Summary
Here, we describe the method of generating an artificial decidualization model using the ovariectomized mouse, a classic endometrial decidualization experiment in the research field of endometrial decidualization.
Abstract
Endometrial decidualization is a unique differentiation process of the endometrium, closely related to menstruation and pregnancy. Impairment of decidualization leads to various endometrial disorders, such as infertility, recurrent miscarriage, and preterm birth. The development and use of the endometrial decidualization model in reproductive studies have been a highlight for reproductive researchers for a long time. The mouse has been extensively used in studying reproduction and decidualization. There are three well-established mouse models regarding decidualization, namely natural pregnancy decidualization (NPD), artificial decidualization (AD), and in vitro decidualization (IVD). Among them, AD is considered a reliable model for mouse decidualization, which is easy to implement and close to NPD. This paper focuses on a modified method of the generation and application process of the mouse artificial decidualization model with ovariectomy to avoid ovarian effects, which can obtain highly reproducible results with small within group variances. This method provides a good and reliable animal model for the study of endometrial decidualization.
Introduction
With the development of human-assisted reproductive technology, the current clinical pregnancy rate of in vitro fertilization-embryo transfer (IVF-ET) has reached or even exceeded that of natural pregnancy. Despite this, many patients in assisted reproduction clinical practice still undergo multiple embryo transfers but fail to achieve pregnancy as desired. However, its specific molecular mechanism is still unclear, so clinical intervention is ineffective, which is one of the significant challenges facing reproductive medicine1,2.
Endometrial factors account for about two-thirds of the causes of IVF failure3. Human embryo implantation is divided into three stages: positioning, adhesion, and invasion4,5,6. The maternal endometrium undergoes a series of changes to meet the arrival of the embryo. Forming an implantation "window period" provides favorable conditions for embryo implantation7,8.
In most mammals, after the blastocyst adheres to the luminal epithelium of the uterus, the stromal cells surrounding the blastocyst rapidly begin to proliferate and differentiate, and the rapid remodeling of the mesenchyme changes its shape and function, leading to embryo implantation5,9,10. The rapid increase in site volume and weight allows the blastocyst to become embedded in the uterine stroma, a process known as decidualization11. The endometrial stroma differentiates and remodels in preparation for pregnancy, while the transition of stromal cells provides space and new signaling connections for decidual cells to perform their functions12,13. Stromal cells transform into decidual cells and secrete many iconic factors such as prolactin (PRL), insulin-like growth factor-binding protein 1 (Igfbp1), and so on. Studies have shown that abnormal decidualization is one of the key reasons for embryo implantation failure, but the cause of abnormal decidualization is still unclear and needs to be further elucidated1,14.
The mouse artificial decidualization model is essential for studying the physiological process and molecular mechanisms underlying decidualization. Artificial decidualization (AD) mainly refers to the process of endometrial decidualization established by artificial methods to simulate pregnancy or the menstrual cycle. In terms of morphology, there is little overall difference between pregnancy decidualization and artificial decidualization15,16. The uterine glands exist in the endometrium before decidua form and disappear after decidualization. Regarding the gene expression, only a slight difference is identified between natural pregnancy decidualization (NPD) and AD15. Consequently, the artificial decidualization model in mice can simulate pregnancy decidualization to explore the unknown pathogenesis and new treatment of human reproductive diseases.
NPD, AD, and in vitro decidualization (IVD) are three methods to achieve mouse decidualization. The NPD model depends on natural pregnancy and is closest to the maternal physiological state, including the effects from embryos. Comparing the differences between implantation and non-implantation sites is a more physiological and convenient approach for studying decidualization. The AD model was developed by using an intrauterine injection of sesame oil as a stimulant to induce decidualization in a pseudopregnant female mouse mated with vasectomized males to avoid the impact from embryos. Both NPD and AD models play essential roles in different research purposes, but they cannot avoid mating failure and within-group differences caused by the different activities of maternal hormone metabolism. IVD is a method depending on the treatment of combined estrogen and progesterone at the cellular level, which requires more stringent experimental conditions and operating ability. However, the in vitro model cannot fully simulate the decidual response under physiological conditions15. Therefore, we propose a simple and improved induction method modified from traditional AD to reduce the effect of endogenous hormones on decidualization. Based on ensuring the success of decidualization induction, it is closer to the physiological state and more suitable for experiments that need to exclude embryo factors.
Subscription Required. Please recommend JoVE to your librarian.
Protocol
All of the animal experiments described were approved by the Affiliated Drum Tower Hospital of Nanjing University Medical School's Committee on the Use and Care of Animals (No. 20171202). All operations follow appropriate animal care and use agency and national guidelines.
NOTE: Mice were raised in a specific pathogen-free (SPF) environment, with a temperature of 22 °C ± 1 °C, relative humidity of 50% ± 1%, a light/dark cycle of 12 h/12 h, and free access to food and water.
1. Mouse ovariectomy
- Sterilize the surgical instruments with a high-temperature and high-pressure sterilizer 1 day before the operation.
- Weigh 8-week-old C57BL/6 mice and intraperitoneally (i.p) inject 1% sodium pentobarbital accordingly to anesthetize the mice. The dose used is 40 mg/kg17. This dose provides 40-60 minutes of sedation, which meets the requirements of an ovariectomy. For pre-operative analgesia, inject mice with 5 mg/kg meloxicam (s.c).
NOTE: Successful anesthesia in mice can be indicated by the disappearance of deep muscle reflexes and steady breathing. Signs of successful anesthesia include no blinking when touching the inner canthus, no swallowing when pulling the tongue, no leg bending when pinching the skin between the toes, and no bouncing when needling the tail. - Apply the protective eye ointment to the eyeballs to prevent dryness during the anesthesia.
- Start the operation when mice are completely anesthetized. Place and fix the mice in the prone position on the operating surface, and shave the hair on the back after wetting them with soapy water. Disinfect the skin with 70% ethanol after shaving.
- Find the operation incision site at 0.5 cm (or 1.0 cm below the rib) on the upper edge of the thigh root of both hind limbs parallel to the spine (Figure 1A).
NOTE: A correct incision location is essential for quickly localizing the ovary. - Take the incision site as the center and disinfect the incision area with iodophor 3x, then place a surgical drape around the incision area.
- Make a longitudinal incision of about 0.5-1.0 cm using scissors. Cut the fascia and passively separate the muscles with tweezers.
- Find a piece of the white fat pad in the incision field close to the lower pole of the kidney through the thin muscle layer (Figure 1B).
NOTE: The white fat pad is the most obvious indicator of the location of the ovary. - Clamp the fat mass with hemostatic clips, and pull the ovary wrapped by the fat pad out of the incision.
- Clamp the junction of the ovary and fallopian tube with curved tweezers, and remove the ovary along the ovarian pedicle with scissors. Stop the bleeding using an electrocoagulation pen or a needle of a 1 mL syringe heated on the alcohol lamp.
NOTE: Be sure to preserve the fallopian tube, which is the anatomical landmark for the subsequent injection of sesame oil into the uterine horns. - Rinse the surgical incision with normal saline to prevent tissue adhesion, use a 4-0 suture to sew the muscle and skin respectively, and disinfect the surgical incision with iodophor again.
- Place the mice in the prone position in the cage and resuscitate them in a 25 °C incubator equipped with a light source and a ventilation system for about 2 h.
- Pay attention to the mice after the operation, put them back in the original feeding place alone until they recover completely, and give them enough water and food.
2. Postoperative rest and estrogen and progesterone formulation
- Make sure the mice rest for 2 weeks after ovariectomy.
- In an ultra-clean cabinet, add estrogen (2 ng/µL) and progesterone (0.2 ng/µL) into sesame oil in RNA enzyme-free centrifuge tubes.
- Place the centrifuge tubes in a thermostatic water bath at 37 °C and shake the tubes continuously to accelerate dissolution.
- After complete dissolution, divide the sesame oil solution into 100 µL aliqouts for convenient use. Store the prepared estrogen and progesterone solutions in a refrigerator at 4 °C.
3. Induced artificial decidualization model
- Subcutaneously (s.c) inject 100 ng of estrogen in 50 µL of sesame oil into each mouse for 3 days, followed by 2 days of rest15.
NOTE: Ensure that the estrogen and progesterone have been formulated and placed in different places. Any contamination of estrogen by progesterone may lead to failure. - Inject (s.c.) 1 mg of progesterone and 10 ng of estrogen in 50 µL of sesame oil into each mouse for another 3 days15.
- Operate the mice to induce the artificial decidualization model15 6 h after the third estrogen-progesterone combined injection.
- Find the uterus horn at the lower end of the fallopian tubes and inject 20 µL of sesame oil slowly along with the uterine horn, push the tissue back, suture the incision, and allow the mouse to recover. The approach to operation is the same as the mouse ovariectomy15.
NOTE: Only proceed with the second surgery in the event of a successful ovariectomy (skin incision is well healed, the ovary is completely excised, and the residual end of the fallopian tube is not adhered to the surrounding tissues).
NOTE: For inducing the AD model, 20 µL of sesame oil is appropriate; more than 20 µL of sesame oil will easily penetrate the other side. - Inject (s.c.) 50 µL of sesame oil containing 1 mg of progesterone and 10 ng of estrogen (H.) for another 4 days. See details in Figure 215,18.
4. Sample collection
- Euthanize the mice (n = 6) by carbon dioxide asphyxiation and collect the uteri. Observe the shape of the bilateral uteri, take photos, and weigh the uterine horns (Figure 3A, B).
- Fix 3-5 mm of the uterus tissue with 10% formalin, embed in paraffin, and section them. Stain the sections with hematoxylin and eosin to observe the morphological changes19 (Figure 4A).
- Embed another 3-5 mm of the uterus tissue in optimal cutting temperature compound (OCT), freeze in liquid nitrogen, and store in a −80 °C refrigerator. Frozen section the tissue to 10 µm and detect alkaline phosphatase activity in the uterine tissue by the azo coupling method20 (Figure 4B).
NOTE: Satisfactory results can be obtained using frozen sections to detect ALP content, not paraffin sections. - Extract the total RNAs of the uterus with Trizol reagent and perform quantitative real-time PCR (qPCR) on a real-time PCR system (Table of Materials) with qPCR master mix (Table of Materials) to detect the relative mRNA expression of prolactin family 8 subfamily member 2 (Prl8a2), alkaline phosphatase liver/bone/kidney (Alpl), and insulin-like growth factor-binding protein 1 (Igfbp1)15 by normalization to 18S mRNA levels (Figure 4C-E). Follow the PCR conditions: Stage 1, 95 °C for 30 s; Stage 2, 95 °C for 10 s and 60 °C for 30 s; repeat the cycle 40x. A complete list of primer sequences is provided in Table 1.
- Analyze qPCR data using the 2-ΔΔCT method and a t-test method for statistical analysis in the appropriate software. In this study, p < 0.05 was considered statistically significant.
Subscription Required. Please recommend JoVE to your librarian.
Representative Results
The mouse decidualization model indexes include the uterus's general morphology, the mass ratio of the decidualized and non-decidualized uterus, the histological morphology of the endometrium, and the expression level of decidualization marker molecules. The general morphology of the artificial decidualized uterus of mice induced by oil is closer to that of the uterus in pregnancy. The uterine body becomes thick, and the uterine cavity becomes smaller than the non-induced side. The volume and weight of the induced uterine horn are significantly higher than that of the non-induced side (Figure 3A,B). HE staining of uterine tissue showed that the glands disappear and the endometrial stromal cells on the induced horn differentiated into large, round, cytoplasmic, and multinucleated decidual cells with unclear cell boundaries. The non-induced side sections show the endometrial tissue morphology under a normal physiological state (Figure 4A). The result of the azo coupling method showed that the alkaline phosphatase content of the oil-induced side was significantly higher than the non-induced side (Figure 4B). The qPCR results showed that the mRNA expression of Prl8a2, Alpl, and Igfbp1 in the induced horn was significantly higher than that in the non-induced one, suggesting that oil can induce artificial decidualization in mice (Figure 4C-E).
Figure 1: The operative incision of the mouse ovariectomy. (A) Mouse ovariectomy position. (B) The position of the mouse ovary during ovariectomy. (C) The site of the ovary during ovariectomy. Please click here to view a larger version of this figure.
Figure 2: The procedure of the operation. The whole procedure includes ovariectomy, postoperative rest, the induction of the artificial decidualization model, and phenotypic validation. Please click here to view a larger version of this figure.
Figure 3: Generation of the mouse artificial decidualization model. (A) Representative picture of artificial decidualization induced by oil. The right-side uterus was not injected with oil, named oil (-). The left-side uterus was injected with oil, named oil (+). (B) The weight of the uterus injected with or without oil. *** p < 0.001. Please click here to view a larger version of this figure.
Figure 4: Validation of the mouse artificial decidualization model. (A) Representative HE picture of artificial decidualization induced by oil. Scale Bar = 1 mm and 100 µm. (B) The azo coupling method detected the alkaline phosphatase activity of artificial decidua. Scale bars = 200 µm and 50 µm. (C) The expression level of Prl8a2 mRNA was detected by qPCR. * p < 0.05. (D) The expression level of Alpl mRNA. ** p < 0.01. (E) The expression level of Igfbp1 mRNA. ** p < 0.01. Please click here to view a larger version of this figure.
| Igfbp1 Mouse qPCR-F | GCCCAACAGAAAGCAGGAGATG |
| Igfbp2 Mouse qPCR-R | GTAGACACACCAGCAGAGTCCA |
| Prl8a2 Mouse qPCR-F | ACCACAACCCATTCTCAGCTGG |
| Prl8a2 Mouse qPCR-R | TGTTCAGGTCCATGAGCTGGTG |
| Alpl Mouse qPCR-F | CCAGAAAGACACCTTGACTGTGG |
| Alpl Mouse qPCR-R | TCTTGTCCGTGTCGCTCACCAT |
| 18s Mouse qPCR-F | ATGGCCGTTCTTAGTTGGTG |
| 18s Mouse qPCR-R | CGGACATCTAAGGGCATCAC |
Table 1: List of primer sequences.
Subscription Required. Please recommend JoVE to your librarian.
Discussion
Decidualization in mice is a spontaneous process depending on the presence of embryos, which is different from humans. However, it has been found that artificial stimulation such as uterine injection of glass beads and uterine laceration can induce decidualization of the endometrium instead of embryos. In addition, researchers found that many factors could induce decidual or participate in decidualization, such as the injection of steroid hormones, prostaglandins, and growth inhibitory factors into the uterine cavity21. Compared with the modeling methods above, the mouse model detailed here with ovariectomy, using sesame oil as a stimulant, can exclude the effects of estrogen and progesterone endogenously produced. Therefore, it is economical and easy to operate.
The ovaries should be removed cleanly to prevent residual ovarian tissue, which will affect the subsequent induction of decidualization. This step aims to reduce the effects of endogenous estrogen and progesterone produced by the ovaries. Damage to the fallopian tube should be avoided because it can be used as a sign to look for the uterus when injecting the sesame oil into the uterine cavity. If abdominal adhesion or fallopian tube removal occurs, the operator must pay attention to distinguishing the uterus from the bowel.
Oil leakage easily occurs in the process of subcutaneous injection. One should select the abdominal skin as a subcutaneous injection site and avoid the nipples. It is necessary to inject the oil and pull out the needle slowly. If the needle cannot be pulled out when the mouse is active, it easily results in leakage. One should press the needle site with a cotton ball for a moment to prevent leakage. Exogenous estrogen and progesterone injections were used in this operation to keep the mice's hormone levels stable before the inducing decidualization operation. This injection method simulated hormone changes in the peri-implantation period of mice. Herein, we induced decidualization after the second estrogen peak.
The key to the success of this operation is the amount of sesame oil injected. Too much sesame oil will penetrate the cavity of the other horn of the uteri. Insufficient sesame oil will lead to decreased decidualization response or uneven decidualization along the uterus, resulting in unexpected experimental differences. During the operation, one should insert the syringe needle into the uterine cavity when injecting sesame oil and gently pull back and forth to ensure the needle is in the uterine cavity. Part of the uterine cavity can be seen as transparent if injected successfully. One should gently clamp the pinprick with tweezers for about 10 s to ensure it is closed, which can prevent the leakage of sesame oil after pulling out the needle. At the same time, gently push the uterine body downward with the needle to make the sesame oil spread evenly in the uterus cavity.
The post-operation treatment and resuscitation are other keys to this model's success. First, keeping a sterile environment for the incision during the operation is essential. Before the mice resuscitate, disinfect the operation incision with iodophor and cover it with a piece of medical gauze to reduce the incidence of infection. After the operation, the mice need to metabolize anesthetics for 2-3 h to recover. During this period, the mice need to be placed into a 25 °C incubator to recover faster and avoid hypothermia caused by the disinfection with 70% alcohol and iodophor. One should pay attention to the healing within a few days after the operation and handle kinds of operative complications in time, such as incision cracking, swelling, ulcerating, and so on.
Prl8a2 and Alpl are the most classical decidualization markers. Igfbp1 is also the main protein in decidualized cells in mice and is considered the specific marker of decidualization in mice. The expression levels of Prl8a2, Alpl, and Igfbp1 mRNA in the oil-induced uterine horn are significantly increased compared to the control side without oil injection. Moreover, alkaline phosphatase activity on the oil-induced side is significantly higher than on the control side. These results all indicate the success of the artificial decidualization model15.
The mouse artificial decidualization model can be used to validate pathogenic infertility molecules and provide a good validation model for diagnosing and treating infertility associated with abnormal endometrial decidualization. This model is useful for studying reproductive diseases, such as repeated abortion and repeated implantation failure. It is used to study the role of maternal factors in embryo implantation and invasion. This AD model has good safety, a high success rate, and solves the influence of endogenous hormones. However, it is a time-consuming and highly demanding process. We will further optimize our experimental methods to facilitate research.
Subscription Required. Please recommend JoVE to your librarian.
Disclosures
The authors have nothing to disclose.
Acknowledgments
The authors wish to acknowledge support from the National Nature Science Foundation of China (82001629, XQS), the Youth Program of Natural Science Foundation of Jiangsu Province (BK20200116, XQS), and Jiangsu Province Postdoctoral Research Funding (2021K277B, XQS).
Materials
| Name | Company | Catalog Number | Comments |
| Estrogen | Sigma | E2758 | Hormone supplement |
| Progesterone | Sigma | P0130 | Hormone supplement |
| Sesame oil | Sigma | S3547 | Hormone supplement |
| Sodium pentobarbital | Dainippon Sumitomo Pharma Co.,Ltd. | Anaesthesia | |
| Meloxicam injection | Qilu Animal Health Products Co., Ltd | Analgesia | |
| Alkaline phophatase stain kit(kaplow's/azo coupling method) | Solarbio | G1480 | Alkaline phophatase stain |
| Eosin | Servicebio | G1005-2 | HE stain |
| Hematoxylin | Servicebio | G1005-1 | HE stain |
| ChamQ Universal SYBR qPCR Master Mix | Vazyme | Q711-02 | qPCR |
| 70% ethanol | Lircon | ZH1120090 | Disinfect |
| Iodophor | Runzekang | RZK-DF | Disinfect |
| Erythromycin Eye Ointment | Guangzhou Baiyunshan | Mice eyeball protect | |
| 4-0 suture | Ethicon | W329 | Incision suture |
| 10% formalin | Yulu | L25010118 | Tissue fix |
| Optimal cutting temperature compound | Sakura | 4583 | Ssection |
| Trizol reagent | Ambion | 15596018 | qPCR |
References
- Carson, S. A., Kallen, A. N. Diagnosis and management of infertility: A review. JAMA. 326 (1), 65-76 (2021).
- Yatsenko, S. A., Rajkovic, A. Genetics of human female infertility dagger. Biology of Reproduction. 101 (3), 549-566 (2019).
- Sang, Y., Li, Y., Xu, L., Li, D., Du, M. Regulatory mechanisms of endometrial decidualization and pregnancy-related diseases. Acta Biochimica et Biophysica Sinica. 52 (2), 105-115 (2020).
- Ng, S. W., et al. Endometrial decidualization: The primary driver of pregnancy health. International Journal of Molecular Sciences. 21 (11), 4092 (2020).
- Birgit, G., Brosens, J. J. Cyclic decidualization of the human endometrium in reproductive health and failure. Endocrine Reviews. 35 (6), 851-905 (2014).
- Owusu-Akyaw, A., Krishnamoorthy, K., Goldsmith, L. T., Morelli, S. S. The role of mesenchymal-epithelial transition in endometrial function. Human Reproduction Update. 25 (1), 114-133 (2019).
- Paulson, E. E., Comizzoli, P. Endometrial receptivity and embryo implantation in carnivores-commonalities and differences with other mammalian species. Biology of Reproduction. 104 (4), 771-783 (2021).
- Kelleher, A. M., Milano-Foster, J., Behura, S. K., Spencer, T. E. Uterine glands coordinate on-time embryo implantation and impact endometrial decidualization for pregnancy success. Nature Communications. 9 (1), 2435 (2018).
- Tian, J., et al. Attenuated monoamine oxidase a impairs endometrial receptivity in women with adenomyosis via downregulation of FOXO1dagger. Biology of Reproduction. 105 (6), 1443-1457 (2021).
- Large, M. J., DeMayo, F. J. The regulation of embryo implantation and endometrial decidualization by progesterone receptor signaling. Molecular and Cellular Endocrinology. 358 (2), 155-165 (2012).
- Dunn, C. L., Kelly, R. W., Critchley, H. O. Decidualization of the human endometrial stromal cell: an enigmatic transformation. Reproductive BioMedicine Online. 7 (2), 151-161 (2003).
- Zhu, H., Hou, C. C., Luo, L. F., Hu, Y. J., Yang, W. X. Endometrial stromal cells and decidualized stromal cells: Origins, transformation and functions. Gene. 551 (1), 1-14 (2014).
- Jose, R. M., et al. Endometrial and decidual stromal precursors show a different decidualization capacity. Reproduction. 160 (1), 83-91 (2020).
- Pan-Castillo, B., et al. Morphophysical dynamics of human endometrial cells during decidualization. Nanomedicine. 14 (7), 2235-2245 (2018).
- Wang, C., et al. Comparative analysis of mouse decidualization models at the molecular level. Genes. 11 (8), 935 (2020).
- De Clercq, K., Hennes, A., Vriens, J. Isolation of mouse endometrial epithelial and stromal cells for in vitro decidualization. Journal of Visualized Experiments. (121), e55168 (2017).
- Kerger, H., et al. Microvascular oxygen delivery and interstitial oxygenation during sodium pentobarbital anesthesia. Anesthesiology. 86 (2), 372-386 (1997).
- Filant, J., Spencer, T. E. Endometrial glands are essential for blastocyst implantation and decidualization in the mouse uterus. Biology of Reproduction. 88 (4), 93 (2013).
- Sheng, X., et al. The mitochondrial protease LONP1 maintains oocyte development and survival by suppressing nuclear translocation of AIFM1 in mammals. EBioMedicine. 75, 103790 (2022).
- Grogg, E., Pearse, A. G. Coupling azo dye methods for histochemical demonstration of alkaline phosphatase. Nature. 170 (4327), 578-579 (1952).
- Labarta, E., et al. Analysis of serum and endometrial progesterone in determining endometrial receptivity. Human Reproduction. 36 (11), 2861-2870 (2021).
