A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Generating Retinal Injury Models in Xenopus Tadpoles

2.5K views

DOI:

10.3791/65771

October 13th, 2023

* These authors contributed equally

In This Article

Summary

We have developed several protocols to induce retinal damage or retinal degeneration in Xenopus laevis tadpoles. These models offer the possibility of studying retinal regeneration mechanisms.

Abstract

Retinal neurodegenerative diseases are the leading causes of blindness. Among numerous therapeutic strategies being explored, stimulating self-repair recently emerged as particularly appealing. A cellular source of interest for retinal repair is the Müller glial cell, which harbors stem cell potential and an extraordinary regenerative capacity in anamniotes. This potential is, however, very limited in mammals. Studying the molecular mechanisms underlying retinal regeneration in animal models with regenerative capabilities should provide insights into how to unlock the latent ability of mammalian Müller cells to regenerate the retina. This is a key step for the development of therapeutic strategies in regenerative medicine. To this aim, we developed several retinal injury paradigms in Xenopus: a mechanical retinal injury, a transgenic line allowing for nitroreductase-mediated photoreceptor conditional ablation, a retinitis pigmentosa model based on CRISPR/Cas9-mediated rhodopsin knockout, and a cytotoxic model driven by intraocular CoCl2 injections. Highlighting their advantages and disadvantages, we describe here this series of protocols that generate various degenerative conditions and allow the study of retinal regeneration in Xenopus.

Introduction

Millions of people worldwide are afflicted with various retinal degenerative diseases leading to blindness, such as retinitis pigmentosa, diabetic retinopathy, or age-related macular degeneration (AMD). To date, these conditions remain largely untreatable. Current therapeutic approaches under evaluation include gene therapy, cell or tissue transplantations, neuroprotective treatments, optogenetics, and prosthetic devices. Another emerging strategy is based on self-regeneration through the activation of endogenous cells with stem cell potential. Müller glial cells, the major glial cell type of the retina, are among cellular sources of interest in this context. Upon injury, they can dedifferentiate, proliferate, and generate neurons1,2,3. Although this process is very effective in zebrafish or Xenopus, it is largely inefficient in mammals.

Nonetheless, it has been shown that appropriate treatments with mitogenic proteins or overexpression of various factors can induce mammalian Müller glia cell-cycle re-entry and, in some cases, trigger their subsequent neurogenesis commitment1,2,3,4,5. This remains, however, largely insufficient for treatments. Hence, increasing our knowledge of the molecular mechanisms underlying regeneration is necessary to identify molecules able to efficiently turn Müller stem-like cell properties into new cellular therapeutic strategies.

With this aim, we developed several injury paradigms in Xenopus that trigger retinal cell degeneration. Here, we present (1) a mechanical retinal injury that is not cell type-specific, (2) a conditional and reversible cell ablation model using the NTR-MTZ system that targets rod cells, (3) a CRISPR/Cas9-mediated rhodopsin knockout, a model of retinitis pigmentosa that triggers progressive rod cell degeneration, and (4) a CoCl2-induced cytotoxic model that according to the dose can specifically target cones or lead to broader retinal cell degeneration. We highlight the particularities, advantages, and disadvantages of each paradigm.

Access restricted. Please log in or start a trial to view this content.

Protocol

Animal care and experimentation were conducted in accordance with institutional guidelines, under the institutional license A91272108. The study protocols were approved by the institutional animal care committee CEEA #59 and received authorization by the Direction Départementale de la Protection des Populations under the reference number APAFIS #32589-2021072719047904 v4 and APAFIS #21474-2019071210549691 v2. See the Table of Materials for details related to all materials, instruments, and reagents used in these protocols.

1. Mechanical retinal injury

NOTE: The injury paradigm protocol described here consists of a mechanical retinal puncture of a tadpole from stage 45 onwards. It, therefore, does not target any particular retinal cell type but damages the whole thickness of the retina at the puncture site.

  1. Preparation of the anesthetic for tadpoles
    1. Prepare a 10% stock solution of benzocaine. For a total volume of 10 mL, add 1 g of benzocaine, 2 mL of dimethyl sulfoxide (DMSO), and 8 mL of propylene glycol. Conserve the stock solution for several months at 4 °C protected from light with aluminum foil.
    2. Prepare 0.005% benzocaine solution at the time of use by adding 25 µL of 10% benzocaine stock solution to 50 mL of tadpole-rearing water (filtered and dechlorinated tap water). Mix well.
      NOTE: The concentration of benzocaine is particularly low because tadpoles are highly sensitive to anesthesia compared to adults.
  2. Pin preparation
    1. Attach a 0.2 mm diameter sterile pin to a sterilized pin holder (Figure 1A).
  3. Tadpole anesthesia
    1. Use a dip net to catch tadpoles in their tanks. Transfer them into a new tank containing the 0.005% benzocaine solution. Wait a few minutes until the tadpoles stop reacting to stimuli (tapping the tank or direct contact).
      NOTE: Several tadpoles may be anesthetized simultaneously, but the time spent in the anesthetic solution should be less than 30 min.
  4. Retinal puncture
    1. Use a spoon to catch one tadpole and put it carefully on a small Petri dish (55 mm diameter) containing a wet tissue. Position the tadpole dorsal side up in the middle of the Petri dish.
    2. Under a stereomicroscope, puncture the retina by gently inserting the pin on the dorsal side of the eye, until it passes through the retina (Figure 1A). If several pokes are needed, repeat this procedure at different places. After puncturing the right eye, turn the Petri dish 180° to puncture the left eye.
    3. Transfer the lesioned tadpole to a large tank containing 1 L of rearing water by carefully immersing the Petri dish. Monitor the tadpoles until they are fully awakened.

2. Conditional rod cell ablation using the NTR-MTZ system

The protocol aims to induce specific rod cell ablation in the Xenopus Tg(rho:GFP-NTR) transgenic line6, available at the TEFOR Paris-Saclay's zootechnics service, which hosts the French Xenopus resource center. This chemogenetic system uses the capacity of nitroreductase (NTR) enzyme to convert the prodrug metronidazole (MTZ) into a cytotoxic DNA cross-linking agent, to specifically ablate NTR-expressing rods (Figure 1B). Two detailed protocols to make Tg(rho:GFP-NTR) or Tg(rho:NTR) transgenic animals and induce degeneration have been published previously 7,8. Here, we simply detail the induction of retinal degeneration and how to monitor the degeneration process in vivo.

  1. Preparation of metronidazole solution
    1. Prepare 10 mM MTZ solution at the time of use by dissolving 1.67 g of MTZ powder in a dark bottle in 1 L of tadpole-rearing water containing 0.1% DMSO, using a magnetic stir-bar and a magnetic agitator.
      NOTE: MTZ is light-sensitive. Complete dissolution may take up to 10 min.
  2. Generating transgenic tadpoles by natural mating from the Tg(rho:GFP-NTR) line
    NOTE: Since transgenic males represent a precious stock, we prefer to generate embryos via natural mating to not sacrifice the male and to use it repeatedly.
    1. Hormone administration
      1. Inject 600 I.U. of human chorionic gonadotropin hormone (hCG) with 25G needles into the dorsal lymph sac of Xenopus laevis wild-type females. Inject transgenic males with 100-200 I.U. of hCG into the dorsal lymph sac. For live monitoring of rod degeneration (step 2.4), use albino Xenopus rather than pigmented ones, to better visualize fluorescence variations across the eye of the generated transgenic tadpoles.
        NOTE: Xenopus females can be primed with 50 I.U. of hCG 1 to 7 days before planned ovulation, but this is optional.
    2. Mating and egg collection
      1. Immediately after the hCG injection, put in a tank one Tg(rho:GFP-NTR) transgenic male together with one hCG-injected female at 20 °C until the next day. Use a large volume (at least 10 L) and add small objects for the eggs to adhere to, so that the eggs are not damaged by the adults' movements. The following day, when the frogs are no longer in amplexus, remove the adults from the tank and collect embryos.
    3. Raising of embryos and tadpoles
      1. Stage embryos and tadpoles according to the normal table of Xenopus development9.
      2. Raise embryos in a tank filled with tadpole-rearing water. From stage 45, feed tadpoles with powdered fry food and oxygenate the water with a bubbler. Add water daily if necessary to compensate for evaporation and change the whole tank water weekly.
        NOTE: Alternatively, it is also possible to exchange 50% of the volume twice a week. A detailed protocol can be found in10.
    4. Transgenic embryo sorting
      1. From stage 37/38, sort and select transgenic embryos under a fluorescence stereomicroscope by directly visualizing GFP (Figure 1C).
  3. Tadpole MTZ treatment
    1. Transfer Tg(rho:GFP-NTR) transgenic tadpoles to a tank containing 10 mM MTZ solution and rear them at 20 °C in darkness for 1 week. Use transgenic siblings raised in tadpole-rearing water containing 0.1% DMSO as controls.
    2. Change the MTZ and control solution every other day during the treatment period. Feed the tadpoles as usual during the MTZ treatment.
    3. For individual fluorescence monitoring (step 2.4), place each tadpole in its small container with 30 mL of MTZ or control solution from step 2.3.1 onward.
      NOTE: MTZ treatment can be performed at any time from stage 45 onwards.
  4. Live monitoring of rod degeneration
    NOTE: The progressive degeneration of the rods can be monitored in real time. Therefore, perform steps 2.4.1. to 2.4.4. before MTZ treatment and then regularly after treatment.
    1. Follow steps 1.1 and 1.3 for the preparation of the anesthetic and the tadpole anesthesia, respectively.
    2. Use a spoon to catch one tadpole and put it carefully on a wet tissue in a small Petri dish (55 mm diameter). Observe the GFP fluorescence under a fluorescent stereomicroscope (excitation wavelength = 488 nm and emission wavelength = 509 nm) and take photographs of the eye. A decreased fluorescence intensity reflects the degradation of rods.
      NOTE: To make quantitative comparisons, the same settings must be maintained for imaging all tadpoles.
    3. Transfer the imaged tadpole to a large tank containing 1 L of rearing water by carefully immersing the Petri dish. Monitor the tadpoles until they are fully awakened.
    4. Compare the fluorescence intensity between MTZ-treated and control tadpole eyes to monitor and assess the efficacy of the degeneration process.

3. Rod cell degeneration by CRISPR/Cas9-mediated rhodopsin knockout

NOTE: This protocol is established to generate a model of retinitis pigmentosa in Xenopus laevis by inducing specific rod cell degeneration using CRISPR/Cas9-mediated rhodopsin knockout. The % of insertion-deletion (indels) in F0 is provided in11 and is ~75%. Such a CRISPR/Cas9-mediated rhodopsin knockout can also be performed in Xenopus tropicalis tadpoles 11.

  1. Preparation of solutions and reagents
    1. crRNA and tracrRNA ordering
      1. Buy the synthetic CRISPR RNA (crRNA) targeting the rhodopsin (rho) gene and the standard trans-activating crRNA (tracrRNA). The crRNA is composed of a rho target-specific region (GCUCUGCUAAGUAAUACUGA) and another one (GUUUUAGAGCUAUGCU) that hybridizes to the tracrRNA.
    2. crRNA:tracrRNA duplex (rho gRNA duplex)
      1. Resuspend crRNA and tracrRNA at 100 µM in the nuclease-free duplex buffer.
      2. Prepare the gRNA duplex by mixing 3 µL of 100 µM rho crRNA, 3 µL of 100 µM tracrRNA, and 94 µL of duplex buffer. The final concentrations are 36 ng/µL rho crRNA, and 67 ng/µL tracrRNA.
      3. Anneal the oligos by heating them at 95 °C for 5 min and slowly cool them to room temperature. Make aliquots and store them at -20 °C.
    3. CRISPR-Cas9 ribonucleoprotein complex (i.e., gRNA duplex/Cas9 protein)
      1. At the time of use, prepare the mixture of rho gRNA duplex and the Cas9 protein. For 20 µL, add 10 µL of the rho gRNA duplex solution, 2 µL of Cas9 protein (stock at 5 mg/mL), 2 µL of fluorescein lysine dextran (stock at 10 mg/mL), and 6 µL of RNase-free water.
      2. To form the ribonucleoprotein complex, incubate for 10 min at 37 °C and let the solution cool to room temperature.
      3. For 20 µL of the control solution, mix 2 µL of Cas9 protein, 2 µL of fluorescein lysine dextran, and 16 µL of RNase-free water.
    4. Preparation of 10x, 1x, and 0.1x MBS solutions
      1. Prepare Modified Barth's Saline stock solution (10x MBS) by adding 11.92 g of HEPES, 51.43 g of sodium chloride (NaCl), 0.75 g of potassium chloride (KCl), 2.1 g of sodium bicarbonate (NaHCO3), and 2.46 g of magnesium sulfate heptahydrate (MgSO4, 7 H2O) in 800 mL of type II water. Adjust the pH to 7.8 with 30% sodium hydroxide (NaOH). Add type II water until the volume is 1 L and sterilize by autoclaving. Store at room temperature.
      2. Prepare 1 L of 1x MBS solution by diluting 100 mL of 10x MBS salt solution and 7 mL of 0.1 M calcium chloride dihydrate (CaCl2, 2H2O) in type II water. Store at room temperature.
      3. Prepare 0.1x MBS solution by diluting 1x MBS solution in type II water. Store at room temperature.
    5. Benzocaine solution for adults
      1. Prepare 0.05% benzocaine solution by adding 5 mL of 10% benzocaine stock solution (see step 1.1.1.) to 1 L of tadpole-rearing water. Mix well.
        NOTE: Conserve this solution for several months at 4 °C protected from light with aluminum foil. Bring the solution to room temperature before being used on animals.
    6. L-cysteine solution
      1. Prepare the dejellying solution at the time of use by adding 2 g of L-cysteine hydrochloric monohydrate to 100 mL of 0.1x MBS solution. Adjust the pH to 7.8 with 30% NaOH.
    7. Polysucrose solution
      1. Prepare the dense polysucrose solution by adding 3 g of polysucrose to 100 mL of 0.1x MBS solution. Store this solution for a few weeks at 4 °C.
  2. In vitro fertilization and dejellying
    NOTE: More details about Xenopus in vitro fertilization can be found in a detailed dedicated protocol in12.
    1. Hormone administration to Xenopus laevis females to induce ovulation
      1. Approximately 15 h prior to oocyte harvesting, inject 600 I.U. of hCG into the dorsal lymph sac of the female and keep it overnight at 18 °C.
    2. Testis dissection
      1. Euthanize the Xenopus male with a lethal dose of 0.05% benzocaine solution for 10-15 min. As a complementary euthanasia method, sever the spine immediately posterior to the skull with sharp and sturdy scissors. Open the abdominal cavity with dissection scissors, cut the testes out, and trim away any attached fat and capillaries. Place each testis immediately on ice in 1 mL of 1x MBS.
    3. Sperm preparation
      1. Crush one testis using a pestle for microcentrifuge tubes and dilute the suspension in a 15 mL tube containing 9 mL of 1x MBS. Add 10 µg/mL of gentamicin to the second testis tube and keep it at 4 °C for a few days for further fertilization experiments.
    4. In vitro fertilization
      1. Gently massage the back of the hormone-injected female and collect the oocytes in a Petri dish (100 mm diameter). Spread a few drops of the sperm solution to the oocytes. Wait 5 min and cover them with 0.1x MBS. Wait 10 min before proceeding with dejellying.
    5. Fertilized egg dejellying
      1. Replace the 0.1x MBS solution with the dejellying solution to remove the jelly coat from the fertilized eggs (~5 min). Thoroughly rinse the embryos 5-6 times with 0.1x MBS and transfer them to a new 100 mm Petri dish filled with 0.1x MBS.
  3. Preparation of the microinjection system
    1. Sharpen glass capillaries with a micropipette puller13.
    2. Fill a sharpened capillary with 2-10 µL of CRISPR-Cas9 ribonucleoprotein complex or the control solution using a microloader tip and place the capillary into the microinjector handler.
    3. At the highest magnification of a stereomicroscope, break off the capillary tip with fine forceps, and adjust the injection time (~400 ms) to obtain an ejection volume of 10 nL per pulse. Set the ejection pressure to around 40 PSI.
  4. One-cell-stage embryo microinjection with the CRISPR-Cas9 ribonucleoprotein complex
    1. Place one-cell-stage embryos on a grid (1 mm nylon tissue) glued in a 100 mm Petri dish filled with 3% polysucrose solution (Figure 1D).
    2. Using the microinjector and under a stereomicroscope, inject 10 nL of the CRISPR-Cas9 ribonucleoprotein complex (which corresponds to 500 pg of gRNA duplex + 5 ng of Cas9 protein per embryo) or control solution at the level of the animal pole, in the cortical region, just under the cytoplasmic membrane.
      NOTE: The fluorescein lysine dextran contained in the solution allows subsequent sorting of the injected embryos.
    3. Transfer the injected embryos to a new 100 mm Petri dish containing a clean polysucrose solution and place them at 21 °C.
    4. On the first day, regularly sort out the well-developed embryos and replace the polysucrose solution with 0.1x MBS around 5 h after microinjection.
    5. Wait for 24 h after injection to sort and select well-injected rho crispant embryos under a fluorescent stereomicroscope by visualizing fluorescein lysine dextran (Figure 1E).
      NOTE: The earlier the microinjection after fertilization, the more effective the knockout.
  5. Raising of embryos and tadpoles
    1. Raise rho crispant embryos in 0.1x MBS in Petri dishes until stage 37/38. Remove dead embryos daily and change the 0.1x MBS solution. From stage 37/38, raise embryos in a tank filled with tadpole-rearing water, and from stage 45 proceed as in step 2.2.3.

4. Retinal cell degeneration by cytotoxic intraocular CoCl 2 injections

NOTE: This protocol is established to induce retinal cell degeneration by intraocular injections of cobalt chloride (CoCl2) in Xenopus laevis tadpoles. According to the dose, it can trigger a cone-specific degeneration or a broader degeneration14. We use this protocol in Xenopus laevis tadpoles aged from stage 48 onwards. It can also be used in Xenopus tropicalis tadpoles.

  1. Preparation of buffer and reagents
    1. Prepare 0.005% benzocaine solution at the time of use as in step 1.1.
    2. Prepare 100 mM CoCl2 stock solution by adding 118.5 mg to 5 mL of 0.1x MBS (see step 3.1.4 to prepare 0.1x MBS). Conserve this stock solution for several months at 4 °C, protected from light with aluminum foil.
      CAUTION: CoCl2 is classified as a toxic compound for human and animal life. Carefully follow the instructions for handling, storage, and waste disposal on the safety data sheet.
    3. For cone-specific degeneration, prepare a 10 mM CoCl2 solution at the time of use from the 100 mM stock solution diluted in 0.1x MBS. For broader retinal cell degeneration, prepare a 25 mM CoCl2 solution.
  2. Preparation of the injection system
    1. Sharpen glass capillaries with a micropipette puller 13.
    2. Fill a sharpened capillary with 2-10 µL of 10 or 25 mM CoCl2 solution or the control solution (0.1x MBS) using a microloader tip and place the capillary into the microinjector handler.
    3. At the highest magnification of a stereomicroscope, break off the capillary tip with fine forceps, and adjust the injection time (approximately 100 ms) to obtain an ejection volume of 15-40 nL per pulse. Set the ejection pressure to ~40 PSI.
      NOTE: The size of the drop should be adapted to the stage of the tadpoles and the size of their eye. For example, at stages 48-49, the drop size is ~15-20 nL, while it is 30-40 nL at stages 52-56. Visually, the size of the drop is a little larger than the lens size.
  3. CoCl2 intraocular injections
    1. Use a dip net to catch tadpoles in their tanks. Transfer them to 50 mL of 0.005% benzocaine solution. Wait a few minutes until the tadpoles stop reacting to the stimuli.
      NOTE: Several tadpoles may be anesthetized at the same time, but the time spent in the anesthetic should be less than 30 min.
    2. Use a spoon to catch one tadpole and put it carefully in a small Petri dish (55 mm diameter) containing a wet tissue. Position the tadpole dorsal side up in the middle of the Petri dish (Figure 1F,G).
    3. Use the microinjector under a stereomicroscope to inject intraocularly the CoCl2 solution. Gently insert the capillary into the eye over the lens. When the capillary tip is inside the eye, eject two drops per eye. After injecting the right eye, turn the Petri dish manually 180° to inject the left eye.
      NOTE: Ensure that the injection is done inside the eye, so a slight swelling of the eye must be seen after each ejection of the solution. The tadpole should stay outside the water as little as possible. The injection of both eyes should take less than 1 min.
    4. Transfer the injected tadpole to a large tank containing 1 L of rearing water by immersing it carefully in the Petri dish (Figure 1H). Monitor the tadpoles until they are fully awakened.

5. Staining to assess retinal damage or retinal degeneration

  1. Tadpole fixation and dehydration
    1. Prepare 4% paraformaldehyde (PFA) solution by diluting 100 mL of 32% PFA solution into 700 mL of 1x PBS. Adjust the pH to 7.4 with NaOH. Aliquot this stock solution and conserve it for several months at -20 °C.
    2. Euthanize the tadpoles in 0.01% benzocaine and transfer them into a vial containing 4% PFA for 2 h at room temperature with agitation or overnight at 4 °C. Rinse 3 x 5 min in 1x PBS.
    3. Progressively dehydrate tadpoles by successive 30 min incubations in 70% and 95% ethanol (diluted in type II water), followed by three more 1 h incubations in 100% ethanol. Store the tadpole heads at this step at -20 °C or directly transfer them to 100% butanol overnight for further steps.
  2. Paraffin sectioning
    1. Replace 100% butanol with melted paraffin for 2 h at 62 °C. Replace the paraffin for 2 x 2 h of additional incubations at 62 °C.
    2. Transfer tadpole heads in disposable paraffin embedding molds and orient them so that their eyes are well aligned, and then allow the paraffin to harden. Store the blocks at room temperature.
    3. Trim the excess paraffin and mount the block with the embedded tadpole(s) on the microtome support.
    4. Section the block with a microtome at the appropriate thickness (10-12 µm). Transfer the ribbons with sections on a slide previously covered with 3% glycerin albumin (diluted in water).
    5. Place the slide on a slide warmer at 42 °C for a few minutes and then remove the excess of glycerin albumin. Let the slides dry overnight in an oven at 37 °C.
    6. Dewax by immersing the slides for 2 x 15 min in a Coplin jar filled with 100% xylene. Rehydrate the sections with graded ethanol series: 100% twice, 70%, 50% (diluted in type II water), ~5 min each, followed by 2 x 5 min in water.
  3. Immunofluorescence labeling
    1. Prepare 100 mM sodium citrate (CiNa) stock solution by adding 29.4 g of sodium citrate trisodium salt dihydrate (C6H5Na3O7, 2H2O) to 1 L of Type II water; adjust the pH to 6 with Hydrochloric acid (HCl). Sterilize by autoclaving and store at room temperature for several months. Prepare the unmasking solution at the time of use by adding 25 mL of 100 mM CiNa stock solution to 225 mL of type II water. Add 125 µL of Tween-20 and mix well (final concentration is 10 mM CiNa, 0.05% Tween-20).
    2. Prepare Hoechst stock solution at 10 mg/mL by adding 100 mg of bisBenzimide H 33258 to 10 mL of type I water. Conserve this stock solution for several months at 4 °C, protected from light with an aluminum foil. Prepare Hoechst solution at 7.5 µg/mL by adding 300 µL of Hoechst stock solution to 400 mL of 1x PBS.
      NOTE: This solution may be used up to 10 times and conserved for around 6 months at 4 °C, protected from light with aluminum foil.
    3. After dewaxing sections, perform antigen retrieval by boiling the sections in the unmasking solution for 9 min. Let the solution cool for 20 min.
    4. Rinse once in type II water and once in 1x PBS. Put the slides flat in a humid chamber and add 400-600 µL of blocking solution per slide (antibody diluent + 0.2% Triton X100) for 30 min.
    5. Replace the blocking solution with 200 µL per slide of the primary antibody diluted in the blocking solution. Use a coverslip to spread the solution over the sections, avoiding bubble formation. Incubate overnight at 4 °C in a humid chamber.
    6. Transfer the slides to a Coplin jar and rinse for 3 x 10 min in 1x PBS supplemented with 0.1 % Triton X100. Put the slides flat, add 400 µL per slide of the secondary antibody diluted in blocking solution, and leave for 2 h at room temperature in a humid chamber.
    7. Transfer slides to a Coplin jar and rinse for 3 x 5 min with 1x PBS supplemented with 0.1% Triton X100.
    8. Counterstain cell nuclei with the Hoechst solution for 10 min and rinse 3 x 5 min with 1x PBS.
    9. Place coverslips over slides in an aqueous mounting medium specifically designed to preserve fluorescence. Let the slides dry for 1 h at room temperature and store them at 4 °C.
    10. Image the slides with a fluorescence microscope.
  4. Hematoxylin and eosin (H&E) staining to assess retinal damage
    NOTE: Instead of labeling a particular cell type by immunostaining, general retinal histology can be assessed with H&E coloration.
    1. After dewaxing sections, perform nucleic acid labeling by immersing slides in hematoxylin solution for 2 min. Rinse well with tap water.
    2. Perform cytoplasm labeling by immersing slides in 1% eosin solution for 1 min. Rinse quickly with water.
      NOTE: Eosin is very soluble; if the slides are left too long in the water, all the dye disappears.
    3. Rinse 2 x 5 min in 100% ethanol and 2 x 5 min in xylene.
    4. Under the hood, place coverslips over the slides in 4-5 drops of a mounting medium. Let the slides dry under a hood and image the following day with a microscope.
  5. Detection of apoptotic cells
    1. After dewaxing sections (see section 5.2.6), follow the kit manufacturer's protocol to detect apoptotic DNA fragmentation.
    2. Perform nuclei staining by immersing slides in Hoechst solution (see section 5.3.8) and mount with an aqueous mounting medium specifically designed to preserve fluorescence. Let the slides dry for 1 h at room temperature and store them at 4 °C.
    3. Image the slides with a fluorescence microscope.

Access restricted. Please log in or start a trial to view this content.

Results

Mechanical retinal injury
Retinal sections of tadpoles subjected to the mechanical injury described in protocol section 1 show that the retinal lesion encompasses all layers of the tissue while remaining limited to the puncture site (Figure 2A,B).

Conditional rod cell ablation using the NTR-MTZ system
The eyes of anesthetized Tg(rho:GFP-NTR) transgenic tadpoles treated with MTZ treatment, as descr...

Access restricted. Please log in or start a trial to view this content.

Discussion

Advantages and disadvantages of various retinal injury paradigms in Xenopus tadpoles

Mechanical retinal injury
Various surgical injuries of the neural retina have been developed in Xenopus tadpoles. The neural retina may either be entirely removed15,16 or only partly excised16,17. The mechanical injury presented here doe...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors have no conflicts of interest to disclose.

Acknowledgements

This research was supported by grants to M.P. from the Association Retina France, Fondation de France, FMR (Fondation Maladies Rares), BBS (Association du syndrome de Bardet-Biedl), and UNADEV (Union Nationale des Aveugles et Déficients Visuels) in partnership with ITMO NNP (Institut Thématique Multi-Organisme Neurosciences, sciences cognitives, neurologie, psychiatrie) / AVIESAN (Alliance Nationale pour les sciences de la vie et de la santé).

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
1,2-Propanediol (propylène glycol)Sigma-Aldrich398039
Absolute ethanol ≥99.8%VWR chemicals20821-365
Anti-Cleaved Caspase 3 antibody (rabbit)Cell signaling9661SDilution 1/300
Anti-GFP antibody (chicken)AveslabsGFP-1020Dilution 1/500
Anti-M-Opsin antibody (rabbit)Sigma-AldrichAB5405Dilution 1/500
Anti-mouse secondary antibody, Alexa Fluor 594 (goat)Invitrogen Thermo ScientificA11005Dilution 1/1,000
Anti-Otx2 antibody (rabbit)AbcamAb183951Dilution 1/100
Anti-rabbit secondary antibody, Alexa Fluor 488 (goat)Invitrogen Thermo ScientificA11008Dilution 1/1,000
Anti-rabbit secondary antibody, Alexa Fluor 594 (goat)Invitrogen Thermo ScientificA11012Dilution 1/1,000
Anti-Recoverin antibody (rabbit)Sigma-AldrichAB5585Dilution 1/500
Anti-Rhodopsin antibody (mouse)Sigma-AldrichMABN15Dilution 1/1,000
Anti-S-Opsin antibody (rabbit)Sigma-AldrichAB5407Dilution 1/500
Apoptotis detection kit (Dead end fluorimetric TUNEL system)PromegaG3250
Benzocaine Sigma-AldrichE1501Stock solution 10%
bisBenzimide H 33258 (Hoechst)Sigma-AldrichB2883Stock solution 10 mg/mL
Butanol-1 ≥99.5%VWR chemicals20810.298
Calcium chloride dihydrate (CaCl2, 2H2O)Sigma-Aldrich (Supelco)1.02382Use at 0.1 M
Cas9 (EnGen Spy Cas9 NLS)New England BiolabsM0646T
Clark Capillary Glass model GC100TF-10Warner Instruments (Harvard Apparatus)30-0038
Cobalt(II) chloride hexahydrate (CoCl2, 6H2O)Sigma-AldrichC8661Stock solution 100 mM
Coverslip 24 x 60 mmVWR631-1575
Dako REAL ab diluent AgilentS202230-2
Dimethyl sulfoxide (DMSO)Sigma-AldrichD8418
Electronic Rotary MicrotomeThermo ScientificMicrom HM 340E 
Eosin 1% aqueousRAL Diagnostics312740
Fluorescein lysine dextran  Invitrogen Thermo ScientificD1822
Fluorescent stereomicroscopeOlympusSZX 200
GentamycinEuromedexEU0410-B
Glycerin albumin acc. MalloryDiapathE0012Use at 3% in water
Hematoxylin (Mayer's Hemalun)RAL Diagnostics320550
HEPES potassium saltSigma-AldrichH0527
Human chorionic gonadotropin hormoneMSD Animal HealthChorulon 1500
Hydrochloric acid fuming, 37% (HCl)Sigma-Aldrich (SAFC)1.00314
L-Cysteine hydrochloride monohydrateSigma-AldrichC7880Use at 2% in 0.1x MBS (pH 7.8 - 8.0)
Magnesium Sulfate Heptahydrate (MgSO4, 7H2O)Sigma-Aldrich (Supelco)1.05886
Metronidazole Sigma-Aldrich (Supelco)M3761Use at 10 mM
Microloader tipsEppendorf5242956003
Micropipette puller (P-97 Flaming/Brown)Sutter Instrument Co.Model P-97Program : Heat 700 / Pull 100 / Vel 75 / Time 90 / Unlocked p = 500
Mounting medium to preserve fluorescence, FluorSave ReagentMillipore345789
Mounting medium, EukittChem-LabCL04.0503.0500
MX35 Ultra Microtome bladeEpredia3053835
Needle Agani 25 G x 5/8''TerumoAN*2516R1
Nickel Plated Pin HolderFine Science Tools26016-12
Nylon filtration tissue (sifting fabric) NITEX, mesh opening 1,000 µmSefar06-1000/44
Paraffin histowax without DMSOHistolab00403
Paraformaldehyde solution (32%)Electron Microscopy SciencesEM-15714-SUse at 4% in 1x PBS pH 7.4
Peel-A-Way Disposable Embedding MoldsEpredia2219
PestleVWR431-0094
Petri Dish 100 mmCorning GosselinSB93-101
Petri Dish 55 mmCorning GosselinBP53-06
Phosphate Buffer Saline Solution (PBS) 10xEuromedexET330-A
PicoSpritzer Microinjection systemParker Instrumentation ProductsPicoSpritzer III
Pins Fine Science Tools26002-20
Polysucrose (Ficoll PM 400 )Sigma-AldrichF4375Use at 3% in 0.1x MBS
Potassium chloride (KCl)Sigma-AldrichP3911
Powdered fry food : sera Micron Naturesera45475 (00720)
Scissors dissectionFine Science Tools14090-09
Slide Superfrost  KNITTEL GlassVS11171076FKA 
Slide warmerKunz instrumentsHP-3
Sodium chloride (NaCl)Sigma-AldrichS7653
Sodium citrate trisodium salt dihydrate (C6H5Na3O7, 2H2O)VWR chemicals27833.294
Sodium hydrogen carbonate (NaHCO3)Sigma-Aldrich (Supelco)1.06329
Sodium hydroxide 30% aqueous solution (NaOH)VWR chemicals28217-292
StereomicroscopeZeissStemi 2000
Syringes Omnifix-F Solo Single-use Syringes 1 mLB-BRAUN9161406V
trans-activating crRNA (tracrRNA)Integrated DNA Technologies1072533
Triton X-100Sigma-AldrichX-100
Tween-20Sigma-AldrichP9416
X-Cite 200DC Fluorescence IlluminatorX-Cite 200DC
Xylene ≥98.5% VWR chemicals28975-325

References

  1. Goldman, D. Müller glial cell reprogramming and retina regeneration. Nature reviews. Neuroscience. 15 (7), 431-442 (2014).
  2. Hamon, A., Roger, J. E., Yang, X. -J., Perron, M. Müller glial cell-dependent regeneration of the neural retina: An overview across vertebrate model systems. Developmental Dynamics. 245 (7), 727-738 (2016).
  3. García-García, D., Locker, M., Perron, M. Update on Müller glia regenerative potential for retinal repair. Current Opinion in Genetics & Development. 64, 52-59 (2020).
  4. Todd, L., et al. Efficient stimulation of retinal regeneration from Müller glia in adult mice using combinations of proneural bHLH transcription factors. Cell Reports. 37 (3), 109857(2021).
  5. Hoang, T., et al. Gene regulatory networks controlling vertebrate retinal regeneration. Science. 370 (6519), (2020).
  6. Langhe, R., et al. Müller glial cell reactivation in Xenopus models of retinal degeneration. Glia. 65 (8), 1333-1349 (2017).
  7. Chesneau, A., Bronchain, O., Perron, M. Conditional chemogenetic ablation of photoreceptor cells in Xenopus retina. Methods in Molecular Biology. 1865, 133-146 (2018).
  8. Martinez-De Luna, R. I., Zuber, M. E. Rod-specific ablation using the nitroreductase/metronidazole system to investigate regeneration in Xenopus. Cold Spring Harbor protocols. 2018 (12), (2018).
  9. Zahn, N., et al. Normal Table of Xenopus development: a new graphical resource. Development. 149 (14), (2022).
  10. McNamara, S., Wlizla, M., Horb, M. E. Husbandry, general care, and transportation of Xenopus laevis and Xenopus tropicalis. Methods in Molecular Biology. 1865, 1-17 (2018).
  11. Parain, K., et al. CRISPR/Cas9-mediated models of retinitis pigmentosa reveal differential proliferative response of Müller cells between Xenopus laevis and Xenopus tropicalis. Cells. 11 (5), 807(2022).
  12. Wlizla, M., McNamara, S., Horb, M. E. Generation and care of Xenopus laevis and Xenopus tropicalis embryos. Methods in Molecular Biology. 1865, 19-32 (2018).
  13. Yuan, S., Sun, Z. Microinjection of mRNA and morpholino antisense oligonucleotides in zebrafish embryos. Journal of Visualized Experiments JoVE. (27), (2009).
  14. Parain, K., Chesneau, A., Locker, M., Borday, C., Perron, M. Regeneration from three cellular sources and ectopic mini-retina formation upon neurotoxic retinal degeneration in Xenopus. bioRxiv. , (2023).
  15. Vergara, M. N., Del Rio-Tsonis, K. Retinal regeneration in the Xenopus laevis tadpole: a new model system. Molecular Vision. 15, 1000-1013 (2009).
  16. Lee, D. C., Hamm, L. M., Moritz, O. L. Xenopus laevis tadpoles can regenerate neural retina lost after physical excision but cannot regenerate photoreceptors lost through targeted ablation. Investigative Ophthalmology & Visual Science. 54 (3), 1859-1867 (2013).
  17. Martinez-De Luna, R. I., Kelly, L. E., El-Hodiri, H. M. The retinal homeobox (Rx) gene is necessary for retinal regeneration. Developmental Biology. 353 (1), 10-18 (2011).
  18. Choi, R. Y., et al. Cone degeneration following rod ablation in a reversible model of retinal degeneration. Investigative Ophthalmology & Visual Science. 52 (1), 364-373 (2011).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Retinal RegenerationMuller Glial CellsMechanical Retinal InjuryPhotoreceptor AblationCRISPR Rhodopsin KnockoutCobalt Chloride InjectionFluorescent StereomicroscopeRetinal Degeneration