgence FRM/Postdocs UFP20060306548 from the Fondation pour la Recherche Medicale. We are thankful for Daniela Junqueira Marosi and Alex Hanter from Integrated DNA Technology (IDT) for the help with the design of RDL guides and qPCR drop-off assays.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| Acetic Acid | Sigma-Aldrich | A6283_100 mL | western blotting |
| Acrylamide-bis Acrylamide | Bio-Rad | 500 mL 1610156 | western blotting |
| Agarose | Sigma-Aldrich | A0169-250g | used with distilled water to fix honey bee brain in blocks |
| Alexa Fluor 488 AffiniPure F(ab')2 Fragment Donkey Anti-Rabbit IgG (H+L) | Jackson Research Laboratories | 711-546-152 | secondary antibody to reveal the primary antibodies from rabbit |
| Alt-R CRISPR-cas9 tracrRNA-5'ATTO | IDT | 1075934 | with desinged guide RNA, it creates gRNA |
| Alt-R S.p. Cas9 nuclease V3 | IDT | 1081058 | enzyme used to make ribonucleoprotein for CRISPR system |
| Ammonium Persulfate | Bio-RAD | 10 g 1610700 | western blotting |
| Anti-mGlutR1 antibodies | Covalab (FRANCE)/21st Century Biochemical | characterized by authors in present paper | Used for primary incubation of mGlut 1 in honey bees |
| Anti-RDL antibodies | 21st Century Biochemical | characterized by authors in present paper | Used for primary incubation of RDL in honey bees |
| Aprotinin | Sigma-Aldrich | Y0001154 | protease inhibitor |
| Barraquer Iris Scissors 7mm Blade Sharp point | World Precision Instruments | 14128-G | used for dissection honey bee brain |
| Benzamidine | Sigma-Aldrich | 12072 | protease inhibitor |
| Blade (breakable) for blade holder | Fine Science Tool | 10050-00 | dissection for western blotting |
| Blade holder and breaker | Fine Science Tool | 15309 | dissection for western blotting |
| Borosilicate glass capillaries | World Precision Instruments | 1B100 F | for injection procedure |
| Chemiluminescent western blot detection substrate | Bio-Rad | 1705062 | western blotting |
| Chloroform | Sigma-Aldrich | 472476-50mL | RNA isolation |
| Dithiothreitol | Bio-Rad | 1610611 | western blotting |
| DNA easy kit | QIAGEN | 69504 | DNA extractionuj |
| DNA-free kit | INVITROGEN | AM1907 | Used to remove DNA |
| Eppendorf Research plus pipette, 3-pack | Sigma-Aldrich | Z683884 | |
| Falcon 24 Well Polystyrene Multiwell | Falcon | 351147 | Multiwell |
| Flat Bottom Embedding Capsules, Polyethylene | Electron Microscopy Science | 70021 | basket for brain sections |
| Forceps Dumont #5 (pair) | Fine Science Tool | 11254-20 | for dissection of honey bee brain from the head |
| Forceps Dumont #5S (pair) | Fine Science Tool | 11252-00 | to clean up the brain from trachea befor dissection |
| Gene Expression Master Mix | Integrated DNA Technologies | 1055770 | qPCR drop off assay |
| Glutaraldehyde | EMS | 16220 | used for preparation of peptide conjugates for control peabsorption |
| Glycerol | Sigma-Aldrich | G5516-500 mL | western blotting, embedding media |
| Glycine | Bio-Rad | 1610718 | western blotting |
| Hydrophobic filtered nylonmesh | Spectrum Labs | 145910 | for bottom of basket for brain sections |
| Isopropyl alcohol | Sigma-Aldrich | I9030-50mL | RNA isolation |
| Keyhole limpet hemocyanin | Sigma-Aldrich | H7017 | used for preparation of conjugates for control |
| LSM800 cofocal microscope | Zeiss | ||
| mGlu_Guide 1 | IDT | designed guide RNA for CRISPR-Cas 9. Target mGlutR1 genome sequences | |
| mGlu_Guide 2 | IDT | designed guide RNA for CRISPR-Cas 9. Target mGlutR1 genome sequences | |
| mGlu_Guide 3 | IDT | designed guide RNA for CRISPR. Target mGlutR1 genome sequences | |
| methanol | Sigma-Aldrich | 34860 | western blotting |
| 96-well PCR microplate | Applied biosystem | 4346907 | qPCR drop off assay and qRT-PCR |
| 384-well PCR microplate | Sigma-Aldrich | Z374911 | qRT-PCR |
| Mineral oil | Sigma-Aldrich | M5904_500mL | for injection procedure |
| Model p87 Flaming Brown Micropipette Puller | Sutter Instrument Co. | Capillary Preparation | |
| Mowiol 4-88 | Sigma-Aldrich | 81381 | for embedding solution |
| Nanoliter 2000 | World Precision Instruments Nanoliter | Injection Apparatus | |
| Normal Donkey Serum | Jackson Research Laboratories | AB_2337258 | blocking agent for immunocytochemistry |
| Non-immune Goat Serum | Invitrogen | 50-062Z 100 mL | blocking agent for immunoblotting |
| Nuclease-free buffer | IDT | 1072570 | Nuclease-free buffer that is used in the preparation of CRISPR-Cas9 injection |
| Nuclease-free water | IDT | AM9337 | nuclease -free water that is used in preparation of CRISPR-Cas 9 system |
| OrbitalShaker Mp4 | Genemate | ||
| Paraformaldehyde | Sigma-Aldrich | 158127-500 g | used with PBS to make fixative for bee brains |
| Phenylmethylsulphonyl fluoride (PMSF) | Sigma-Aldrich | P7626-250 mg | protease inhibitor |
| Phosphate Buffer Saline | Sigma-Aldrich | P4417-100TAB | Used with Paraformaldehyde as fixative; buffer for antibodies |
Request permission to reuse the text or figures of this JoVE article
Request Permission