Hier haben wir ein Organ-on-a-Chip-Modell für glatte Muskelzellen der menschlichen Aorta entwickelt, um die in vivo biomechanische Belastung von glatten Muskelzellen in der menschlichen Aortenwand zu replizieren.
Method Article
Access restricted. Please log in or start a trial to view this content.
Access restricted. Please log in or start a trial to view this content.
Access restricted. Please log in or start a trial to view this content.
Access restricted. Please log in or start a trial to view this content.
Access restricted. Please log in or start a trial to view this content.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| 4% Paraformaldehyd | Beyotime | P0099-100ml | Wird zur Zellimmobilisierung |
| verwendet Alexa Fluor 350-markierte Ziege Anti-Kaninchen | IgG Beyotime | A0408 | Antikörper zur Immunfärbung von |
| Rinderserumalbumin | Beyotime | ST025-20g | |
| Calcium AM/PI | Invitrogen | L3224 | |
| Zellkulturflasche | Corning | 430639 | |
| CNN1 | Abcam | Ab46794 | |
| Kommerzielle flexible PDMS-Membran | Hangzhou Bald Advanced Materials | KYQ-200 | |
| F-Aktin | Invitrogen | R415 | |
| FBS | Sigma | M8318 | |
| Schläuche | Runze Fluid | 96410 | 1 mm Innendurchmesser; 3 mm Außendurchmesser; 1 mm Wandstärke; Offizielle Website-Adresse: https://www.runzefluidsystem.com |
| Menschliche Aorten-Glatt -Muskelzelllinie CRL1999 | ATCC | Chargennummer: 70019189 | |
| Bild J | Imagej.net/fiji/downloads | Kostenloser Download: https://fiji.sc | Bildgebungsplattform, die zur Identifizierung der Fluoreszenzintensität verwendet wird |
| Inkubator | Thermo Fisher Scientific | Stellt sicher, dass die Temperatur, Luftfeuchtigkeit und die Lichteinwirkung während des gesamten Experiments < /> genau gleich sind. | |
| Luer | Runze Fluid | RH-M016 | Offizielle Website-Adresse: https://www.runzefluidsystem.com. |
| Mikroskop | Olympus | ||
| Maus Kollagen | Sigma | C7661 | |
| Sauerstoffplasma | Changzhou Hongming Instrument | HM-Plasma5L | |
| Pasteur-Pipette | Biologix | 30-0138A1 | |
| PBS | Beyotime | C0221A | |
| Pen-Strep | Sigma | P4458-100ml | Antibiodics zur Verhinderung einer bakteriellen Kontamination von Zellen während der Kultur. |
| Schlauchpumpe | Kamoer | F01A-STP-B046 | |
| Petrischale | Corning | 430167 | |
| SPS-Steuerung | Zhejiang Jun Teng (BenT) CNC-Fabrik | BR010-11T8X2M | Die detaillierte Programmeinstellung finden Sie in der Ergänzung. Offizielle Website-Adresse: files.http://www.btcnc.net |
| Polydimethylsiloxan (PDMS) | Dow Corning | Sylgard 184 | |
| SM22 | Abcam | ab14106 | |
| SMCM | ScienCell | Cat 1101 | |
| Magnetventil | SMC (China) | VQZ300 | |
| Spritze | Becton, Dickinson and Company | 300841 | |
| Triton-X 100 | Beyotime | ST795 | Zum Durchdringen von Zellmembranen |
| Trizol | Invitrogen | 10296010 | Wird für die RNA-Extraktion |
| Trypsin verwendet | Sigma | 15400054 | |
| Vakuumfilter | SMC (China) | ZFC5-6 | Offizielle Website-Adresse: https://www.smc.com.cn |
| Vakuumpumpe | Kamoer | KVP15-KL-S | |
| Vakuumregler | AirTAC | GVR-200-06 | |
| Primers | |||
| Primer Name | Vorwärts (5' bis 3') | Rückwärtsgang (5' bis 3') | |
| SM22 | CCGTGGAGATCCCAACTGG | CCATCTGAAGGCCAATGACAT | |
| CNN1 | CTCCATTGACTCGAACGACTC | CAGGTCTGCGAAACTTCTTAGA |
Access restricted. Please log in or start a trial to view this content.
Request permission to reuse the text or figures of this JoVE article
Request Permission