Here, we present a protocol to detect four zoonotic intestinal parasites from multiple sources simultaneously based on a combination of polymerase chain reaction (PCR) based integrated molecular detection system.
A subscription to JoVE is required to view this content. Sign in or start your free trial.
Method Article
Here, we present a protocol to detect four zoonotic intestinal parasites from multiple sources simultaneously based on a combination of polymerase chain reaction (PCR) based integrated molecular detection system.
Infectious diseases are critical factors affecting human health, economic development, and social stability. Among them, zoonotic intestinal parasitic diseases have increasingly become a focus of global concern as emerging, re-emerging infectious diseases, particularly Cryptosporidium, Enterocytozoon bieneusi, Blastocystis, and Giardia. Only a few studies were published on the epidemiology of the above parasites, accompanied by issues such as single detection targets, low detection rates, and high missing detection rates. This study aims to establish an integrated molecular detection system based on a combination of PCR tests for simultaneous detection of the above four zoonotic intestinal parasites in samples collected from wild mice, companion pets, and livestock (cattle and sheep), in order to provide an efficient technical support for routine parasite detection in multiple scenarios, including animal-environment interfaces especially in local surveillance facilities.
In this study, taking the detection of Enterocytozoon bieneusi in feces from 95 wild mice and 30 cats and dogs (25 from cats and 5 from dogs) as primary test, when two sets of primers were used to amplify the ITS gene, the positive results of each PCR were exactly the same (5.26%), but the combination of 2 sets of polymerase chain reaction (PCR) tests resulted higher positive rate (6.32%) for Enterocytozoon bieneusi. For Giardia, 9 positive samples were detected using the beta-giardin (BG) gene, while no positives were detected using the glutamate dehydrogenase (GDH) and triose phosphate isomerase (TPI) genes. The above results demonstrated that a combination of PCR tests for multiple target genetic segments enhanced the detection capacity for designated pathogens, compared to any single PCR test. Target sequences were confirmed by Sanger sequencing. This system was designed to enhance and facilitate the surveillance of infection status, distribution, and phylogenetic evolution of zoonotic intestinal parasites from multiple sources, providing a basis for accurate and sensitive warnings at an early stage. This aims to build a technical bridge for achieving the One Health goal across human-animal-environment interfaces.
The Cryptosporidium, Enterocytozoon bieneusi, Blastocystis, and Giardia are common and easily neglected protozoan pathogens with global prevalence. In recent years, due to factors such as reclamation and intrusion into the ecological niches of natural foci, the popularity of companion animal breeding, and the development of livestock and poultry breeding, the prevalence of multi-source zoonotic intestinal parasitic diseases in rodents, companion animals (cats and dogs), and livestock (cattle and sheep) has increasingly become a focus of emerging, outbreak, and re-emerging infectious diseases at domestic and rural areas, seriously endangering human health and global public health security1,2,3,4.
These parasites have complex intra-generic species and extensive host adaptability. They can infect not only rodents, companion animals, livestock ruminants, poultry, and birds, but also zoonotic species, which can infect humans, causing clinical symptoms such as abdominal pain, diarrhea, and vomiting. They are particularly susceptible among the children, the elderly, pregnant women, and immunocompromised populations, and can be transmitted through water, food, and air, posing significant zoonotic public health risks3,5,6.
Currently, the identification of the above four parasites primarily relies on morphology, which is prone to misidentification due to morphological similarities within genera and subjective factors, particularly in distinguishing between species and genotypes. Molecular biology techniques have been widely used for identifying species, genera, and genotypes of these parasites. For Blastocystis and Cryptosporidium, detection mainly focuses on the small subunit ribosomal ribonucleic acid (SSU rRNA) gene3,7,8; for Enterocytozoon bieneusi, the internal transcribed spacer (ITS) gene4,9; and for Giardia, the beta-giardin (BG), glutamate dehydrogenase (GDH), and triose phosphate isomerase (TPI) genes10,11. Although nested conventional polymerase chain reaction (PCR) has greatly improved the identification and typing capabilities of these four parasites, it is insufficient in detecting missed cases and identifying new species or quasispecies with significant genetic characteristics. This often affects the efficiency of epidemiological investigation, transmission, and disease control in humans, animals, and other hosts, posing great challenges to public health security in humans, animals, and the environment.
Due to the similarities in symptoms, transmission routes, and host range of these four parasites, there is not yet any integrated molecular system for efficient detection while avoiding missing detection and accurately identifying new species or quasispecies with significant genetic differences. This study established a mature integrated molecular detection system based on PCR-high-throughput sequencing technology by reviewing literature, for the simultaneous detection of the four zoonotic intestinal parasites in multi-source samples (wild mice, companion animals, cattle, and sheep). Combined with bioinformatics analysis, this system was applied to identify multi-source zoonotic intestinal parasites, monitor epidemiological factors such as infection distribution and phylogenetic evolution, and early warning of human and animal infections and environmental contamination.
Access restricted. Please log in or start a trial to view this content.
The study was approved and conducted by the animal ethics committee of Jiangsu Provincial Center for Disease Control and Prevention. This study was conducted in accordance with the 2020 Edition of the American Veterinary Medical Association Guidelines on Animal Euthanasia, the guiding principles of the Regulations on the Administration of Experimental Animals (Order No. 2 of the State Science and Technology Commission of the People's Republic of China, 1988), and the Guiding Principles for the Humane Treatment of Animals issued by the Ministry of Science and Technology of the People's Republic of China.
1. Preparation of fresh feces from wild mice, companion animals, and livestock (cattle and sheep)
2. Extraction of total DNA from fresh feces of wild mice, companion animals, and livestock (cattle and sheep)
3. Nested conventional PCR detection of Cryptosporidium and Blastocystis targeting small subunit ribosomal RNA (SSU rRNA)
NOTE: Dream Taq Green PCR Mix was used for this step.
| Pathogen | Expected product size (bp) | Primer sequences (5′-3′) | References | ||
| Cryptosporidium | 830 | F1: CCATTTCCTTCGAAACAGGA | 1 | ||
| R1: TTCTAGAGCTAATACATGCG | |||||
| F2: AAGGAGTAAGGAACAACCTCCA | |||||
| R2: GGAAGGGTTGTATTTATTAGATAAAG | |||||
| 607 | F-1: GACATATCATTCAAGTTTCTGACC | 8,11 | |||
| R1-1: CTGAAGGAGTAAGGAACAACC | |||||
| R2-1: TCTAAGAATTTCACCTCTGACTG | |||||
| Blastocystis | 600 | F1: GGGATCCTGATCCTTCCGCAGGTTCACCTAC | 3 | ||
| R1: GGAAGC TTATCTGGTTGATCCTGCCAGTA | |||||
| F2: ATCTGGTTGATCCTGCCAGT | |||||
| R2: GAGCTTTTTAACTGCAACAACG | |||||
| 460 | F1-1: TGCTTTCGCACTTGTTCATC | 3,12 | |||
| F2-1: GATTTATTGTCACTACCTCC | |||||
| R-1: ATCTGGTTGATCCTGCCAGT | |||||
Table 1: Primer sequences for SSU rRNA of Cryptosporidium and Blastocystis.
4. Nested conventional PCR detection of Enterocytozoon bieneusi ITS Gene, and Giardia BG, GDH, and TPI genes
NOTE: Dream Taq Green PCR Mix was used for this step.
| Pathogen | Expected product size (bp) | Primer sequences (5′-3′) | References | ||
| Enterocytozoon bieneusi | 390 | F1: GGTCATAGGGATGAAGAG | 9 | ||
| R1: TTCGAGTTCTTTCGCGCTC | |||||
| F2: GCTCTGAATATCTATGGCT | |||||
| R2: ATCGCCGACGGATCCAAGTG | |||||
| 390 | F1-1: GATGGTCATAGGGATGAAGAGCTT | 2 | |||
| R1-1: TATGCTTAAGTCCAGGGAG | |||||
| F2-1: AGGGATGAAGAGCTTCGGCTCTG | |||||
| R2-1: AGTGATCCTGTATTAGGGATATT | |||||
| Giardia | 511 | BG-F1: AAGCCCGACGACCTCACCCGCAGTGC | 2,10 | ||
| BG-R1: GAGGCCGCCCTGGATCTTCGAGACGAC | |||||
| BG-F2: GAACGAACGAGATCGAGGTCCG | |||||
| BG-R2: CTCGACGAGCTTCGTGTT | |||||
| 530 | GDH-F1: TTCCGTRTYCAGTACAACTC | 2,10 | |||
| GDH-R1: ACCTCGTTCTGRGTGGCGCA | |||||
| GDH-F2: ATGACYGAGCTYCAGAGGCACGT | |||||
| GDH-R2: GTGGCGCARGGCATGATGCA | |||||
| 530 | TPI-F1: AAATIATGCCTGCTCGTCG | 2,10 | |||
| TPI-R1: CAAACCTTITCCGCAAACC | |||||
| TPI-F2: CCCTTCATCGGIGGTAACTT | |||||
| TPI-R2: GTGGCCACCACICCCGTGCC | |||||
Table 2: Primer sequences for Enterocytozoon bieneusi ITS gene, and Giardia BG, GDH, and TPI genes.
Access restricted. Please log in or start a trial to view this content.
Mice Cryptosporidium, Blastocystis SSU rRNA gene, Enterocytozoon bieneusi ITS gene, and Giardia BG gene PCR testing results
All 95 rectal fecal samples from mice were tested for the ITS gene of Enterocytozoon bieneusi using two sets of primers, resulting 5 positive samples for each method, resulting 6 positive samples in t...
Access restricted. Please log in or start a trial to view this content.
The Cryptosporidium, Enterocytozoon bieneusi, Blastocystis, and Giardia are common zoonotic intestinal parasites; the first two are classified as Category B biological pathogens by the U.S. National Institutes of Health (NIH), and all four are listed by the World Health Organization (WHO) as 24 of the most important food-borne parasites worldwide. They can potentially infect humans, animals, and contaminate the environment, which may cause disease outbreaks and significantly affect pub...
Access restricted. Please log in or start a trial to view this content.
The authors have nothing to disclose.
This study was supported by the Jiangsu Provincial Health Commission (grant nos. Ym2023024), Yancheng Municipal Medical Research Project (grant no. YK2023085), and the Open Fund of the Key Laboratory of Pathogenic Microbiology for Emerging and Re-emerging Infectious Diseases (Jiangsu Provincial Center for Disease Control and Prevention) (PM202402).
Access restricted. Please log in or start a trial to view this content.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| Agarose | Qingke Tech | TSJ001 | |
| Qiaquick gel extraction kit | Qiagen | 28704 | DNA gel extraction kit |
| 100 bp Plus DNA Ladder | TransGen Biotech | BM311 | DNA Ladder |
| 4S Green Plus Nucleic Acid Stain | BBI | A616696-0500 | DNA stain |
| 10×TBE Buffer | Solarbio | T1051 | electrophoreisis buffer |
| Qubit 4.0 | Thermo | https://www.thermofisher.com/in/en/home /industrial/spectroscopy-elemental -isotope-analysis/molecular-spectroscopy/ fluorometers/qubit/models/qubit-4.html? ef_id=:G:s&s_kwcid=AL!3652!10!77515 785702067!!!!77516061528018!!380468 453!1240249321530142&cid=bid_pca_ aqb_r01_co_cp1359_pjt0000_bid 00000_0se_bng_bt_pur_con | Fluorescence quantitative instrument |
| MINI Space 1000 | Tanon | http://en.biotanon.com/PRODUCT/ PRODUCTLIST?ID=3040& TYPE=DETAIL | Gel imager |
| Fast DNA Stool Mini Kit for DNA extraction | QIAGEN | 51604 | Nucleic acid extraction kit |
| ProFlex Base | Thermo | https://www.thermofisher.com/ in/en/home/life-science/pcr/ thermal-cyclers-realtime- instruments/thermal-cyclers /proflex-pcr-system.html | PCR |
| Dream Taq Green PCR Mix | Thermo | K1082 | Pcr amplification |
Access restricted. Please log in or start a trial to view this content.