Method Article

In vivo Function of Differential Subsets of Cutaneous Dendritic Cells to Induce Th17 Immunity in Intradermal Candida albicans Infection

1.6K views

DOI:

10.3791/62731

July 20th, 2021

 ,  ,  ,  ,  ,  ,  , 

Corresponding Authors: Min-Geol Lee <mglee@yuhs.ac>, Tae-Gyun Kim <tgmed83@yuhs.ac>

In This Article

Summary

Here, we demonstrate the in vivo function of cutaneous dendritic cell subsets in Th17 immunity of deep dermal Candida albicans infection.

Abstract

The skin is the outermost barrier organ in the body, which contains several types of dendritic cells (DCs), a group of professional antigen-presenting cells. When the skin encounters invading pathogens, different cutaneous DCs initiate a distinct T cell immune response to protect the body. Among the invading pathogens, fungal infection specifically drives a protective interleukin-17-producing Th17 immune response. A protocol was developed to efficiently differentiate Th17 cells by intradermal Candida albicans infection to investigate a subset of cutaneous DCs responsible for inducing Th17 immunity. Flow cytometry and gene expression analyses revealed a prominent induction of Th17 immune response in skin-draining lymph nodes and infected skin. Using diphtheria toxin-induced DC subset-depleting mouse strains, CD301b+ dermal DCs were found to be responsible for mounting optimal Th17 differentiation in this model. Thus, this protocol provides a valuable method to study in vivo function of differential subsets of cutaneous DCs to determine Th17 immunity against deep skin fungal infection.

Introduction

The skin is the outermost barrier organ, which protects the body from invading external pathogens and stimuli1. Skin is composed of two distinct layers, including the epidermis-a stratified epithelium of keratinocytes-and the underlying dermis-a dense network of collagen and other structural components. As a primary epithelial barrier tissue, the skin chiefly provides physical barriers and contributes to additional immunological barriers as it contains numerous resident immune cells2,3. Among the cutaneous immune cells, dendritic cells (DCs) are a type of professional antigen-presenting cells, which actively take up self- and non-self-antigens and migrate to the regional lymph nodes (LNs) to initiate antigen-specific T cell responses and tolerance according to the nature of antigens4.

The skin harbors epidermal antigen-presenting cells, namely the Langerhans cells (LCs) and at least two types of DCs, including dermal type 1 conventional DCs (cDC1) and dermal type 2 conventional DCs (cDC2)5. Epidermal LCs are of embryonic monocytic origin and maintain their cell number by self-perpetuation under homeostatic conditions6. In contrast, dermal cDC1 and cDC2 are of hematopoietic stem cell origin and are continuously replenished by DC-committed progenitors5. Cutaneous DCs are characterized by their surface markers, roughly divided into Langerin+ (including LCs and cDC1) and CD11b+Langerin- populations (mainly cDC2). In addition, this group has revealed that the CD11b+Langerin- DC population is further classified into two subsets according to CD301b expression7.

The important functional features of cutaneous DCs are centered on a division of labor, determined mainly by the intrinsic nature of each subset of DCs, in situ locations of the DCs, the tissue microenvironment, and local inflammatory cues8. These functional characteristics of cutaneous DCs necessitate the investigation of the role of specific subsets of DCs during certain types of immune response of the skin. Upon antigenic stimulation by cutaneous DCs in the draining LNs, naïve CD4+ T cells differentiate into specific subsets of helper T cells, which produce a set of defined cytokines for exerting their effector function9. Among the CD4+ helper T cell subsets, interleukin-17 (IL-17)-producing Th17 cells play a crucial role in autoimmune diseases and antifungal immunity10. In this regard, cutaneous fungal infection has been a robust model to study Th17 immunity in vivo11,12,13. When tape-stripped skins are epicutaneously exposed to the Candida albicans (C. albicans) yeast, epidermal LCs play a pivotal role in driving antigen-specific Th17 differentiation14.

Protective immunity against intradermal C. albicans infection requires innate immunity such as the fibrinolytic activity of fibroblasts and phagocytes15. However, little is known about the role of cutaneous DC subsets in establishing Th17 immunity in deep dermal C. albicans infection. This paper describes a method of intradermal skin infection of C. albicans, which produces local and regional Th17 immune responses. The application of diphtheria toxin (DT)-induced DC subset depletion mouse strains revealed that CD301b+ dermal DCs are crucial for Th17 immunity in this model. The approach described here allows for the study of the Th17 response to deep dermal invasive fungal infection.

Protocol

NOTE: All animal experiments were approved by the Institution Animal Care and Use Committee (IACUC, Approval ID: 2019-0056, 2019-0055). Seven to 9-week-old wild-type (WT) C57BL/6 female mice weighing 18-24 g were used for this study. Some studies were performed using female Langerin-diphtheria toxin receptor (DTR) and CD301b-DTR mice of the same age and weight. Four to six mice were used in each group for an experiment, and the data are representative of three independent experiments. This work was conducted under Biosafety Level 3 conditions, which could also be carried out under Biosafety Level 2 conditions according to institutional guidelines (room temperature 23 °C ± 3 °C, humidity 50% ± 10%).

1. Preparation of Candida albicans

NOTE: Experiments in this section were performed in a biological safety cabinet.

  1. Streak C. albicans strain SC5314 onto a yeast-peptone-dextrose-adenine (YPDA) agar plate using an inoculation loop and needle.
  2. Incubate the plate upside down for 2 days at 30 °C.
    NOTE: The YPDA agar plate with C. albicans can be stored at 4 °C for up to 1 month.
  3. Isolate a single colony from the plate for inoculation into 10 mL of YPDA medium in a 50 mL tube using a sterile pipette tip.
  4. Incubate at 30 °C with shaking at 230-250 rpm for ~17 h.
  5. Place the yeast suspension in a cuvette, and measure the optical density (OD) at 600 nm every 30 min using a UV-VIS spectrophotometer until the OD600 reaches 1.5-2.0.
    NOTE: This step may take 16-18 h.
  6. Spin the yeast suspension at 1000 × g for 5 min.
  7. Discard the supernatant and resuspend the yeast cells in an appropriate amount of sterile phosphate-buffered saline (PBS).
  8. Count the C. albicans cells using a hemocytometer and spin the suspension at 1000 × g for 5 min.
  9. Discard the supernatant, and resuspend the C. albicans cells in PBS to a concentration of 1 × 107 cells in 40 µL of PBS per footpad.
  10. For the preparation of heat-killed (HK) C. albicans, kill the yeast cells by heating at 65 °C for 60 min using a heating mixer after determining the cell number.

2. Mouse footpad infection with C. albicans

Candida albicans sensitization, infection timeline, rat popliteal LNs analysis, experimental setup.
Figure 1: Schematic diagram of intradermal Candida albicans infection model. (A) The hind footpads of mice were injected intradermally with 1 × 107 C. albicans. After 7 days, the footpads of mice were re-exposed to 1 × 107 HK C. albicans by intradermal injection, and the delayed-type hypersensitivity response was measured 24 h after antigen challenge. Local Immune response during C. albicans sensitization was analyzed after 7 days in skin-draining LNs. (B, C) Images of footpads before intradermal footpad injection with C. albicans. (D, E) Injection of C. albicans into the deep dermis of the right footpad. (F, G) Clinical signs of redness and swelling following footpad injection of the right footpad. (H) A sketch showing lymphatic pathways from the footpad to popliteal LNs following C. albicans injection. (I) Exposed popliteal LNs located behind the knee 7 days after C. albicans injection and (J) without injection. Abbreviations: HK = heat-killed; LNs = lymph nodes. Please click here to view a larger version of this figure.

  1. Anesthetize the mice with isoflurane in an induction chamber until the mice have a slow respiratory rate and show no withdrawal responses to toe or tail pinches.
    NOTE: During anesthesia, eye ointment is recommended to prevent dry eyes, especially for anesthesia lasting longer than 5 min.
  2. Remove the cap from a 31 G needle, and load the 0.3 mL insulin syringe with the prepared C. albicans from step 1.9 after mixing the cells.
  3. Remove the anesthetized mouse from the induction chamber, and gently inject 40 µL of the yeast cells (1 × 107 cells) into the deep dermis of the right footpad for C. albicans sensitization.
    NOTE: The maximum volume that can be injected into a footpad is 50 µL.
  4. Withdraw the syringe needle slowly from the injection site.
  5. Place each mouse alone in a cage until it has fully recovered from anesthesia and then return it safely to the home cage.
  6. To develop an antigen-specific response to C. albicans , challenge the right footpad of the mice with the prepared HK C. albicans via intradermal injection 7 days after the sensitization, as described previously (1 × 107 cells; 40 µL per footpad; repeat steps 2.1-2.5).
  7. Harvest skin-draining LNs 7 days after C. albicans sensitization or lesional footpad tissues 24 h after antigen challenge after euthanasia in a CO2 chamber.

3. Diphtheria toxin-induced dendritic cell depletion in vivo

NOTE: In this study, both Langerin-DTR and CD301b-DTR mice were treated with DT 1 day before and after intradermal sensitization to C. albicans.

  1. Prepare a 10 µg/mL solution of DT in PBS.
  2. Remove the cap from the needle of a 1 mL insulin syringe, mix the DT, and fill the syringe with the DT.
  3. Properly restrain the mice in a head-down position.
  4. Disinfect the ventral side of the mice with 70% ethanol.
  5. Slowly inject each mouse with 100 µL of 1 µg DT intraperitoneally into the lower left quadrant of the abdomen to deplete specific dendritic cell subsets.
    NOTE: Be careful not to damage organs during the injection.
  6. Wait for 5 s; then, slowly remove the needle.

4. Quantitative real-time polymerase chain reaction

  1. Place the mouse in a CO2 chamber until no breathing movement is observed.
  2. Disinfect the mouse with 70% ethanol, and cut the lesion from the hind footpad skin into small pieces using forceps and scissors.
  3. Completely immerse the sliced tissues in RNA isolation reagent.
  4. Homogenize the samples using a tissue homogenizer according to the manufacturer's instructions (2 cycles of 3 min at 30 Hz).
    NOTE: Stainless steel beads were used for tissue lysis in this study.
  5. Spin at 10,000 × g for 5 min, 4 °C.
  6. Carefully transfer the supernatant to a fresh tube.
  7. Isolate total RNA from the lesional skin using a total RNA isolation kit.
  8. Determine the RNA concentration using a UV-Vis spectrophotometer.
  9. Synthesize cDNA using a reverse transcription kit for quantitative real-time polymerase chain reaction (qPCR).
  10. Perform real-time qPCR with the real-time PCR system by monitoring the synthesis of double-stranded DNA during PCR cycles using green fluorescent dye.
    ​NOTE: In this study, the results were normalized to the level of hypoxanthine-guanine phosphoribosyltransferase (Hprt). The primer sequences are listed in Table 1, and the PCR protocol is as follows: initial denaturation at 95 °C for 30 s, amplification for 42 cycles (95 °C for 5 s, 60 °C for 30 s).

5. Cell isolation and flow cytometric analysis

  1. After CO2 euthanasia, dissect the mice using forceps and scissors, carefully exposing and harvesting the footpad-draining LNs called popliteal LNs, located behind the knee.
  2. Prepare single-cell suspensions from the footpad-draining LNs of each mouse by filtering the tissues through a 70 µm strainer after homogenization using the plunger of a 3 mL syringe.
  3. Wash the cells with PBS and spin at 500 × g for 5 min at 4 °C.
  4. Discard the supernatant, and wash the cells with PBS again.
  5. Spin at 500 × g for 5 min at 4 °C.
  6. Discard the supernatant and resuspend the cells in complete RPMI-10 medium containing 55 µM β-mercaptoethanol, 50 ng/mL phorbol 12-myristate 13-acetate (PMA), and 500 ng/mL ionomycin in a 24 well-plate for T cell stimulation.
  7. After 1 h, add 10 µg/mL of brefeldin A and 1000x monensin to the cell suspension and culture for an additional 5 h.
  8. Harvest the cells and wash them with fluorescence-activated cell sorting (FACS) buffer.
  9. Spin at 500 × g for 5 min at 4 °C and discard the supernatant.
  10. Stain the dead cells with a fixable dead cell-staining dye and incubate for 30 min at 4 °C.
  11. Wash the samples with FACS buffer and spin them at 500 × g for 5 min at 4 °C.
  12. Discard the supernatant, and stain the cells with fluorochrome-conjugated surface marker antibodies and Fc receptor blocker for 30 min at 4 °C.
  13. Wash the samples with FACS buffer and spin them at 500 × g for 5 min at 4 °C.
  14. Discard the supernatant and resuspend the pelleted cells in fixation and permeabilization solution for 15-20 min at 4 °C for intracellular staining.
  15. Wash the samples with 1x washing buffer and spin them at 500 × g for 5 min at 4 °C.
  16. Discard the supernatant, and perform intracellular cytokine staining for 30 min at 4 °C.
  17. Wash the samples with 1x washing buffer and spin at 500 x g for 5 min at 4 °C.
  18. Resuspend the cells in the appropriate volume (200-300 µL) of FACS buffer.
  19. Analyze protein expression using flow cytometry.

Results

Here, we demonstrated an intradermal infection model of C. albicans to study the role of cutaneous DC-mediated Th17 immune response in vivo. Following an initial intradermal injection with C. albicans into the footpad, the skin-draining LNs were enlarged (Figure 2A). During the sensitization period, the ratio of CD4+ to CD8+ effector T cells was notably increased (Figure 2B,C). Additionally, the effector CD4+ T cells abundantly produced IL-17A relative to the effector CD8+ T cells (Figure 2D,E). These results indicated that intradermal C. albicans infection potently drives IL-17A-producing-CD4+ T cell immunity.

The expression of interferon gamma (Ifnγ), Il4, and Il17a was observed in the challenged footpad skin with C. albicans (Figure 3). Although the initial sensitization with C. albicans led to increased levels of Ifnγ and Il4 mRNA at day 7, there was no increase in Il17a at this time point. Importantly, the mice showed a profound elevation of local Il17a expression 24 h after C. albicans re-exposure. However, the challenge with C. albicans did not further increase the mRNA levels of Ifnγ and Il4. These results indicated that re-exposure to C. albicans via the intradermal route, described in this protocol, efficiently induces an antigen-specific IL-17 response in the skin.

Skin DCs migrate and present antigens in the skin-draining LNs after exposure to antigens, initiating antigen-specific immune responses. A DT-induced, DC subset-depleted mouse system was used to determine which DC subsets are responsible for the Th17 immunity to C. albicans. Depletion of Langerin+ DCs (LCs and cDC1) resulted in comparable ratios of CD4+ to CD8+ T cells (Figure 4A-C) and IL-17A production from CD44+ effector CD4+ T cells in skin-draining LNs (Figure 4D,E). Meanwhile, the depletion of CD301b+ cDC2 significantly attenuated IL-17A expression along with a relative decline in CD4+ T cells (Figure 4A-E). These findings demonstrate that CD301b+ dermal DCs invoke a protective Th17 immune response against deep dermal C. albicans infection in vivo.

Candida albicans effect on T-lymphocytes; flow cytometry diagrams, cell population graph.
Figure 2: Intradermal Candida albicans infection induces Th17 cell differentiation in skin-draining LNs. (A) Representative images of skin-draining LNs in naïve (upper) or C. albicans-sensitized mice (lower) 7 days after intradermal injection into the footpad. (B) Gating strategies for the effector T cells of skin-draining LNs at day 7 post-infection. (C) The proportion of CD4+ to CD8+ effector T cell population in skin-draining LNs 7 days after intradermal sensitization. (D) Representative flow cytometric plots of intracellular IL-17A expression from effector CD4+ T cells or CD8+ T cells in skin-draining LNs 7 days after intradermal infection. (E) The absolute cell numbers of IL-17A-producing cells from effector CD4+ or CD8+ T cells. Data are from at least two independent experiments with four to seven mice per group. Error bars indicate mean ± standard error of the mean. ***, p<0.001. Abbreviations: LNs= lymph nodes; CD = cluster of differentiation; IL = interleukin; FSC = forward scatter; SSC = side scatter; A = area of peak; H = height of peak; TCR = T cell receptor; ns = not significant. Please click here to view a larger version of this figure.

Gene expression bar chart; Ifng, Il4, Il17a relative levels; sensitization, challenge conditions.
Figure 3: The lesional skin re-exposed to Candida albicans characteristically exhibits an antigen-specific IL-17 response. Gene expression analysis of Ifng, Il4, and Il17a in the footpad skin before (7 days after sensitization) and 24 h after HK C. albicans challenge via intradermal injection compared to the naïve skin. Data are from at least two independent experiments with four to five mice per group. Error bars indicate mean ± standard error of the mean. **, p<0.005. Abbreviations: HK = heat-killed; IL = interleukin; Ifng = interferon gamma gene; ns = not significant. Please click here to view a larger version of this figure.

Flow cytometry analysis of immune cells; CD45+ gating; CD11c/MHCII markers; T-lymphocyte ratios; CD4/CD8; IL-17A.
Figure 4: CD301b+ dermal DCs drive Th17 immunity against deep dermal Candida albicans infection. The skin-draining LNs of naïve, WT, Langerin-DTR, and CD301b-DTR mice with DT treatment were analyzed by flow cytometry 7 days after intradermal C. albicans infection. (A) Validation for the depletion of specific DC subsets in the epidermis and dermis of WT, Langerin-DTR, and CD301b-DTR mice after DT treatment. (B) Gating strategies for the CD4+ and CD8+ T cells of skin-draining LNs at day 7 post-infection. (C) The ratios of CD4+ to CD8+ T cells in each experimental group. (D) Representative flow cytometric plots of intracellular IL-17A production from CD44+CD4+ effector T cells in each experimental group. (E) The absolute numbers of IL-17A-producing Th17 cells in each experimental group. Data are from at least two independent experiments with five to six mice per group. Error bars indicate mean ± standard error of the mean. **, p<0.005; ***, p<0.001. Abbreviations: DCs = dendritic cells; WT = wild-type; DTR = diphtheria toxin receptor; DT = diphtheria toxin; CD = cluster of differentiation; LNs = lymph nodes; IL = interleukin; Th17 = T helper 17 cells; ns = not significant. Please click here to view a larger version of this figure.

GenesForwardReverse
HprtTCAGTCAACGGGGGACATAAAGGGGCTGTACTGCTTAACCAG
Il4AGATCATCGGCATTTTGAACGTTTGGCACATCCATCTCCG
Il17aCAGCAGCGATCATCCCTCAAAGCAGGACCAGGATCTCTTGCTG
IfngGATGCATTCATGAGTATTGCCAAGTGTGGACCACTCGGATGAGCTC

Table 1: Primer sequences.

Discussion

This paper describes a method of intradermal C. albicans infection that allows the study of the role of cutaneous DCs in Th17 immune response in vivo. By applying multiparametric flow cytometric analysis with DT-induced mouse strains, we found that CD301b+ dermal DCs are a crucial cutaneous DC subset for initiating Th17 immunity against deep dermal C. albicans infection. Moreover, the results showed that the IL-17-producing T cell response was mainly produced by CD4+ but not by CD8+ T cells, indicating that this model is a faithful model of Th17 immunity in vivo.

Previous elegant studies have shown that epicutaneous C. albicans infection led to Th17 immunity through IL-6-producing epidermal LCs14,16. Moreover, a Th17 response to C. albicans epicutaneous infection was specifically induced by the yeast form but not by the hyphal form of C. albicans, suggesting that the morphology of C. albicans is crucial for antifungal Th17 immunity16. Therefore, this protocol also utilizes the yeast form of C. albicans, which would transform into the hyphal form under nutrition-enriched and higher temperature conditions17. It is unclear whether an intradermal injection of C. albicans hyphae would induce Th17 immunity. Although previous studies have demonstrated the role of innate immunity against intradermal C. albicans hyphal infection that resulted in a high interferon-γ immune response, they did not evaluate the IL-17 response15,18. Future studies would be needed to demonstrate differences in Th17 immunity between the yeast and hyphal forms of intradermal infection.

The dermis contains all subsets of cutaneous DCs. In contrast to epicutaneous infection, this protocol shows that CD301b+ dermal DCs are crucial for inducing Th17 immunity against intradermal C. albicans infection in the regional LNs. Compared to the epicutaneous infection of C. albicans, an intradermal administration route could bypass the persistent exposure of C. albicans on the epidermal surface and the resultant epidermal injury mediated by C. albicans pseudohyphae invasion14. This might induce a lesser degree of epidermal LC activation, which requires IL-1β production and subsequent keratinocyte-derived tumor necrosis factor-alpha (TNF-α) for their migration to regional LNs19.

Furthermore, an initial intradermal location of C. albicans would lead to strong activation and enhanced uptake by dermal DCs. Among the dermal DCs, previous studies have shown that CD11b+ cDC2 and CD301b+ cDC2 mediate a Th17 immune response both in the intestine and the skin7,20. The results herein demonstrate the crucial role of CD301b+ dermal DCs for Th17 cell priming in the intradermal C. albicans infection model. Thus, this model provides an important experimental protocol to study Th17-centered immunological features of deep dermal fungal infection, which is more prevalent in immunocompromised individuals21. The use of immunodeficient mouse strains in this protocol will shed light on the new immunopathogenesis of the deep cutaneous fungal infection.

For a successful experiment to analyze the Th17 immune response to deep dermal C. albicans infection, users must be familiar with the anatomical dissection of skin-draining popliteal LNs (Figure 1). In addition, users must be trained in multicolor flow cytometric analysis of T cells in the LNs. Advanced knowledge of cutaneous immunology is also required to follow this protocol. The use of this method is therefore ideal to better understand the roles of each cutaneous DC subset during deep fungal skin infections.

Disclosures

The authors have no conflicts of interest to declare.

Acknowledgements

This research was supported by Samjung-Dalim Faculty research grant of Yonsei University College of Medicine (6-2019-0125), by a Basic Science Research Program through the National Research Foundation of Republic of Korea funded by the Ministry of Education (2019R1A6A1A03032869) and Ministry of Science and Information and Communications Technology (2018R1A5A2025079, 2019M3A9E8022135, and 2020R1C1C1014513), and by Korea Centers for Disease Control and Prevention (KCDC, 2020-ER6714-00).

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
0.3 mL (31 G) insulin syringe BD328822
1x  Perm/Wash bufferBD554723
1 mL (30 G) syringe insulin syringe BD328818
24 well-plateFalcon353047
50 mL conical tubeFalcon50050
70 μm strainerFalcon352350
70% ethanol
ABI StepOnePlus real-time PCR systemApplied Biosystems
Anesthesia chamberHarvard Apparatus
Brefeldin ABDBD 555029
β-MercaptoethanolGibco21985023
Candida albicans strain SC5314provided by Daniel Kaplan at Pittsburgh University
CD3BioLegend100216Clone 17A2
CD301b-DTR miceprovided by Akiko Iwasaki at Yale University
CD4BioLegend100408Clone GK1.5
CD44eBioscience47-0441-80Clone IM7
CD8aBD Biosciences553031Clone 53.6.7
Centrifuge
Clicker counter
CuvetteKartellKA.1938
Cytofix/Cytoperm solutionBD554722
Diphtheria toxin (DT)Sigma
Dulbecco's phosphate-buffered saline (DPBS)WelgeneLB001-02
FACS (Fluorescence-activated cell sorting) bufferIn-house
Fc receptor blockerBD553142
Fetal bovine serum (FBS)WelgeneS101-07
ForcepsRobozfor harvesting sample
HemocytometerFisher Scientific267110
Hybrid-R total RNA kitGeneAll Biotechnology305-101
hydroxyethyl piperazine ethane sulfonic acid (HEPES)Gibco15630-080
IL-17A (intracellular cytokine)BioLegend506912Clone TC11-18H10.1
IonomycinSigmaI0634
Isoflurane
Langerin-DTRprovided by Heung Kyu Lee at Korea Advanced Institute of Science and Technology
LIVE/DEAD Fixable Aqua Dead Cell Stain KitInvitrogenL34957
Loop and NeedleSPL90010
MonensinBDBD554724
NanoDrop 2000Thermo Scientific
Penicillin Gibco15140-122
Petri dishSPL10090
Phorbol 12-myristate 13-acetate (PMA)SigmaP8139
PrimeScript RT Master MixTakara BioRR360A
RPMI 1640Gibco11875-093
ScissorsRobozfor harvesting sample
Stainless Steel Beads, 5 mmQIAGEN69989
Sterile pipette tip
SYBR Green Premix Ex Taq IITakara BioRR820A
TCRβBioLegend109228Clone H57-597
ThermoMixer CEppendorf
TissueLyserQIAGEN
UV-VIS spectrophotometerPerkinElmer
Wild-type C57BL/6 miceOrient Bio7- to 9-week-old mice were used
Yeast-peptone-dextrose-adenine (YPDA) medium, liquid, sterile (1% yeast extract, 2% Bacto peptone, 2% dextrose)
YPDA agar plate, sterile (1% yeast extract, 2% Bacto peptone, 2% dextrose, 2% Bacto agar)

References

  1. Nestle, F. O., Di Meglio, P., Qin, J. Z., Nickoloff, B. J. Skin immune sentinels in health and disease. Nature Reviews Immunology. 9 (10), 679-691 (2009).
  2. Bouwstra, J. A., Ponec, M. The skin barrier in healthy and diseased state. Biochimica et Biophysica Acta. 1758 (12), 2080-2095 (2006).
  3. Kabashima, K., Honda, T., Ginhoux, F., Egawa, G. The immunological anatomy of the skin. Nature Reviews Immunology. 19 (1), 19-30 (2019).
  4. Banchereau, J., et al. Immunobiology of dendritic cells. Annual Review of Immunology. 18, 767-811 (2000).
  5. Kashem, S. W., Haniffa, M., Kaplan, D. H. Antigen-presenting cells in the skin. Annual Review of Immunology. 35, 469-499 (2017).
  6. Kaplan, D. H. Ontogeny and function of murine epidermal Langerhans cells. Nature Immunology. 18 (10), 1068-1075 (2017).
  7. Kim, T. G., et al. Skin-specific CD301b(+) dermal dendritic cells drive IL-17-mediated psoriasis-like immune response in mice. Journal of Investigative Dermatology. 138 (4), 844-853 (2018).
  8. Durai, V., Murphy, K. M. Functions of murine dendritic cells. Immunity. 45 (4), 719-736 (2016).
  9. O'Shea, J. J., Paul, W. E. Mechanisms underlying lineage commitment and plasticity of helper CD4+ T cells. Science. 327 (5969), 1098-1102 (2010).
  10. Korn, T., Bettelli, E., Oukka, M., Kuchroo, V. K. IL-17 and Th17 cells. Annual Review of Immunology. 27, 485-517 (2009).
  11. Hernandez-Santos, N., Gaffen, S. L. Th17 cells in immunity to Candida albicans. Cell Host & Microbe. 11 (5), 425-435 (2012).
  12. Burstein, V. L., et al. IL-17-mediated immunity controls skin infection and T helper 1 response during experimental Microsporum canis dermatophytosis. Journal of Investivative Dermatology. 138 (8), 1744-1753 (2018).
  13. Sparber, F., et al. The skin commensal yeast Malassezia triggers a type 17 response that coordinates anti-fungal immunity and exacerbates skin inflammation. Cell Host & Microbe. 25 (3), 389-403 (2019).
  14. Igyarto, B. Z., et al. Skin-resident murine dendritic cell subsets promote distinct and opposing antigen-specific T helper cell responses. Immunity. 35 (2), 260-272 (2011).
  15. Santus, W., et al. Skin infections are eliminated by cooperation of the fibrinolytic and innate immune systems. Science Immunology. 2 (15), (2017).
  16. Kashem, S. W., et al. Candida albicans morphology and dendritic cell subsets determine T helper cell differentiation. Immunity. 42 (2), 356-366 (2015).
  17. Chen, H., Zhou, X., Ren, B., Cheng, L. The regulation of hyphae growth in Candida albicans. Virulence. 11 (1), 337-348 (2020).
  18. Santus, W., Mingozzi, F., Vai, M., Granucci, F., Zanoni, I. Deep dermal injection as a model of Candida albicans skin infection for histological analyses. Journal of Visualized Experiments: JoVE. (136), e57574(2018).
  19. Villablanca, E. J., Mora, J. R. A two-step model for Langerhans cell migration to skin-draining LN. European Journal of Immunology. 38 (11), 2975-2980 (2008).
  20. Persson, E. K., et al. IRF4 transcription-factor-dependent CD103(+)CD11b(+) dendritic cells drive mucosal T helper 17 cell differentiation. Immunity. 38 (5), 958-969 (2013).
  21. Marcoux, D., et al. Deep cutaneous fungal infections in immunocompromised children. Journal of the American Academy of Dermatology. 61 (5), 857-864 (2009).

Reprints and Permissions

Tags

Intradermal InfectionSkin BarrierAntigen Presenting CellsFlow CytometryGene ExpressionDermal DC SubsetsSkin Fungal Infection
Video Coming Soon