Here, we introduce a detailed soaking method of RNA interference in Bursaphelenchus xylophilus to facilitate the study of gene functions.
A subscription to JoVE is required to view this content. Sign in or start your free trial.
Method Article
Here, we introduce a detailed soaking method of RNA interference in Bursaphelenchus xylophilus to facilitate the study of gene functions.
The pinewood nematode, Bursaphelenchus xylophilus, is one of the most destructive invasive species worldwide, causing the wilting and eventual death of pine trees. Despite the recognition of their economic and environmental significance, it has thus far been impossible to study the detailed gene functions of plant-parasitic nematodes (PPNs) using conventional forward genetics and transgenic methods. However, as a reverse genetics technology, RNA interference (RNAi) facilitates the study of the functional genes of nematodes, including B. xylophilus.
This paper outlines a new protocol for RNAi of the ppm-1 gene in B. xylophilus, which has been reported to play crucial roles in the development and reproduction of other pathogenic nematodes. For RNAi, the T7 promoter was linked to the 5′-terminal of the target fragment by polymerase chain reaction (PCR), and double-stranded RNA (dsRNA) was synthesized by in vitro transcription. Subsequently, dsRNA delivery was accomplished by soaking the nematodes in a dsRNA solution mixed with synthetic neurostimulants. Synchronized juveniles of B. xylophilus (approximately 20,000 individuals) were washed and soaked in dsRNA (0.8 µg/μL) in the soaking buffer for 24 h in the dark at 25 °C.
The same quantity of nematodes was placed in a soaking buffer without dsRNA as a control. Meanwhile, another identical quantity of nematodes was placed in a soaking buffer with green fluorescent protein (gfp) gene dsRNA as a control. After soaking, the expression level of the target transcripts was determined using real-time quantitative PCR. The effects of RNAi were then confirmed using microscopic observation of the phenotypes and a comparison of the body size of the adults among the groups. The current protocol can help advance research to better understand the functions of the genes of B. xylophilus and other parasitic nematodes toward developing control strategies through genetic engineering.
Plant-parasitic nematodes (PPNs) are a continuing threat to food security and forest ecosystems. They cause an estimated 100 billion USD in economic losses each year1, the most problematic of which are primarily root-knot nematodes, cyst nematodes, and pinewood nematodes. The pinewood nematode, Bursaphelenchus xylophilus, is a migratory, endoparasitic nematode, which is the causal pathogen of pine wilt disease2. It has caused great harm to pine forests worldwide3. Using the terminology of Van Megen et al.4, B. xylophilus is a member of the Parasitaphelenchidae and belongs to clade 10, whereas most other major plant parasites belong to clade 12.
As an independent and recently evolved plant parasite, B. xylophilus is an attractive model for comparative studies. To date, there has been substantial research on root-knot nematodes and cyst nematodes belonging to clade 12, which are obligate, sedentary endoparasites and are some of the most intensely studied nematodes. However, conducting further research in this important area comes with a major challenge: the function of parasitism genes is a research bottleneck. Functional studies generally include ectopic expression and knockdown/out experiments but rely on effective genetic transformation protocols for the nematode. As a result, reverse genetics in PPNs almost exclusively relies on gene silencing by RNAi.
RNAi, a mechanism widely present in eukaryotic cells, silences gene expression by introducing double-stranded RNA (dsRNA)5. To date, the posttranscriptional gene-silencing mechanism induced by dsRNA has been found in all studied eukaryotes, and RNAi technology, as a tool of functional genomics research and other applications, has developed rapidly in many organisms. Since the discovery of the RNAi machinery in Caenorhabditis elegans in 19986, RNAi techniques have become effective methods for identifying the gene function of nematodes and are proposed as a new way to effectively control pathogenic nematodes7.
RNAi is technically facile-soaking the juveniles in dsRNA can suffice; however, the efficacy and reproducibility of this approach vary widely with the nematode species and the target gene8. The silencing of 20 genes involved in the RNAi pathways of the root-knot nematode, Meloidogyne incognita, was investigated using long dsRNAs as triggers, resulting in diverse responses, including an increase and no change in the expression of some genes9. These results show that target genes may respond to RNAi knockdown differently, necessitating an exhaustive assessment of their suitability as targets for nematode control via RNAi. However, there is currently a paucity of research on the developmental and reproductive biology of B. xylophilus.
As a continuation of previous work10,11,12,13, we describe here a protocol for applying RNAi to study the function of the ppm-1 gene of B. xylophilus, including the synthesis of dsRNA, synthetic neurostimulant soaking, and quantitative polymerase chain reaction (qPCR) detection. The knowledge gained from this experimental approach will likely contribute markedly to understanding basic biological systems and preventing pine wilt disease.
Access restricted. Please log in or start a trial to view this content.
The study was approved by the council for animal experimentation of Zhejiang Agricultural & Forestry University. The B. xylophilus isolate NXY61 was originally extracted from a diseased Pinus massoniana in the Ningbo area of Zhejiang province, China11.
1. Gene cloning
NOTE: See the Table of Materials for details about the primers used in this protocol.
2. Synthesis of dsRNA
3. RNAi by soaking
4. qPCR detection
5. Evaluate the body length of nematode adults following RNAi
Access restricted. Please log in or start a trial to view this content.
Analysis of ppm-1 expression of B. xylophilus after RNAi
The relative expression level of the ppm-1 gene of B. xylophilus soaked with GFP dsRNA and that soaked with target gene dsRNA was 0.92 and 0.52, respectively (the ppm-1 gene expression level of the ddH2O-treated control group was set to 1) (Figure 1). Thus, exogenous dsRNA has no effect on the...
Access restricted. Please log in or start a trial to view this content.
Although the life history and parasitic environment of B. xylophilus are different from those of other nematodes, there has been limited research on the molecular pathogenesis of this plant pathogen. Despite great progress made in the application of CRISPR/Cas9 genome editing technology in C. elegans and other nematodes, only RNAi technology applied to B. xylophilus has been published to date17. RNAi is one of the most powerful tools available to study the gene function ...
Access restricted. Please log in or start a trial to view this content.
No conflicts of interest were declared.
This research was funded by the National Natural Science Foundation of China (31870637, 31200487) and jointly funded by the Zhejiang Key Research Plan (2019C02024, LGN22C160004).
Access restricted. Please log in or start a trial to view this content.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| Baermann funnel | n/a | n/a | to isolate nematodes |
| Beacon Designer 7.9 | Shanghai kangyusheng information technology co. | n/a | to design qPCR primers |
| Botrytis cinerea | n/a | n/a | as food for nematodes |
| Bursaphelenchus xylophilus | n/a | n/a | its number was NXY61 and was it was originally extracted from diseased Pinus massoniana in Ningbo, Zhejiang province, China. |
| constant temperature incubator | Shanghai Jing Hong Laboratory Instrument Co. | H1703544 | to cultur nematodes |
| Electrophoresis apparatus | Bio-Rad Laboratories | 1704466 | to achieve electrophoretic analysis |
| Ethanol, 75% | Sinopharm Chemical Reagent Co. | 80176961 | to extract RNA |
| Ex Taq Polymerase Premix | Takara Bio Inc. | RR030A | for PCR |
| Ex Taq Polymerase Premix | Takara Bio Inc. | RR390A | for PCR |
| Gel imager | LongGene Scientific Instruments Co. | LG2020 | to make nucleic acid bands visible |
| GraphPad Prism 8 | GraphPad Prism | n/a | to analyze the data and make figurs |
| High Speed Centrifuge | Hangzhou Allsheng Instruments Co. | AS0813000 | centrifug |
| High-flux tissue grinder | Bertin | to extract RNA | |
| ImageJ software | National Institutes of Health | n/a | to measure the body lengths |
| isopropyl alcohol | Shanghai Aladdin Biochemical Technology Co. | L1909022 | to extract RNA |
| Leica DM4B microscope | Leica Microsystems Inc. | to observe nematodes | |
| magnetic beads | Aoran science technology co. | 150010C | to extract RNA |
| MEGAscript T7 High Yield Transcription Kit | Thermo Fisher Scientific Inc. | AM1333 | to synthesize dsRNA in vitro |
| NanoDrop ND-2000 spectrophotometer | Thermo Fisher Scientific Inc. | NanoDrop 2000/2000C | to analyze the quality of the dsRNA |
| PCR Amplifier | Bio-Rad Life Medical Products Co. | 1851148 | to amplify nucleic acid sequence |
| Petri dishes | n/a | n/a | to cultur nematodes |
| pGEM-T Easy vector | Promega Corporation | A1360 | for cloning |
| Potato Dextrose Agar (Medium) | n/a | n/a | to cultur Botrytis cinerea |
| Prime Script RT reagent Kit with gDNA Eraser | Takara Bio Inc. | RR047B | to synthetic cDNA |
| Primer Premier 5.0 | PREMIER Biosoft | n/a | to design PCR primers |
| primers:ppm-1-F/R | Tsingke Biotechnology Co. | n/a | F: 5'-GATGCGAAGTTGCCAATCATTCT -3'; R: 5'- CCAGATCCAGTCCACCATACACC -3 |
| q-ppm-1-F/R | Tsingke Biotechnology Co. | n/a | F: 5'-CATCCGAATGGCAATACAG-3'; R: 5'-ACTATCCTCAGCGTTAGC-3' |
| Real-time thermal cycler qTOWER 2.2 | Analytique Jena Instruments (Beijing) Co. | for qPCR | |
| shaking table | Shanghai Zhicheng analytical instrument manufacturing co. | to soak nematodes | |
| stereoscopic microscope | Chongqing Optec Instrument Co. | 1814120 | to observe nematodes |
| T7-GFP-F/R | Tsingke Biotechnology Co. | n/a | F: 5'-TAATACGACTCACTATAGGGAAA GGAGAAGAACTTTTCAC-3'; R: 5'-TAATACGACTCACTATAGGGCTG TTACAAACTCAAGAAGG-3' |
| T7 promoter | Tsingke Biotechnology Co. | n/a | TAATACGACTCACTATAGGG |
| Takara MiniBEST Agarose Gel DNA Extraction Kit | Takara Bio Inc. | 9762 | to recover DNA |
| TaKaRa TB Green Premix Ex Taq (Tli RNaseH Plus) | Takara Bio Inc. | RR820A | for qPCR |
| trichloroethane | Shanghai LingFeng Chemical Reagent Co. | to extract RNA | |
| TRIzol Reagent | Thermo Fisher Scientific Inc. | 15596026 | total RNA extraction reagent,to extract RNA |
Access restricted. Please log in or start a trial to view this content.
This corrects the article 10.3791/63645-v