Integrated PCR-Based Molecular Detection System for the Simultaneous Detection of Four Zoonotic Intestinal Parasites from Multiple Sources

Summary

Here, we present a protocol to detect four zoonotic intestinal parasites from multiple sources simultaneously based on a combination of polymerase chain reaction (PCR) based integrated molecular detection system.

Abstract

Infectious diseases are critical factors affecting human health, economic development, and social stability. Among them, zoonotic intestinal parasitic diseases have increasingly become a focus of global concern as emerging, re-emerging infectious diseases, particularly Cryptosporidium, Enterocytozoon bieneusi, Blastocystis, and Giardia. Only a few studies were published on the epidemiology of the above parasites, accompanied by issues such as single detection targets, low detection rates, and high missing detection rates. This study aims to establish an integrated molecular detection system based on a combination of PCR tests for simultaneous detection of the above four zoonotic intestinal parasites in samples collected from wild mice, companion pets, and livestock (cattle and sheep), in order to provide an efficient technical support for routine parasite detection in multiple scenarios, including animal-environment interfaces especially in local surveillance facilities.

In this study, taking the detection of Enterocytozoon bieneusi in feces from 95 wild mice and 30 cats and dogs (25 from cats and 5 from dogs) as primary test, when two sets of primers were used to amplify the ITS gene, the positive results of each PCR were exactly the same (5.26%), but the combination of 2 sets of polymerase chain reaction (PCR) tests resulted higher positive rate (6.32%) for Enterocytozoon bieneusi. For Giardia, 9 positive samples were detected using the beta-giardin (BG) gene, while no positives were detected using the glutamate dehydrogenase (GDH) and triose phosphate isomerase (TPI) genes. The above results demonstrated that a combination of PCR tests for multiple target genetic segments enhanced the detection capacity for designated pathogens, compared to any single PCR test. Target sequences were confirmed by Sanger sequencing. This system was designed to enhance and facilitate the surveillance of infection status, distribution, and phylogenetic evolution of zoonotic intestinal parasites from multiple sources, providing a basis for accurate and sensitive warnings at an early stage. This aims to build a technical bridge for achieving the One Health goal across human-animal-environment interfaces.

Introduction

The Cryptosporidium, Enterocytozoon bieneusi, Blastocystis, and Giardia are common and easily neglected protozoan pathogens with global prevalence. In recent years, due to factors such as reclamation and intrusion into the ecological niches of natural foci, the popularity of companion animal breeding, and the development of livestock and poultry breeding, the prevalence of multi-source zoonotic intestinal parasitic diseases in rodents, companion animals (cats and dogs), and livestock (cattle and sheep) has increasingly become a focus of emerging, outbreak, and re-emerging infectious diseases at domestic and rural areas, seriously endangering human health and global public health security^1,2,3,4.

These parasites have complex intra-generic species and extensive host adaptability. They can infect not only rodents, companion animals, livestock ruminants, poultry, and birds, but also zoonotic species, which can infect humans, causing clinical symptoms such as abdominal pain, diarrhea, and vomiting. They are particularly susceptible among the children, the elderly, pregnant women, and immunocompromised populations, and can be transmitted through water, food, and air, posing significant zoonotic public health risks^3,5,6.

Currently, the identification of the above four parasites primarily relies on morphology, which is prone to misidentification due to morphological similarities within genera and subjective factors, particularly in distinguishing between species and genotypes. Molecular biology techniques have been widely used for identifying species, genera, and genotypes of these parasites. For Blastocystis and Cryptosporidium, detection mainly focuses on the small subunit ribosomal ribonucleic acid (SSU rRNA) gene^3,7,8; for Enterocytozoon bieneusi, the internal transcribed spacer (ITS) gene^4,9; and for Giardia, the beta-giardin (BG), glutamate dehydrogenase (GDH), and triose phosphate isomerase (TPI) genes^10,11. Although nested conventional polymerase chain reaction (PCR) has greatly improved the identification and typing capabilities of these four parasites, it is insufficient in detecting missed cases and identifying new species or quasispecies with significant genetic characteristics. This often affects the efficiency of epidemiological investigation, transmission, and disease control in humans, animals, and other hosts, posing great challenges to public health security in humans, animals, and the environment.

Due to the similarities in symptoms, transmission routes, and host range of these four parasites, there is not yet any integrated molecular system for efficient detection while avoiding missing detection and accurately identifying new species or quasispecies with significant genetic differences. This study established a mature integrated molecular detection system based on PCR-high-throughput sequencing technology by reviewing literature, for the simultaneous detection of the four zoonotic intestinal parasites in multi-source samples (wild mice, companion animals, cattle, and sheep). Combined with bioinformatics analysis, this system was applied to identify multi-source zoonotic intestinal parasites, monitor epidemiological factors such as infection distribution and phylogenetic evolution, and early warning of human and animal infections and environmental contamination.

Protocol

The study was approved and conducted by the animal ethics committee of Jiangsu Provincial Center for Disease Control and Prevention. This study was conducted in accordance with the 2020 Edition of the American Veterinary Medical Association Guidelines on Animal Euthanasia, the guiding principles of the Regulations on the Administration of Experimental Animals (Order No. 2 of the State Science and Technology Commission of the People's Republic of China, 1988), and the Guiding Principles for the Humane Treatment of Animals issued by the Ministry of Science and Technology of the People's Republic of China.

1. Preparation of fresh feces from wild mice, companion animals, and livestock (cattle and sheep)

1. Anesthetize mice by carbon dioxide inhalation from a canned compressed carbon dioxide source in a transparent airtight plastic box, with a replacement rate of 30%-70% of the container volume per minute. After complete anesthesia and coma, perform cervical dislocation on the mice.
2. Fresh fecal sample collection: Collect fecal samples from dogs, cats, cattle, and sheep within 1 h after defecation, with one tube per animal's feces, and avoid cross-contamination.
   1. Capture rodents using bait cages with release devices in different wild habitats. Place the captured mice in mouse bags and promptly transport them to the laboratory. Under sterile operation in a biosafety cabinet, dissect the mice to collect the rectum containing feces, place it in a 2 mL cryotube, and store it at -80 °C for later detection.
   2. Select dogs and cats from pet stores in different regions as research objects. Collect freshly excreted feces immediately, into 5 mL cryotubes, labeled with complete sample information, and promptly transport them to the laboratory for storage at -80 °C.
   3. Select cattle and sheep from livestock farms (intensive or free-range) as research objects. Collect freshly excreted feces immediately into 50 mL cryotubes, labeled with complete sample information, and promptly transport them to the laboratory for storage at -80 °C.

2. Extraction of total DNA from fresh feces of wild mice, companion animals, and livestock (cattle and sheep)

1. Fecal pretreatment:
   NOTE: QIAamp Fast DNA Stool Mini Kit was used.
   1. Under sterile operation in a biosafety cabinet, add approximately 200 mg of feces from different sources into the phosphate-buffered saline(PBS) buffer, add steel beads, and homogenize thoroughly using a tissue grinder.
   2. Heat this at 70 °C for 5 min and centrifuge at 10,000 × g for 10 min at room temperature (15-25 °C).
   3. Add 600 µL of supernatant to a 2 mL centrifuge tube containing 25 µL of proteinase K, add 600 µL of Buffer AL, and vortex for 15 s.
   4. Incubate at 70 °C for 10 min. Add 600 µL of 100% anhydrous ethanol to the lysate and vortex to mix.
2. Carefully add 600 µL of the lysate to a spin column, centrifuge at 14000 × g for 1 min, and place the spin column in a new 2 mL collection tube. Repeat this step once more.
3. Carefully open the spin column, add 500 µL of Buffer AW1, centrifuge at maximum speed for 1 min, and place the spin column in a new 2 mL collection tube. Carefully open the spin column, add 500 µL of Buffer AW2, and centrifuge at maximum speed for 3 min.
4. Place the spin column in a new 2 mL collection tube (prepared separately) and centrifuge at 14000 × g for 3 min. Place the spin column in a new labeled 1.5 mL centrifuge tube, and add 100 µL of Elution Buffer directly to the spin column membrane.
5. Incubate at room temperature (15-25 °C) for 1 min, and centrifuge at 14000 × g for 1 min to elute DNA.
6. Determine the concentration and purity of the DNA using an ultra-micro spectrophotometer. Use the extracted DNA for subsequent detection or store it at -20 °C for long-term preservation.
   NOTE: The A260/A280 ratio should be 1.8-2.0 to ensure the integrity and purity of the extracted DNA.

3. Nested conventional PCR detection of Cryptosporidium and Blastocystis targeting small subunit ribosomal RNA (SSU rRNA)

NOTE: Dream Taq Green PCR Mix was used for this step.

1. Prepare the PCR reaction system on ice using PCR Mix: 25 µL of 2× Taq buffer, 2 µL of each of forward and reverse primers, 16 µL of ddH₂O, and 5 µL of template, with a total volume of 50 µL.
2. For Cryptosporidium, follow steps 3.2.1-3.2.2.
   1. Use F1R1¹ and F-1R1-1^8,11as the first-round reaction primers. Set the reaction program: initial denaturation at 94 °C for 5 min, 30 cycles of denaturation at 94 °C for 40 s, annealing at 55 °C for 40 s, and extension at 72 °C for 90 s, with a final elongation at 72 °C for 7 min.
   2. Use F2R2¹ and F-1R2-1^8,11as the second-round primers, with the following reaction program: initial denaturation at 94 °C for 5 min, 30 cycles of denaturation at 94 °C for 40 s, annealing at 55 °C for 40 s, and extension at 72 °C for 1 min, with a final elongation at 72 °C for 7 min.
3. For Blastocystis, follow steps 3.3.1-3.3.4.
   1. Use F1R1³ and F1-1R-1^3,12 as the first-round reaction primers. Set the reaction program for F1R1 as follows: initial denaturation at 94 °C for 5 min, 30 cycles of denaturation at 94 °C for 40 s, annealing at 60 °C for 40 s, and extension at 72 °C for 100 s, with a final elongation at 72 °C for 7 min.
   2. Set the reaction program for F1-1R-1 as follows: initial denaturation at 94 °C for 5 min, 30 cycles of denaturation at 94 °C for 40 s, annealing at 55 °C for 40 s, and extension at 72 °C for 1 min, with a final elongation at 72 °C for 7 min.
   3. Use F2R2³ and F2-1R-1^3,12 as the second-round primers. Set the reaction program for F2R2 as follows: initial denaturation at 94 °C for 5 min, 30 cycles of denaturation at 94 °C for 40 s, annealing at 60 °C for 40 s, and extension at 72 °C for 1 min, with a final elongation at 72 °C for 7 min.
   4. Set the reaction program for F2-1R-1 as follows: initial denaturation at 94 °C for 5 min, 30 cycles of denaturation at 94 °C for 40 s, annealing at 55 °C for 40 s, and extension at 72 °C for 50 s, with a final elongation at 72 °C for 7 min.
      ​NOTE: Primer sequences are shown in Table 1^1,3,8,11,12.

Pathogen	Expected product size (bp)	Primer sequences (5′-3′)			References
Cryptosporidium	830	F1: CCATTTCCTTCGAAACAGGA			1
		R1: TTCTAGAGCTAATACATGCG
		F2: AAGGAGTAAGGAACAACCTCCA
		R2: GGAAGGGTTGTATTTATTAGATAAAG
	607	F-1: GACATATCATTCAAGTTTCTGACC			8,11
		R1-1: CTGAAGGAGTAAGGAACAACC
		R2-1: TCTAAGAATTTCACCTCTGACTG
Blastocystis	600	F1: GGGATCCTGATCCTTCCGCAGGTTCACCTAC			3
		R1: GGAAGC TTATCTGGTTGATCCTGCCAGTA
		F2: ATCTGGTTGATCCTGCCAGT
		R2: GAGCTTTTTAACTGCAACAACG
	460	F1-1: TGCTTTCGCACTTGTTCATC			3,12
		F2-1: GATTTATTGTCACTACCTCC
		R-1: ATCTGGTTGATCCTGCCAGT

Table 1: Primer sequences for SSU rRNA of Cryptosporidium and Blastocystis.

4. Nested conventional PCR detection of Enterocytozoon bieneusi ITS Gene, and Giardia BG, GDH, and TPI genes

NOTE: Dream Taq Green PCR Mix was used for this step.

1. Prepare the PCR reaction system on ice using PCR mix: 25 µL of 2× Taq buffer, 2 µL each of forward and reverse primers, 16 µL of ddH₂O, and 5 µL of template, with a total volume of 50 µL.
2. For Enterocytozoon bieneusi, follow steps 4.2.1-4.2.2.
   1. Use F1R1⁹ and F1-1R1-1² as the first-round reaction primers. Set the reaction program as follows: initial denaturation at 94 °C for 5 min, 30 cycles of denaturation at 94 °C for 40 s, annealing at 55 °C for 40 s, and extension at 72 °C for 50 s, with a final elongation at 72 °C for 7 min.
   2. Use F2R2⁹ and F2-1R2-1² as the second-round primers, with the reaction program as follows: initial denaturation at 94 °C for 5 min, 30 cycles of denaturation at 94 °C for 40 s, annealing at 55 °C for 40 s, and extension at 72 °C for 50 s, with a final elongation at 72 °C for 7 min.
3. For Giardia, follow steps 4.3.1-4.3.3.
   1. Use BG-F1R1, GDH-F1R1, and TPI-F1R1^2,10 as the first-round reaction primers for the three target genes. Set the first-round reaction program for all as follows: initial denaturation at 94 °C for 5 min, 30 cycles of denaturation at 94 °C for 40 s, annealing at 50 °C for 40 s, and extension at 72 °C for 1 min, with a final elongation at 72 °C for 7 min.
   2. Set the second-round reaction program for BG-F2R2^2,10 and TPI-F2R2^2,10 as follows: initial denaturation at 94 °C for 5 min, 30 cycles of denaturation at 94 °C for 40 s, annealing at 55 °C for 40 s, and extension at 72 °C for 50 s, with a final elongation at 72 °C for 7 min.
   3. Set the second-round reaction program for GDH-F2R2^2,10 as follows: initial denaturation at 94 °C for 5 min, 30 cycles of denaturation at 94 °C for 40 s, annealing at 60 °C for 40 s, and extension at 72 °C for 50 s, with a final elongation at 72 °C for 7 min.
      ​NOTE: Primer sequences are shown in Table 2^2,9,10.

Pathogen	Expected product size (bp)	Primer sequences (5′-3′)			References
Enterocytozoon bieneusi	390	F1: GGTCATAGGGATGAAGAG			9
		R1: TTCGAGTTCTTTCGCGCTC
		F2: GCTCTGAATATCTATGGCT
		R2: ATCGCCGACGGATCCAAGTG
	390	F1-1: GATGGTCATAGGGATGAAGAGCTT			2
		R1-1: TATGCTTAAGTCCAGGGAG
		F2-1: AGGGATGAAGAGCTTCGGCTCTG
		R2-1: AGTGATCCTGTATTAGGGATATT
Giardia	511	BG-F1: AAGCCCGACGACCTCACCCGCAGTGC			2,10
		BG-R1: GAGGCCGCCCTGGATCTTCGAGACGAC
		BG-F2: GAACGAACGAGATCGAGGTCCG
		BG-R2: CTCGACGAGCTTCGTGTT
	530	GDH-F1: TTCCGTRTYCAGTACAACTC			2,10
		GDH-R1: ACCTCGTTCTGRGTGGCGCA
		GDH-F2: ATGACYGAGCTYCAGAGGCACGT
		GDH-R2: GTGGCGCARGGCATGATGCA
	530	TPI-F1: AAATIATGCCTGCTCGTCG			2,10
		TPI-R1: CAAACCTTITCCGCAAACC
		TPI-F2: CCCTTCATCGGIGGTAACTT
		TPI-R2: GTGGCCACCACICCCGTGCC

Table 2: Primer sequences for Enterocytozoon bieneusi ITS gene, and Giardia BG, GDH, and TPI genes.

Results

Mice Cryptosporidium, Blastocystis SSU rRNA gene, Enterocytozoon bieneusi ITS gene, and Giardia BG gene PCR testing results
All 95 rectal fecal samples from mice were tested for the ITS gene of Enterocytozoon bieneusi using two sets of primers, resulting 5 positive samples for each method, resulting 6 positive samples in t...

Discussion

The Cryptosporidium, Enterocytozoon bieneusi, Blastocystis, and Giardia are common zoonotic intestinal parasites; the first two are classified as Category B biological pathogens by the U.S. National Institutes of Health (NIH), and all four are listed by the World Health Organization (WHO) as 24 of the most important food-borne parasites worldwide. They can potentially infect humans, animals, and contaminate the environment, which may cause disease outbreaks and significantly affect pub...

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
Agarose	Qingke Tech	TSJ001
Qiaquick gel extraction kit	Qiagen	28704	DNA gel extraction kit
100 bp Plus DNA Ladder	TransGen Biotech	BM311	DNA Ladder
4S Green Plus Nucleic Acid Stain	BBI	A616696-0500	DNA stain
10×TBE Buffer	Solarbio	T1051	electrophoreisis buffer
Qubit 4.0	Thermo	https://www.thermofisher.com/in/en/home /industrial/spectroscopy-elemental -isotope-analysis/molecular-spectroscopy/ fluorometers/qubit/models/qubit-4.html? ef_id=:G:s&s_kwcid=AL!3652!10!77515 785702067!!!!77516061528018!!380468 453!1240249321530142&cid=bid_pca_ aqb_r01_co_cp1359_pjt0000_bid 00000_0se_bng_bt_pur_con	Fluorescence quantitative instrument
MINI Space 1000	Tanon	http://en.biotanon.com/PRODUCT/ PRODUCTLIST?ID=3040& TYPE=DETAIL	Gel imager
Fast DNA Stool Mini Kit for DNA extraction	QIAGEN	51604	Nucleic acid extraction kit
ProFlex Base	Thermo	https://www.thermofisher.com/ in/en/home/life-science/pcr/ thermal-cyclers-realtime- instruments/thermal-cyclers /proflex-pcr-system.html	PCR
Dream Taq Green PCR Mix	Thermo	K1082	Pcr amplification