Isolation of Murine Retinal Endothelial Cells for Next-Generation Sequencing

Summary

This protocol describes a method for the isolation of murine postnatal retinal endothelial cells optimized for cell yield, purity, and viability. These cells are suitable for next-generation sequencing approaches.

Abstract

Recent improvements in next-generation sequencing have advanced researchers' knowledge of molecular and cellular biology, with several studies revealing novel paradigms in vascular biology. Applying these methods to models of vascular development requires the optimization of cell isolation techniques from embryonic and postnatal tissues. Cell yield, viability, and purity all need to be maximal to obtain accurate and reproducible results from next-generation sequencing approaches. The neonatal mouse retinal vascularization model is used by researchers to study mechanisms of vascular development. Researchers have used this model to investigate mechanisms of angiogenesis and arterial-venous fate specification during blood vessel formation and maturation. Applying next-generation sequencing techniques to study the retinal vascular development model requires optimization of a method for the isolation of retinal endothelial cells that maximizes cell yield, viability, and purity. This protocol describes a method for murine retinal tissue isolation, digestion, and purification using fluorescence-activated cell sorting (FACS). The results indicate that the FACS-purified CD31+/CD45- endothelial cell population is highly enriched for endothelial cell gene expression and exhibits no change in viability for 60 min post-FACS. Included are representative results of next-generation sequencing approaches on endothelial cells isolated using this method, including bulk RNA sequencing and single-cell RNA sequencing, demonstrating that this method for retinal endothelial cell isolation is compatible with next-generation sequencing applications. This method of retinal endothelial cell isolation will allow for advanced sequencing techniques to reveal novel mechanisms of vascular development.

Introduction

The high-throughput capacity of sequencing nucleic acids via next-generation sequencing approaches has greatly advanced researchers' knowledge of molecular and cellular biology. These advanced techniques include whole transcriptome RNA sequencing, DNA sequencing of targeted regions to identify Single Nucleotide Polymorphisms (SNPs), DNA sequencing of bound transcription factors in Chromatin Immunoprecipitation (ChIP) sequencing, or open chromatin regions in Assay for Transposase-Accessible Chromatin (ATAC) sequencing, and single-cell RNA sequencing¹. In vascular biology, these advances have allowed researchers to elucidate complica....

Protocol

The Institutional Animal Care and Use Committees of Yale University and the University of Virginia approved all animal experiments listed in this protocol.

1. Obtain mouse eyes for retinal isolation

1. Prepare 1x ice-cold PBS and add 500 μL to each well of a 48-well plate.
2. Euthanize neonatal mice at postnatal day six (P6) according to approved institutional guidelines. For this experiment, litters of approximately 4-8 neonatal mice are euthanized at P6 via isoflurane inhalation for at least three minutes after the respiratory arrest, followed by decapitation.
3. Remove the eyes from each o....

Results

Digestion of retinal tissue and immunostaining for CD31 and CD45 results in an identifiable population of CD31+/CD45- endothelial cells after gating for cells, single cells, and viability (Figure 2A). CD45 immunostaining is required to eliminate CD31+/CD45+ cells, which include platelets and some leukocytes²¹. Controls should be performed for each experiment to show antibody specificity and guide gating strategy (Figure 2B). This percenta.......

Discussion

This protocol describes a method for the isolation of endothelial cells from postnatal murine retinal tissue that has been optimized for high cell number, purity, and viability. Cell purity is obtained by FACS isolation of endothelial cell populations from the digested single-cell suspension by CD31+/CD45- immunostaining. Quality of isolation is quantified in assays for viability by Trypan blue staining and gene expression by qPCR for CD31, CD45, and VE-Cadherin (although VE-Cadherin was not used for immunostaining). The.......

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
2 mL Eppendorf safe-lock tubes	USA Scientific	4036-3352
5 ml Falcon Test Tubes with Cell Strainer Snap Cap	Corning	352235
60 mm Non TC-treated Culture Dish	Corning	430589
APC Rat Anti-Mouse CD31	BD Biosciences	551262
APC Rat IgG2a κ Isotype Control	BD Biosciences	553932
BD FACSChorus Software	BD Biosciences	FACSCHORUS
BD FACSMelody Cell Sorter	BD Biosciences	FACSMELODY
Collagenase Type II	Sigma-Aldrich	234115
Costar 48-well Clear TC-treated Multiple Well Plates, Individually Wrapped, Sterile	Corning	3548
D-Glucose	Gibco	A2494001
Disposable Graduated Transfer Pipettes	Fisher Scientific	12-711-9AM
Dissecting Pan Wax	Carolina	629100
Dissection scissors	Fine Science Tools	14085-08
Dissection Stereo Microscope M165 FC	Leica	M165FC
Dulbecco's Modified Eagle Medium (DMEM)	Gibco	11965-052
Dulbecco’s Phosphate Buffered Saline (PBS)	Gibco	14190144
Eppendorf Flex-Tubes Microcentrifuge Tubes 1.5 mL	Sigma-Aldrich	22364120
Fetal Bovine Serum (FBS)	Gemini Bio	100-106
Fine dissection forceps	Fine Science Tools	11250-00
Hank's Buffered Salt Solution (HBSS)	Gibco	14175095
HEPES (1M)	Gibco	15630130
iScript cDNA Synthesis Kit	Bio-Rad	1708890
Isoflurane, USP	Covetrus	11695067772
Isotemp General Purpose Deluxe Water Bath	Fisher Scientific	FSGPD20
Primer: ActB_Forward: 5’- agagggaaatcgtgcgtgac -3’	Integrated DNA Technologies	N/A
Primer: ActB_Reverse: 5’- caatagtgatgacctggccgt -3’	Integrated DNA Technologies	N/A
Primer: CD31_Forward: 5’- gagcccaatcacgtttcagttt -3’	Integrated DNA Technologies	N/A
Primer: CD31_Reverse: 5’- tccttcctgcttcttgctagct -3’	Integrated DNA Technologies	N/A
Primer: CD45_Forward: 5’- gggttgttctgtgccttgtt -3’	Integrated DNA Technologies	N/A
Primer: CD45_Reverse: 5’- ctggacggacacagttagca -3’	Integrated DNA Technologies	N/A
Primer: VE-Cadherin_Forward: 5’- tcctctgcatcctcactatcaca -3’	Integrated DNA Technologies	N/A
Primer: VE-Cadherin_Reverse: 5’- gtaagtgaccaactgctcgtgaat -3’	Integrated DNA Technologies	N/A
Propidium iodide	Sigma-Aldrich	P4864
RNeasy Plus Mini Kit	Qiagen	74134
Sorvall Legend Micro 21R Centrifuge, Refrigerated	ThermoFisher	75002477
SYBR-Green iTaq Universal SYBR Green Supermix	Bio-Rad	172-5120
Trypan Blue Solution	ThermoFisher	15250061
V450 Rat Anti-Mouse CD45	BD Biosciences	560501
V450 Rat IgG2b, κ Isotype Control	BD Biosciences	560457