This protocol describes a method for the isolation of murine postnatal retinal endothelial cells optimized for cell yield, purity, and viability. These cells are suitable for next-generation sequencing approaches.
A subscription to JoVE is required to view this content. Sign in or start your free trial.
Method Article
This protocol describes a method for the isolation of murine postnatal retinal endothelial cells optimized for cell yield, purity, and viability. These cells are suitable for next-generation sequencing approaches.
Recent improvements in next-generation sequencing have advanced researchers' knowledge of molecular and cellular biology, with several studies revealing novel paradigms in vascular biology. Applying these methods to models of vascular development requires the optimization of cell isolation techniques from embryonic and postnatal tissues. Cell yield, viability, and purity all need to be maximal to obtain accurate and reproducible results from next-generation sequencing approaches. The neonatal mouse retinal vascularization model is used by researchers to study mechanisms of vascular development. Researchers have used this model to investigate mechanisms of angiogenesis and arterial-venous fate specification during blood vessel formation and maturation. Applying next-generation sequencing techniques to study the retinal vascular development model requires optimization of a method for the isolation of retinal endothelial cells that maximizes cell yield, viability, and purity. This protocol describes a method for murine retinal tissue isolation, digestion, and purification using fluorescence-activated cell sorting (FACS). The results indicate that the FACS-purified CD31+/CD45- endothelial cell population is highly enriched for endothelial cell gene expression and exhibits no change in viability for 60 min post-FACS. Included are representative results of next-generation sequencing approaches on endothelial cells isolated using this method, including bulk RNA sequencing and single-cell RNA sequencing, demonstrating that this method for retinal endothelial cell isolation is compatible with next-generation sequencing applications. This method of retinal endothelial cell isolation will allow for advanced sequencing techniques to reveal novel mechanisms of vascular development.
The high-throughput capacity of sequencing nucleic acids via next-generation sequencing approaches has greatly advanced researchers' knowledge of molecular and cellular biology. These advanced techniques include whole transcriptome RNA sequencing, DNA sequencing of targeted regions to identify Single Nucleotide Polymorphisms (SNPs), DNA sequencing of bound transcription factors in Chromatin Immunoprecipitation (ChIP) sequencing, or open chromatin regions in Assay for Transposase-Accessible Chromatin (ATAC) sequencing, and single-cell RNA sequencing1. In vascular biology, these advances have allowed researchers to elucidate complicated mechanisms of development and disease, along with distinguishing gene expression patterns along a continuum of varying phenotypes2,3. Future experiments can further define complex mechanisms by combining the next-generation sequencing with evaluated models of vascular development, but the methods for sample preparation need to be compatible with the advanced sequencing techniques.
The quality, accuracy, and reproducibility of next-generation sequencing approaches depend on the method of sample preparation. When isolating a subset of cells or generating single-cell suspensions from tissues, optimal digestion and purification methods are essential for maximizing cell number, viability, and purity of the cell population4,5. This requires a balance in the digestion method: strong digestion is necessary to release cells from the tissue and obtain enough cells for downstream approaches, but cell viability will be negatively affected if the digestion is too strong6,7. Additionally, purity of the cell population is necessary for robust results and accurate analysis of data, which can be accomplished through FACS. This highlights the importance of optimizing cell isolation methods to apply next-generation sequencing to established models of vascular development.
A well-characterized model for investigating vascular development is the murine retinal vascular development model. Murine retinal vasculature develops postnatally in a two-dimensional superficial plexus, with initial angiogenic sprouting from the optic nerve visible at postnatal day (P)3, angiogenic front with stalk- and tip-cells and initial vessel maturation visible at P6, and maturation of the vascular plexus visible after P98,9. During the remodeling of the initial vascular plexus, endothelial cells undergo specification toward arterial, capillary, and venous phenotypes in different vessels to generate a circulatory network10,11. Therefore, this method allows researchers to visualize angiogenic vascular plexus formation and endothelial arterial-venous specification and maturation at various time points during development9. Additionally, this model provides a method for investigating the effects of transgenic manipulation on angiogenesis and vascular plexus development, which has been applied for the investigation of vascular development, arterial-venous malformations, and oxygen-induced neovascularization12,13,14,15,16. In order to combine next-generation sequencing approaches with the murine retinal vascular development model, an optimized protocol for the isolation of endothelial cells from retinal tissue is necessary.
This protocol describes an optimized method for digesting retinal tissue from mice at P6 to maximize cell yield, purity, and viability. Retinal tissue is isolated from P6 mice, digested for 20 min, immunostained for CD31 and CD45, and purified through FACS to isolate a single cell suspension of endothelial cells in about 2.5 h (Figure 1A). These endothelial cells were found to maintain high viability for 60 min post-isolation17, allowing library preparations for next-generation sequencing methods. Additionally, representative results are provided for FACS gating and quality control results from two separate next-generation sequencing methods using this isolation protocol: whole transcriptome RNA sequencing and single-cell RNA sequencing. This method allows for next-generation sequencing approaches to be used in conjunction with the retinal vascularization model to elucidate novel mechanisms of vascular development.
Access restricted. Please log in or start a trial to view this content.
The Institutional Animal Care and Use Committees of Yale University and the University of Virginia approved all animal experiments listed in this protocol.
1. Obtain mouse eyes for retinal isolation
2. Isolate mouse retinal tissue

Figure 1: Overview of the isolation protocol. (A) Schematic of the isolation timeline with an estimated time for each step: Isolation of Retinal Tissue, Digest, Antibody Staining, FACS, and Cell Viability Window. (B) Step-by-step guide for isolation of retinal tissue from the eye, with numbered dissection steps: 1) pierce cornea, 2) tear cornea, 3) tear sclera, 4) remove sclera from the retina, 5) further remove sclera and connecting tissue from the retina, 6) remove the vitreous body and vitreous vessels from the retina. (C) Representative images of retinal tissue during various digestion steps: Pre-digest, Post-digest, Pellet (black arrows highlight retinal tissue or cell pellet). Republished with permission from Chavkin et al. published in S. Karger AG, Basel17. Please click here to view a larger version of this figure.
3. Digest retinal tissue into a single cell suspension
4. Count cells
5. Immunostain the cells with antibodies
6. Prepare for fluorescence-activated cell sorting
7. Set up the FACS instrument
8. Isolate viable endothelial cells via FACS
9. Perform viability assay
10. Perform gene expression assay
Access restricted. Please log in or start a trial to view this content.
Digestion of retinal tissue and immunostaining for CD31 and CD45 results in an identifiable population of CD31+/CD45- endothelial cells after gating for cells, single cells, and viability (Figure 2A). CD45 immunostaining is required to eliminate CD31+/CD45+ cells, which include platelets and some leukocytes21. Controls should be performed for each experiment to show antibody specificity and guide gating strategy (Figure 2B). This percenta...
Access restricted. Please log in or start a trial to view this content.
This protocol describes a method for the isolation of endothelial cells from postnatal murine retinal tissue that has been optimized for high cell number, purity, and viability. Cell purity is obtained by FACS isolation of endothelial cell populations from the digested single-cell suspension by CD31+/CD45- immunostaining. Quality of isolation is quantified in assays for viability by Trypan blue staining and gene expression by qPCR for CD31, CD45, and VE-Cadherin (although VE-Cadherin was not used for immunostaining). The...
Access restricted. Please log in or start a trial to view this content.
The authors have no relevant disclosures.
Thank you to the Yale Flow Cytometry Facility, the University of Virginia Flow Cytometry Core Facility, the Yale Center for Genomic Analysis, and the University of Virginia Genome Analysis and Technology Core for their effort, expertise, and advice in contributing to the presented experiments. This study was funded by NIH grants to N.W.C. (T32 HL007224, T32 HL007284), S.C. (T32 HL007284), K.W. (R01 HL142650), and K.K.H. (R01 HL146056, R01 DK118728, UH3 EB025765).
Access restricted. Please log in or start a trial to view this content.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| 2 mL Eppendorf safe-lock tubes | USA Scientific | 4036-3352 | |
| 5 ml Falcon Test Tubes with Cell Strainer Snap Cap | Corning | 352235 | |
| 60 mm Non TC-treated Culture Dish | Corning | 430589 | |
| APC Rat Anti-Mouse CD31 | BD Biosciences | 551262 | |
| APC Rat IgG2a κ Isotype Control | BD Biosciences | 553932 | |
| BD FACSChorus Software | BD Biosciences | FACSCHORUS | |
| BD FACSMelody Cell Sorter | BD Biosciences | FACSMELODY | |
| Collagenase Type II | Sigma-Aldrich | 234115 | |
| Costar 48-well Clear TC-treated Multiple Well Plates, Individually Wrapped, Sterile | Corning | 3548 | |
| D-Glucose | Gibco | A2494001 | |
| Disposable Graduated Transfer Pipettes | Fisher Scientific | 12-711-9AM | |
| Dissecting Pan Wax | Carolina | 629100 | |
| Dissection scissors | Fine Science Tools | 14085-08 | |
| Dissection Stereo Microscope M165 FC | Leica | M165FC | |
| Dulbecco's Modified Eagle Medium (DMEM) | Gibco | 11965-052 | |
| Dulbecco’s Phosphate Buffered Saline (PBS) | Gibco | 14190144 | |
| Eppendorf Flex-Tubes Microcentrifuge Tubes 1.5 mL | Sigma-Aldrich | 22364120 | |
| Fetal Bovine Serum (FBS) | Gemini Bio | 100-106 | |
| Fine dissection forceps | Fine Science Tools | 11250-00 | |
| Hank's Buffered Salt Solution (HBSS) | Gibco | 14175095 | |
| HEPES (1M) | Gibco | 15630130 | |
| iScript cDNA Synthesis Kit | Bio-Rad | 1708890 | |
| Isoflurane, USP | Covetrus | 11695067772 | |
| Isotemp General Purpose Deluxe Water Bath | Fisher Scientific | FSGPD20 | |
| Primer: ActB_Forward: 5’- agagggaaatcgtgcgtgac -3’ | Integrated DNA Technologies | N/A | |
| Primer: ActB_Reverse: 5’- caatagtgatgacctggccgt -3’ | Integrated DNA Technologies | N/A | |
| Primer: CD31_Forward: 5’- gagcccaatcacgtttcagttt -3’ | Integrated DNA Technologies | N/A | |
| Primer: CD31_Reverse: 5’- tccttcctgcttcttgctagct -3’ | Integrated DNA Technologies | N/A | |
| Primer: CD45_Forward: 5’- gggttgttctgtgccttgtt -3’ | Integrated DNA Technologies | N/A | |
| Primer: CD45_Reverse: 5’- ctggacggacacagttagca -3’ | Integrated DNA Technologies | N/A | |
| Primer: VE-Cadherin_Forward: 5’- tcctctgcatcctcactatcaca -3’ | Integrated DNA Technologies | N/A | |
| Primer: VE-Cadherin_Reverse: 5’- gtaagtgaccaactgctcgtgaat -3’ | Integrated DNA Technologies | N/A | |
| Propidium iodide | Sigma-Aldrich | P4864 | |
| RNeasy Plus Mini Kit | Qiagen | 74134 | |
| Sorvall Legend Micro 21R Centrifuge, Refrigerated | ThermoFisher | 75002477 | |
| SYBR-Green iTaq Universal SYBR Green Supermix | Bio-Rad | 172-5120 | |
| Trypan Blue Solution | ThermoFisher | 15250061 | |
| V450 Rat Anti-Mouse CD45 | BD Biosciences | 560501 | |
| V450 Rat IgG2b, κ Isotype Control | BD Biosciences | 560457 |
Access restricted. Please log in or start a trial to view this content.