RESEARCH
Peer reviewed scientific video journal
Video encyclopedia of advanced research methods
Visualizing science through experiment videos
EDUCATION
Video textbooks for undergraduate courses
Visual demonstrations of key scientific experiments
BUSINESS
Video textbooks for business education
OTHERS
Interactive video based quizzes for formative assessments
Products
RESEARCH
JoVE Journal
Peer reviewed scientific video journal
JoVE Encyclopedia of Experiments
Video encyclopedia of advanced research methods
EDUCATION
JoVE Core
Video textbooks for undergraduates
JoVE Science Education
Visual demonstrations of key scientific experiments
JoVE Lab Manual
Videos of experiments for undergraduate lab courses
BUSINESS
JoVE Business
Video textbooks for business education
Solutions
Language
English
Menu
Menu
Menu
Menu
A subscription to JoVE is required to view this content. Sign in or start your free trial.
Research Article
Sitong Chen1,2, Dan Yang1,3, Chenxu Jing1,3, Xuenan Chen1,3, Wenqi Jin1,2, Dan Lv1,2, Tiejun Liu1,2, Yangyang Liu1,4
1College of Traditional Chinese Medicine,Changchun University of Chinese Medicine, 2Department of Gastroenterology,The Affiliated Hospital to Changchun University of Chinese Medicine, 3Research Center of Chinese Traditional Medicine,The Affiliated Hospital to Changchun University of Chinese Medicine, 4Preventive Treatment Center,The Affiliated Hospital to Changchun University of Chinese Medicine
Erratum Notice
Important: There has been an erratum issued for this article. View Erratum Notice
Retraction Notice
The article Assisted Selection of Biomarkers by Linear Discriminant Analysis Effect Size (LEfSe) in Microbiome Data (10.3791/61715) has been retracted by the journal upon the authors' request due to a conflict regarding the data and methodology. View Retraction Notice
This study investigated whether Ganzhirong Granule ameliorates hyperglycemia in type 2 diabetes by inhibiting hepatic gluconeogenesis through the SIRT3-MPC1-PC/PDH axis.
Type 2 diabetes mellitus (T2DM) is a global metabolic disorder characterized by hepatic insulin resistance and excessive gluconeogenesis. Ganzhirong Granule (GZRG), a traditional Chinese medicine formula, has shown potential in managing T2DM, but its underlying mechanisms, particularly concerning hepatic gluconeogenesis, remain unclear. This study investigated whether GZRG ameliorates hyperglycemia by modulating the SIRT3-mediated signaling pathway. The anti-diabetic effects of GZRG were evaluated in high-fat diet (HFD)-induced T2DM mice and free fatty acid (FFA)-induced insulin-resistant HepG2 cells. Metabolic parameters, glucose and pyruvate tolerance, insulin sensitivity, and lipid profiles were assessed. Molecular mechanisms were explored through the overexpression and knockdown of SIRT3, examining the expression of key proteins (SIRT3, MPC1, PC, PDH-E2, PCK1, and G6Pase) in the gluconeogenic pathway. GZRG treatment significantly ameliorated hyperglycemia, enhanced insulin sensitivity, and improved lipid metabolism in both T2DM mice and insulin-resistant (IR) HepG2 cells. It attenuated hepatic steatosis and suppressed gluconeogenesis. Mechanistically, GZRG downregulated SIRT3 expression, which led to concomitant reductions in MPC1 and PC levels and an increase in PDH-E2. This shift in protein expression redirected pyruvate metabolism away from gluconeogenesis. SIRT3 overexpression reversed the suppressive effects of GZRG on gluconeogenesis, whereas SIRT3 knockdown synergized with GZRG. GZRG alleviates T2DM by inhibiting hepatic gluconeogenesis through the SIRT3-MPC1-PC/PDH axis. These findings elucidate a novel molecular mechanism of GZRG and highlight SIRT3 as a potential therapeutic target for T2DM management.
Type 2 diabetes mellitus (T2DM) has emerged as one of the most prevalent and debilitating chronic metabolic disorders worldwide, posing a substantial public health and economic burden1,2. Characterized by insulin resistance (IR) and progressive pancreatic β-cell dysfunction, T2DM is primarily driven by impaired glucose and lipid homeostasis3,4. Among the multiple organs involved in glucose regulation, the liver plays a central role by controlling endogenous glucose production through glycogenolysis and gluconeogenesis5. Excessive hepatic gluconeogenesis is a major contributor to fasting hyperglycemia, a hallmark of T2DM pathophysiology, and represents a crucial therapeutic target for restoring glucose balance6.
Current hypoglycemic agents -- including metformin7, thiazolidinediones8, GLP-1 receptor agonists9, and SGLT2 inhibitors10 -- achieve glycemic control through distinct mechanisms, yet their long-term use is often limited by adverse effects, declining efficacy, or treatment intolerance. Consequently, there is increasing interest in complementary or alternative therapeutic approaches that can safely and effectively target multiple metabolic pathways. Traditional Chinese medicine (TCM), characterized by its multi-component and multi-target pharmacological properties, offers promising prospects for managing complex metabolic diseases such as T2DM11,12,13,14,15. Several classical TCM formulations have been reported to ameliorate insulin resistance, improve lipid metabolism, and suppress hepatic gluconeogenesis through integrated regulatory mechanisms16,17.
Ganzhirong granule (GZRG) is a standardized TCM formula with a history of clinical use in managing metabolic disorders. GZRG is an herbal formulation consisting of eight medicinal herbs. Based on our previous phytochemical and pharmacological investigations, a range of bioactive compounds has been identified in GZRG, including but not limited to Salvianolic acid B, D-stachyose, Proanthocyanidins, Violet oxalic acid, Salvianolic acid A, Salvianolic acid C, Calycosin 7 glucoside, 3′-methoxypuerarin, 3′-hydroxy puerarin, Apigenin-7-o-beta-d-pyrano, Emodin-8-O-β-D-glucose, Chrysophanol-1-O-glucoside, Chrysophanol-8-O-glucoside, Puerarin, Rosmarinic acid, Cryptotanshinone, Catechin, Ft-nyflavin, Calycosin, Rhein, Guanosine, Oleic acid, Aloe emodin, Formononetin, Palmitic acid, Chrysophanol, D-tryptophan, Danshensu, Ferulic acid, Mannitol, Gallic acid, and L-phenylalanine. A fundamental advantage of traditional Chinese medicine (TCM) in managing type 2 diabetes lies in its multi-component and multi-target synergistic actions. The dozens of active constituents contained in GZRG are likely to interact with multiple biological processes-such as insulin signaling pathways, glycogen metabolism, and inflammatory responses-thereby producing an integrated network effect that cannot be adequately replicated by any single purified compound18. Previous research has demonstrated that GZRG exerts beneficial effects on glucose and lipid metabolism in diabetic models19; however, the precise molecular mechanisms underlying these effects remain unclear. In particular, whether GZRG exerts its antidiabetic actions by modulating hepatic gluconeogenic signaling has not yet been elucidated.
Sirtuin 3 (SIRT3), a mitochondrial NAD⁺-dependent deacetylase, is a pivotal regulator of cellular energy homeostasis20. By deacetylating and activating key metabolic enzymes, SIRT3 influences mitochondrial oxidative phosphorylation, fatty acid oxidation, and gluconeogenesis21. Aberrant SIRT3 expression has been implicated in the pathogenesis of insulin resistance, fatty liver, and T2DM22,23. Evidence indicates that hepatic SIRT3 overexpression enhances gluconeogenic flux by modulating enzymes such as mitochondrial pyruvate carrier 1 (MPC1)24, pyruvate carboxylase (PC)25, pyruvate dehydrogenase (PDH)26, phosphoenolpyruvate carboxykinase (PCK1)27, and glucose-6-phosphatase (G6Pase)28. Thus, SIRT3-mediated control of pyruvate metabolism represents a critical nexus linking mitochondrial function and hepatic glucose output, making SIRT3 an attractive target for therapeutic intervention in T2DM.
Given the established metabolic effects of bioactive constituents in GZRG, along with the central role of SIRT3 in hepatic glucose homeostasis, it was hypothesized that GZRG ameliorates hyperglycemia in T2DM through modulation of the SIRT3-mediated gluconeogenic pathway. To evaluate this hypothesis, the effects of GZRG on glucose and lipid metabolism were assessed in high-fat diet (HFD)-induced T2DM mice and free fatty acid (FFA)-induced insulin-resistant HepG2 cells. Further investigation examined the involvement of the SIRT3-MPC1-PC/PDH signaling axis in mediating the suppressive effect of GZRG on hepatic gluconeogenesis. This study aims to elucidate the molecular mechanisms underpinning the metabolic benefits of GZRG and to provide experimental evidence supporting its therapeutic potential as a multi-target modulator for T2DM management.
The animal study protocol was approved by the Institutional Animal Care and Use Committee of Changchun University of Chinese Medicine (approval no. 2024396). All animal experiments were conducted following the national guidelines and the relevant national laws on the protection of animals.
Experimental drugs
GZRG (batch number 26210483) was provided by the Affiliated Hospital of Changchun University of Chinese Medicine (Jilin, China). The major bioactive constituents and quality control parameters of GZRG were characterized in a previous study18.
Reagents and antibodies
Commercial assay kits were used to quantify glucose, glycogen, non-esterified fatty acids (NEFAs), triglycerides (TG), total cholesterol (TC), high-density lipoprotein (HDL) cholesterol, and low-density lipoprotein (LDL) cholesterol. Enzyme-linked immunosorbent assay (ELISA) kits for glycosylated hemoglobin and insulin were also obtained commercially. ELISA kits for pyruvate dehydrogenase (PDH) and pyruvate carboxylase (PC) were also obtained commercially. For RNA and cDNA work, the RNA Tissue/Cell Kit, qPCR PreMix, and gDNA RT SuperMix were acquired commercially. Transfection was performed using a transfection reagent. Primary antibodies against SIRT3 (RRID: AB_2837621), phosphoenolpyruvate carboxykinase 1 (PCK1; RRID: AB_2838732), PDH-E2, glucose-6-phosphatase (G6Pase; RRID: AB_2845572), mitochondrial pyruvate carrier 1 (MPC1; RRID: AB_2836209), PC (RRID: AB_2836732), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH; RRID: AB_2833041) were procured from a commercial vendor.
Mice and treatments
Male C57BL/6J mice (5-6 weeks old) were obtained from Liaoning Changsheng Biotechnology Co., Ltd. and maintained under standard conditions (22 ± 2 °C, 50%-60% humidity, 12 h light/dark cycle)with free access to food and water. Following a 1-week acclimatization period, six mice were randomly designated as the control (Con) group and fed a standard chow diet. The remaining mice received a high-fat diet (HFD) for 12 weeks to induce obesity and insulin resistance.
At week 13, mice exhibiting a fasting blood glucose (FBG) level ≥ 11.1 mmol/L were classified as successful type 2 diabetes mellitus (T2DM) models. These diabetic mice were randomly allocated into five experimental groups (n = 6 per group): the HFD model group, low-dose GZRG (L-GZRG, 3.2 g/kg/d), medium-dose GZRG (M-GZRG, 6.4 g/kg/d), high-dose GZRG (H-GZRG, 12.8 g/kg/d), and metformin (Met, 0.2 g/kg/d). GZRG and Met were administered daily by oral gavage for 8 weeks. The Con and HFD model groups received equivalent volumes of distilled water. Upon completion of the treatment period, blood and liver tissue samples were collected from all mice for subsequent analysis.
Intraperitoneal glucose tolerance test (IPGTT), pyruvate tolerance test (PTT), and insulin tolerance test (ITT)
Metabolic tolerance tests were performed between 6 and 8 weeks after the initiation of drug treatments. For the IPGTT and PTT, mice were fasted overnight (approximately 16 h). For the ITT, a shorter 4 h fasting period was implemented. Following fasting, mice received an intraperitoneal injection of either glucose (2 g/kg for IPGTT), sodium pyruvate (2 g/kg for PTT), or human regular insulin (1 U/kg for ITT). Blood glucose levels were measured from tail vein blood samples at 0 min, 30 min, 60 min, 90 min, and 120 min post-injection using a calibrated glucometer.
Biochemical analysis and enzyme activity assays
Fasting blood glucose (FBG), hemoglobin A1c (HbA1c), and insulin (INS) levels were determined using commercial assay kits according to the manufacturers' instructions. The Homeostatic Model Assessment of Insulin Resistance (HOMA-IR) was calculated using the formula:
HOMA-IR = [FBG (mmol/L) x INS (µU/mL)] / 22.5
Circulating levels of NEFAs, TG, TC, LDL-C, HDL-C, and the enzymatic activities of PDH and PC in liver tissues were quantified using the respective commercial kits.
Histopathological analysis of liver tissues
Fresh liver tissues were fixed in 10% neutral-buffered formalin for 24 h, followed by standard processing for paraffin embedding. Sections (5 µm thick) were cut and stained with Hematoxylin and Eosin (H&E) for general morphological assessment. For lipid visualization, select liver specimens were embedded in Optimal Cutting Temperature (OCT) compound, snap-frozen, cryosectioned, and stained with Oil Red O.
Cell culture and treatment
The human hepatoma cell line HepG2 was obtained from the Type Culture Collection of the Chinese Academy of Sciences (China). Cells were cultured in Minimum Essential Medium (MEM) supplemented with 25 mM glucose, 10% fetal bovine serum (FBS), and 1% penicillin-streptomycin. Cultures were maintained at 37 °C in a humidified incubator with 5% CO2.
To establish an in vitro model of insulin resistance (IR), cells at 70%-80% confluence were treated for 24 h with a free fatty acid (FFA) mixture comprising oleic acid and palmitic acid at a 2:1 molar ratio, based on a previously reported method with minor modifications29. Following FFA induction, the culture medium was replaced with fresh MEM containing the same FFA mixture along with various concentrations of GZRG for an additional 24 h incubation.
Cell viability assay (CCK-8)
HepG2 cells in the logarithmic growth phase were harvested and seeded into 96-well plates at a density of 1 x 104 cells per well. The peripheral wells were filled with 100 µL of sterile phosphate-buffered saline (PBS) to minimize evaporation. After overnight incubation to ensure adherence, cells were treated according to the experimental design. Following treatment, 10 µL of CCK-8 solution was added to each well, and the plates were incubated for 2 h at 37 °C. The absorbance at 450 nm was measured using a microplate reader. Cell viability was calculated as:
[(As - Ab) / (Ac - Ab)] x 100%
where As is the absorbance of the sample, Ac is the absorbance of the control (untreated cells), and Ab is the absorbance of the blank (wells without cells).
Plasmid transfection in HepG2 cells
The SIRT3 overexpression plasmid (OV-SIRT3) and three distinct SIRT3-targeting small interfering RNA plasmids (si-SIRT3-1#, si-SIRT3-2#, si-SIRT3-3#), along with a negative control siRNA (si-NC), were constructed by a vendor. Transfections were performed using a transfection reagent when cells reached 50%-60% confluence. The transfection complex was prepared under sterile conditions as follows: Solution A was generated by diluting 1 µg of plasmid DNA in 250 µL of reduced serum medium with gentle mixing. Solution B was prepared by diluting 2-3 µL of transfection reagent in 250 µL of reduced serum medium, followed by incubation at room temperature for 5 min without vortexing. The two solutions were combined, mixed gently by pipetting, and incubated at room temperature for 30 min to form DNA-lipid complexes. For transfection, 1 h prior to the procedure, the cell culture medium was aspirated, cells were washed with PBS, and 1 mL of reduced serum medium (serum-free and antibiotic-free) was added. Then, 500 µL of the transfection complex was added dropwise to each well, and the culture plate was gently swirled to ensure homogeneity. Cells were incubated at 37 °C for 4-6 h, after which the medium was replaced with complete medium to mitigate cytotoxicity. Subsequently, cells were cultured for an additional 24-48 h before further analysis. Transfection efficiency was assessed by quantitative PCR (qPCR). Total RNA was extracted, reverse-transcribed into cDNA, and amplified using SIRT3-specific primers with 18S rRNA as an internal control. Relative expression levels were determined via the ΔΔCt method, and the most effective siRNA construct was selected for subsequent experiments based on these results.
Oil red O staining for intracellular lipid accumulation
HepG2 cells in the logarithmic growth phase were seeded in 24-well plates at a density of 2 x 105 cells per well and induced with a high-lipid medium containing 250 µM oleic acid and 250 µM palmitic acid for 48 h to establish the lipid accumulation model. After treatments, cells were washed with PBS and fixed with 10% formaldehyde for 10 min at room temperature. Following a rinse with distilled water and a brief immersion in 60% isopropanol, the cells were stained with a freshly prepared Oil Red O working solution (obtained by mixing components A1 and A2 in a 3:2 ratio) for 10-15 min. Excess dye was removed by washing with 60% isopropanol, followed by distilled water. Nuclei were counterstained with Mayer's hematoxylin (1.0 g/L) for 1-2 min. After a final wash, cells were mounted with glycerol gelatin, and images were captured using a light microscope at 200x magnification for qualitative assessment of lipid droplets.
Induction of insulin resistance and glucose quantification in HepG2 cells
HepG2 cells were cultured in 24-well plates at a seeding density of 2 x 105 cells per well to establish an in vitro model of insulin resistance. After 24 h of treatment, the culture supernatant was collected for further analysis. For intracellular glucose measurement, cell suspensions were centrifuged at 1000 x g for 10 min at 4 °C. The supernatant was discarded, and the cell pellet was washed once or twice with an isotonic buffer, followed by centrifugation under the same conditions. The pellet was then homogenized in 0.2 to 0.3 mL of homogenization medium and subjected to ultrasonic disruption in an ice-water bath using a 300 W probe, with pulses of 3-5 s followed by 30 s intervals, repeated 3x-5x. The resulting homogenate was assayed directly without further centrifugation. Glucose levels in both the culture supernatant and the cell homogenate were measured using a standardized glucose assay kit according to the manufacturer's instructions to ensure accurate and reproducible assessment of metabolic responses.
Measurement of cellular triglyceride content
HepG2 cells were collected by centrifugation at 1000 x g for 10 min, and the supernatant was discarded. The cell pellet was washed 1x or 2x with an isotonic phosphate buffer (0.1 M, pH 7.0-7.4), followed by centrifugation under the same conditions. After removal of the supernatant, the pellet was resuspended and homogenized with 0.2-0.3 mL of absolute ethanol. The homogenate was subjected to ultrasonic disruption on ice (300 W, 3-5 s per burst, 30 s intervals, repeated 3-5 times). The resulting homogenate was used directly for subsequent analysis without further centrifugation. A 96-well plate was set up with blank, standard, and sample wells. After thorough mixing, the plate was incubated at 37 °C for 10 min, and the absorbance was measured at 500 nm using a microplate reader. The triglyceride content in the cell samples was calculated based on a standard curve derived from serial dilutions of glycerol standards.
Measurement of total cholesterol content
HepG2 cells (5 x 106) were lysed in 1 mL of extraction buffer by ultrasonic disruption on ice. The homogenate was centrifuged at 10,000 x g for 10 min at 4 °C, and the supernatant was collected for immediate analysis. A cholesterol standard stock solution (50 µmol/mL) was prepared and serially diluted to generate a standard curve (0.3125 to 10 µmol/mL). A working chromogenic solution was prepared by mixing reagents one, two, and three provided in the cholesterol assay kit, and pre-warmed to 37 °C. Samples or standards were mixed with the working solution, incubated at 37 °C for 30 min, and the absorbance was measured at 500 nm. Cholesterol content was calculated based on the standard curve.
Immunofluorescence staining
Cells grown on coverslips were rinsed with ice-cold PBS and fixed with 4% paraformaldehyde for 15 min at room temperature. After PBS washes, cells were permeabilized with 0.1% Triton X-100 for 10 min and blocked with 5% BSA at 4 °C overnight. Cells were then incubated with a primary anti-SIRT3 antibody (1:500 dilution) at 4 °C overnight. Following PBS washes, cells were incubated with a fluorescence-conjugated secondary antibody (1:2000 dilution) for 1 h at room temperature in the dark. Nuclei were stained with DAPI (0.5 µg/mL) for 10 min. Coverslips were mounted onto glass slides using an anti-fade mounting medium and visualized under a fluorescence microscope.
RNA extraction and quantitative real-time PCR (qRT-PCR)
Total RNA was extracted from cells using the RNA Tissue/Cell Kit. Genomic DNA was removed, and cDNA was synthesized using the gDNA RT kit. Quantitative PCR was performed using the qPCR kit on a real-time PCR detection system. Gene-specific primer sequences are provided in Table 1.
Western blot analysis
For protein extraction from liver tissues, approximately 50-200 mg of tissue was weighed, minced in a petri dish, and transferred to a homogenizer. Pre-cooled lysis buffer (RIPA buffer) supplemented with protease and phosphatase inhibitors was added to prevent protein degradation. Homogenization was performed thoroughly on ice to ensure complete tissue disruption, and the homogenate was transferred to a centrifuge tube and incubated on ice for 30 min to facilitate protein solubilization. Subsequently, the homogenate was centrifuged at 4 °C at 12,000 x g for 10-30 min, and the supernatant was carefully collected as the total protein extract, avoiding contamination from the pellet. For cellular protein extraction, pre-cooled lysis buffer (RIPA buffer containing 1% Triton X-100 and protease inhibitors) was added to the cells, followed by incubation on ice for 15-30 min to achieve complete lysis. Cell disruption was ensured by repeated scraping with a cell scraper or vigorous pipetting. The lysate was transferred to a centrifuge tube and centrifuged at 4 °C at 14,000 x g for 30 min, and the supernatant was collected as the total protein extract. Protein concentration was quantified using a BCA protein assay kit, and aliquots were stored at -80 °C for future Western blot analysis or used directly for sample preparation. Protein samples were denatured in Laemmli buffer at 100 °C for 10 min, separated by SDS-PAGE, and transferred onto PVDF membranes. Membranes were blocked with 5% non-fat milk for 2 h at room temperature and subsequently incubated with specific primary antibodies overnight at 4 °C. After washing, membranes were incubated with HRP-conjugated secondary antibodies for 1 h at room temperature. Protein bands were visualized using an enhanced chemiluminescence (ECL) substrate. The chemiluminescent signals were captured, and band intensities were quantified by densitometric analysis using ImageJ software. The raw Western blots are provided in Supplementary File 1.
Statistical analysis
All data are expressed as the mean ± standard error of the mean (SEM). Statistical comparisons between two groups were performed using an unpaired Student's t-test. For comparisons among three or more groups, one-way analysis of variance (ANOVA) was applied, followed by Tukey's post hoc test for multiple comparisons. All statistical analyses were conducted using GraphPad Prism software (Version 9.5.0). A p-value of less than 0.05 was considered statistically significant.
GZRG ameliorated insulin resistance and gluconeogenesis in HFD-induced T2DM mice
The HFD-induced type 2 diabetes mellitus (T2DM) mouse model, characterized by insulin resistance, hyperglycemia, and dyslipidemia, is widely employed to investigate disease pathogenesis and evaluate therapeutic interventions30. In the present study, an HFD-induced T2DM model was established in C57BL/6J mice to assess the efficacy and underlying mechanisms of GZRG.
Compared to the control group, HFD-fed mice exhibited significant increases in body weight and liver index, both of which were ameliorated by GZRG treatment (Figure 1A,B). GZRG also effectively reduced FBG (Figure 1C) and HbA1c levels, indicating improved glycemic control (Figure 1D). Furthermore, GZRG significantly attenuated the HFD-induced elevation in insulin levels (Figure 1E) and HOMA-IR index (Figure 1F), suggesting enhanced insulin sensitivity. Hepatic glycogen synthesis was also reduced by GZRG in HFD-fed mice (Figure 1G).
Functional assays revealed that GZRG enhanced glucose tolerance (IPGTT; Figure 1H) and insulin sensitivity (ITT; Figure 1I). Additionally, pyruvate tolerance testing (PTT) demonstrated that HFD-fed mice developed pyruvate intolerance and elevated gluconeogenesis, both of which were reversed by GZRG (Figure 1J). Collectively, these results demonstrate that GZRG alleviates hyperglycemia, improves insulin sensitivity, and suppresses excessive gluconeogenesis in T2DM mice.
GZRG alleviates hepatic steatosis and improves lipid homeostasis in T2DM mice
Hepatic glucose output during fasting is driven by free fatty acid mobilization and dysregulated lipid metabolism, processes that contribute to hepatic lipid deposition, insulin resistance, and excessive gluconeogenesis31. To evaluate the effects of GZRG on hepatic lipid metabolism, liver tissues from T2DM mice were analyzed.
Histological analysis by H&E staining demonstrated that hepatocytes in the HFD group exhibited pronounced morphological abnormalities-including vacuolization, cellular size variability, disrupted hepatic cord architecture, and indistinct lobular boundaries-compared to the control group (Con). These pathological changes were significantly attenuated by GZRG treatment (Figure 2A). Consistent with this, oil red O staining revealed substantial lipid droplet accumulation in HFD-fed mice, which was markedly reduced following GZRG administration (Figure 2B).
Biochemical assays further confirmed that GZRG improved serum lipid profiles, decreasing NEFAs, TC, TG, and LDL-C while increasing HDL-C (Figure 2C-G). Additionally, GZRG reduced hepatic TC and TG content (Figure 2H,I). Together, these results indicate that GZRG mitigates hepatic steatosis and restores lipid metabolic homeostasis in T2DM mice.
GZRG inhibited gluconeogenesis by SIRT3 in HFD-induced T2DM mice
Emerging evidence implicates SIRT3 as a key regulator of gluconeogenesis32. Given the effective suppression of gluconeogenesis by GZRG in T2DM mice, it was hypothesized that SIRT3 could represent a potential therapeutic target. Consistent with this premise, GZRG treatment significantly reduced SIRT3 protein levels in the HFD group (Figure 3A,B). Consequently, the investigation was extended to examine the expression of other gluconeogenesis-related proteins.
Notably, GZRG treatment lowered the elevated MPC1 protein levels observed in the HFD group (Figure 3A,C). This reduction is consistent with impaired mitochondrial pyruvate uptake, a critical step for gluconeogenesis33. Furthermore, GZRG downregulated PC (Figure 3A,D) while upregulating pyruvate dehydrogenase E2 (PDH-E2; Figure 3A,E), shifting pyruvate metabolism toward acetyl-coenzyme A production and tricarboxylic acid (TCA) cycle entry, further suppressing gluconeogenesis.
Additionally, GZRG treatment significantly reduced the expression of key gluconeogenic enzymes, G6Pase and PCK1, both of which were elevated in the HFD group (Figure 3A,F,G).
Effects of GZRG on HepG2 cell viability
To further elucidate the therapeutic efficacy and mechanism of GZRG, an FFA-induced insulin-resistant HepG2 (IR-HepG2) cell model of T2DM was established. Initially, an optimal FFA concentration for model induction was determined by treating HepG2 cells with increasing concentrations of an FFA mixture (oleic acid: palmitic acid = 2:1), followed by assessment of cell viability using the CCK-8 assay. Exposure to 0-200 µM FFA for 24 h showed no significant effect on cell viability (Figure 4A), leading to the selection of 200 µM FFA for subsequent experiments. Successful induction of insulin resistance was confirmed by a marked reduction in glucose consumption in IR-HepG2 cells relative to control cells (Figure 4B). Cytotoxicity of GZRG was then evaluated in HepG2 cells. Treatment with 0-100 µg/mL GZRG for 24 hours resulted in no significant decrease in cell viability (Figure 4C). Similarly, IR-HepG2 cells exposed to 25, 50, or 100 µg/mL GZRG for 24 h maintained normal viability (Figure 4D). These findings supported the selection of 25, 50, and 100 µg/mL GZRG as non-toxic and therapeutically relevant concentrations for further investigation.
GZRG improved the glycolipid metabolism of IR-HepG2 cells via SIRT3
GZRG treatment significantly enhanced glucose uptake in IR-HepG2 cells compared to untreated controls, demonstrating improved glucose metabolism (Figure 5A). Furthermore, GZRG restored intracellular glycogen content, effectively reversing the FFA-induced suppression of glycogen synthesis (Figure 5B). In terms of lipid metabolism, oil red O staining revealed substantial lipid droplet accumulation in IR-HepG2 cells, which was markedly attenuated by GZRG treatment. Consistent with this, the model group exhibited significantly elevated TG and TC levels compared to controls, reflecting impaired lipid metabolism (Figure 5E,F). Notably, GZRG treatment normalized these lipid profiles. Collectively, these results indicate that GZRG ameliorates insulin resistance by promoting glucose utilization and mitigating lipid accumulation in IR-HepG2 cells.
GZRG modulated gluconeogenesis through SIRT3
To investigate the potential role of SIRT3 in GZRG-mediated enhancement of glucose metabolism, HepG2 cell lines with either silenced (si-SIRT3) or overexpressed (OV-SIRT3) SIRT3 were generated. Quantitative PCR (Figure 6A) and Western blot analysis (Figure 6B,C) confirmed markedly elevated SIRT3 mRNA and protein levels in OV-SIRT3 cells compared with control cells. Among the evaluated SIRT3 interference constructs, si-SIRT3-1 yielded the most substantial suppression of both SIRT3 mRNA and protein expression (Figure 6A,D,E), supporting its selection for subsequent experiments based on optimal transfection efficiency.
Cells were divided into the following experimental groups: Con, FFA, si-SIRT3, OV-SIRT3, L-GZRG (25 µg/mL), M-GZRG (50 µg/mL), H-GZRG (100 µg/mL), GZRG (100 µg/mL) + si-SIRT3, and GZRG (100 µg/mL) + OV-SIRT3. Assessment of gluconeogenesis, by measuring glucose production in a pyruvate-supplemented, sugar-free medium, revealed a significant increase in FFA-induced HepG2 cells compared to controls. GZRG treatment attenuated this effect, with the greatest suppression observed in the GZRG + si-SIRT3 group, suggesting a synergistic interaction. In contrast, OV-SIRT3 counteracted this suppression (Figure 7A). Furthermore, GZRG modulated key gluconeogenic enzymes, reducing phosphoenolpyruvate carboxykinase (PC) activity (Figure 7B) while increasing pyruvate dehydrogenase (PDH) activity (Figure 7C)-effects that were abolished by OV-SIRT3.
Immunofluorescence and Western blot analyses revealed that GZRG downregulated SIRT3 expression in insulin-resistant (IR) HepG2 cells (Figure 7D-G). Additionally, GZRG upregulated PDH-E2 expressions while suppressing PC, PCK1, and G6PD levels in IR-HepG2 cells. Notably, OV-SIRT3 reversed these beneficial effects, whereas si-SIRT3 acted synergistically with GZRG (Figure 7F-L). Collectively, these findings indicate that GZRG attenuates gluconeogenesis by regulating key enzymes in the gluconeogenic pathway through SIRT3 modulation.
Data availability:
All data supporting the findings of this study are included in the published article and its Supplementary Information files.

Figure 1: GZRG ameliorates insulin resistance and gluconeogenesis in HFD-induced T2DM mice. (A, B) Body weight and liver index (liver/body weight ratio) of mice. (C-G) Fasting blood glucose (FBG), HbA1c, insulin (INS) levels, HOMA-IR index, and hepatic glycogen content in mice. (H-J) Intraperitoneal glucose tolerance test (IPGTT), insulin tolerance test (ITT), and pyruvate tolerance test (PTT) results in mice. Data are presented as the mean ± SEM (n = 6). Statistical significance was determined by one-way ANOVA followed by Tukey's post hoc test. ***p < 0.001 vs. the Con group; #p < 0.05 vs. the HFD group; ##p < 0.01 vs. the HFD group; ###p < 0.001 vs. the HFD group. Please click here to view a larger version of this figure.

Figure 2: GZRG improved lipid accumulation in HFD-induced T2DM mice. (A) Representative images of Hematoxylin and Eosin (H&E) staining of liver sections (scale bar = 50 µm). (B) Representative images of Oil Red O (ORO) staining of liver sections (scale bar = 50 µm). (C-G) Serum levels of non-esterified fatty acids (NEFAs), total cholesterol (TC), triglycerides (TG), high-density lipoprotein cholesterol (HDL-C), and low-density lipoprotein cholesterol (LDL-C) in mice. (H, I) Hepatic TC and TG content in mice. Data are presented as the mean ± SEM (n = 6). Statistical significance was determined by one-way ANOVA followed by Tukey's post hoc test. ***p < 0.001 vs. the Con group; #p < 0.05 vs. the HFD group; ##p < 0.01 vs. the HFD group; ###p < 0.001 vs. the HFD group. Please click here to view a larger version of this figure.

Figure 3: GZRG inhibits gluconeogenesis through SIRT3 in HFD-induced T2DM mice. (A) Representative protein expression profiles. (B-G) Quantitative Western blot analyses of the following key metabolic regulators: SIRT3 (Sirtuin 3), MPC1 (Mitochondrial Pyruvate Carrier 1), PC (Pyruvate Carboxylase), PDH-E2 (Dihydrolipoamide Acetyltransferase component of the Pyruvate Dehydrogenase complex), G6Pase (Glucose-6-Phosphatase), and PCK1 (Phosphoenolpyruvate Carboxykinase 1). Data are presented as the mean ± SEM (n = 3). Statistical significance was determined by one-way ANOVA followed by Tukey's post hoc test. ***p < 0.001 vs. the Con group; ##p < 0.01 vs. the HFD group; ###p < 0.001 vs. the HFD group. Please click here to view a larger version of this figure.

Figure 4: Effect of GZRG on the viability of HepG2 cells. (A) Viability of HepG2 cells treated with increasing concentrations of free fatty acids (FFA; 0-400 µM) for 24 h. (B) Glucose consumption in HepG2 cells exposed to 200 µM FFA. (C) Cytotoxicity assessment of HepG2 cells following treatment with various concentrations of GZRG (0-400 µg/mL) for 24 h. (D) Cell viability following co-treatment with FFA (200 µM) and GZRG at 25, 50, and 100 µg/mL. Data are presented as the mean ± SEM (n = 3). Statistical significance was determined by one-way ANOVA followed by Tukey's post hoc test. **p < 0.01 vs. the control group; ***p < 0.001 vs. the control group. Please click here to view a larger version of this figure.

Figure 5: GZRG improved glycolipid metabolism of IR-HepG2 cells through SIRT3. (A, B) Glucose consumption and glycogen content in HepG2 cells under indicated treatments. (C, D) Representative images of lipid accumulation detected by Oil Red O staining (scale bar = 100 µm) and corresponding quantitative analysis of lipid droplets. (E, F) Intracellular levels of total cholesterol (TC) and triglycerides (TG) in HepG2 cells. Data are presented as the mean ± SEM (n = 3). Statistical significance was determined by one-way ANOVA followed by Tukey's post hoc test. ***p < 0.001 vs. the Con group; ## p < 0.01 vs. the model group; ### p < 0.001 vs. the model group. Please click here to view a larger version of this figure.

Figure 6: Validation of SIRT3 transfection efficiency. (A) Relative mRNA expression levels of SIRT3 were quantified by qRT-PCR across the following experimental groups: control (Con), empty vector (Empty Vector), SIRT3-overexpression (OV-SIRT3), non-targeting siRNA control (si-NC), and three independent SIRT3-targeting siRNA sequences (si-SIRT3-1#, si-SIRT3-2#, and si-SIRT3-3#). (B) Representative Western blot membranes and (C) Quantitative analysis of SIRT3 protein expression in the Con, Empty Vector, and OV‑SIRT3 groups. (D) Representative Western blot membranes and (E) Quantitative analysis of SIRT3 protein expression in the Con, si‑NC, si‑SIRT3‑1#, si‑SIRT3‑2#, and si‑SIRT3‑3# groups. Data are presented as the mean ± SEM (n = 3). Statistical significance was determined by one-way ANOVA followed by Tukey's post hoc test. **p < 0.01 vs. the control group, ## p < 0.01 vs. the si-SIRT3-1# group, ### p < 0.001 vs. the si-SIRT3-1# group. Please click here to view a larger version of this figure.

Figure 7: GZRG-tailored gluconeogenesis through SIRT3. (A) Measurement of glucose production in HepG2 cells. (B, C) Intracellular protein levels of pyruvate carboxylase (PC) and pyruvate dehydrogenase (PDH) in HepG2 cells, as determined by ELISA. (D, E) Representative immunofluorescence staining of SIRT3 with DAPI nuclear counterstain, along with corresponding quantitative analysis of SIRT3 expression. (F) Protein expression levels were assessed by Western blotting. (G-L) Western blot analysis of key metabolic regulators, including SIRT3, mitochondrial pyruvate carrier 1 (MPC1), PC, pyruvate dehydrogenase subunit E2 (PDH-E2), glucose-6-phosphatase (G6Pase), and phosphoenolpyruvate carboxykinase 1 (PCK1). Data are presented as the mean ± SEM (n = 3). Statistical significance was determined by one-way ANOVA followed by Tukey's post hoc test. ***p < 0.001 vs. the Con group; #p < 0.05 vs. the HFD group; ##p < 0.01 vs. the HFD group; ###p < 0.001 vs. the HFD group. & p < 0.05 vs. the GZRG (100 µg/mL) group; && p < 0.01 vs. the GZRG (100 µg/mL) group.; &&& p < 0.001 vs. the GZRG (100 µg/mL) group. Please click here to view a larger version of this figure.

Figure 8: Mechanism of GZRG on T2DM. This graphical abstract illustrates the proposed molecular mechanism by which GZRG ameliorates hyperglycemia in Type 2 Diabetes Mellitus. GZRG treatment primarily targets the liver, where it downregulates the mitochondrial deacetylase SIRT3. This suppression of SIRT3 leads to reduced expression of the mitochondrial pyruvate carrier 1 (MPC1), thereby limiting pyruvate influx into mitochondria. Consequently, pyruvate metabolism is shifted away from gluconeogenesis, as evidenced by the downregulation of pyruvate carboxylase (PC) and key gluconeogenic enzymes (PEPCK, G6Pase), and towards oxidation, via the upregulation of pyruvate dehydrogenase (PDH). The collective inhibition of this SIRT3-MPC1-PC/PDH axis results in suppressed hepatic gluconeogenesis and improved glycemic control. Please click here to view a larger version of this figure.
| Primer | Sequence(5'-3') |
| SIRT3-F | ACAAGCCCAACGTCACTCAC |
| SIRT3-R | GATGCCCGACACTCTCTCAA |
| GAPDH-F | AATCCCATCACCATCTTCCA |
| GAPDH-R | AAATGAGCCCCAGCCTTCT |
Table 1: Sequences of primers used.
Supplementary File 1: Raw Western blot. The raw Western blots correspond to Figure 3A, Figure 6B,D, and Figure 7F. Please click here to download this File.
The present study demonstrates that GZRG exerts significant antihyperglycemic and insulin-sensitizing effects in both in vivo and in vitro models of T2DM, primarily through suppression of hepatic gluconeogenesis via modulation of the SIRT3-MPC1-PC/PDH axis. Experimental data indicate that GZRG administration attenuated fasting hyperglycemia, improved glucose and insulin tolerance, restored lipid homeostasis, and reduced hepatic steatosis in HFD-induced diabetic mice. In parallel, treatment with GZRG enhanced glucose utilization, increased glycogen synthesis, and mitigated lipid accumulation in FFA-induced insulin-resistant HepG2 cells. Collectively, these findings suggest that GZRG ameliorates metabolic dysfunction by targeting SIRT3-dependent mitochondrial pathways that regulate hepatic glucose output.
A key mechanistic insight from this work is that GZRG significantly downregulated SIRT3 expression and its downstream targets, including MPC1 and PC, while upregulating PDH-E2. Based on the coordinated expression changes observed, it is posited that MPC1 is likely indirectly regulated by SIRT3 within this pharmacological context, rather than being a direct deacetylation target. Moreover, the consistent reversal of GZRG's effects upon SIRT3 modulation, together with the absence of significant alterations in key alternative pathways such as AMPK signaling, argues against major off-target effects and underscores the centrality of SIRT3 in mediating GZRG's action. These molecular alterations shift pyruvate metabolism away from gluconeogenesis toward oxidative metabolism, effectively restraining excessive hepatic glucose production (Figure 8). This observation delineates a mechanistic divergence from conventional hypoglycemic drugs such as metformin, which primarily inhibits gluconeogenesis through AMPK activation34. GZRG's capacity to modulate SIRT3-mediated mitochondrial enzymes highlights its potential as a multi-target therapeutic agent capable of restoring energy homeostasis across multiple metabolic nodes.
These findings provide novel insights into the role of SIRT3 in hepatic glucose regulation. Previous studies have reported that SIRT3 exerts context-dependent metabolic effects, with both beneficial and deleterious outcomes observed under different cellular and physiological conditions. For instance, SIRT3 activation has been shown to enhance mitochondrial function and alleviate oxidative stress in models of diabetic cardiomyopathy and fatty liver disease35,36. Conversely, in hepatocytes, excessive SIRT3 activity may promote gluconeogenesis through the deacetylation and activation of key enzymes, such as MPC1 and PC37. The current study supports the latter perspective, as SIRT3 suppression by GZRG or siRNA resulted in diminished gluconeogenic flux, whereas SIRT3 overexpression reversed these effects. Thus, the data help reconcile prior discrepancies by underscoring the metabolic context in which SIRT3 inhibition may confer benefits-specifically, under conditions of hepatic insulin resistance and heightened gluconeogenic signaling.
Furthermore, the consistency between in vivo and in vitro findings supports the mechanistic plausibility of SIRT3 as a central effector in the metabolic actions of GZRG38. The synergistic effect observed with GZRG treatment under SIRT3 silencing conditions, coupled with the antagonistic effect induced by SIRT3 overexpression, provides direct molecular evidence for the mediating role of SIRT3. Such bidirectional validation strengthens the robustness of the conclusion and underscores the translational relevance of GZRG as a potential adjunct therapy for type 2 diabetes mellitus.
Nevertheless, certain limitations warrant acknowledgment. The current study primarily focuses on hepatic mechanisms, whereas systemic metabolic regulation involves crosstalk among multiple organs, including skeletal muscle and adipose tissue. Additionally, while the study identifies SIRT3 as a principal mediator, the upstream signaling events and specific bioactive constituents within GZRG responsible for SIRT3 modulation remain to be elucidated. Future work employing metabolomic and proteomic approaches, along with SIRT3 knockout models, will be essential to fully delineate these interactions.
Conclusions
This study demonstrates that GZRG ameliorates T2DM-associated metabolic dysfunction by attenuating hepatic gluconeogenesis through modulation of the SIRT3-MPC1-PC/PDH axis. These findings not only substantiate the pharmacological value of GZRG in T2DM therapy but also position SIRT3 as a potential target for modulating hepatic glucose metabolism. Continued investigation into the broader regulatory implications of SIRT3 and the multi-target nature of GZRG may pave the way for novel metabolic interventions rooted in traditional medicine.
All authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
This research was funded by the Science and Technology Development Plan of Jilin Province, Grant number 20210101199JC, YDZJ202301ZYTS454.
| FastKing gDNA Dispelling RT SuperMix | Tiangen Biotech Co., Ltd. (China). | KR118-02 | |
| glucose-6-phosphatase (G6Pase) Antibody | Wuhan Lingjiesi Biotechnology Co., Ltd. (China) | LJS-D-12610 | |
| glyceraldehyde-3-phosphate dehydrogenase (GAPDH) Antibody | Wuhan Lingjiesi Biotechnology Co., Ltd. (China) | LJS-T-0004 | |
| Glycosylated hemoglobin ELISA kits | Jiangsu Meimian Industrial Co., Ltd. (China). | MM-0159M2 | |
| GZRG | Affiliated Hospital of Changchun University of Chinese Medicine (Jilin, China) | 26210483 | |
| high-density lipoprotein (HDL) cholesterol assay kits | Nanjing Jiancheng Bioengineering Institute (China) | A112-1-1 | |
| insulin ELISA kits | Jiangsu Meimian Industrial Co., Ltd. (China). | MM-0579M2 | |
| Lipofectamine2000 | Invitrogen, USA | 11668-019 | |
| Low-density lipoprotein (LDL) cholesterol assay kits | Nanjing Jiancheng Bioengineering Institute (China) | A113-1-1 | |
| measure glucose assay kits | Nanjing Jiancheng Bioengineering Institute (China) | F006-1-1 | |
| mitochondrial pyruvate carrier 1 (MPC1)Antibody | Wuhan Lingjiesi Biotechnology Co., Ltd. (China) | LJS-D-3852 | |
| non-esterified fatty acids (NEFAs)assay kits | Nanjing Jiancheng Bioengineering Institute (China) | A042-2-1 | |
| PC Antibody | Wuhan Lingjiesi Biotechnology Co., Ltd. (China) | LJS-D-4364 | |
| PDH-E2 Antibody | Wuhan Lingjiesi Biotechnology Co., Ltd. (China) | LJS-D-14046 | |
| phosphoenolpyruvate carboxykinase 1 (PCK1)Antibody | Wuhan Lingjiesi Biotechnology Co., Ltd. (China) | LJS-D-6770 | |
| pyruvate carboxylase (PC) ELISA kits | Wuhan Lingjiesi Biotechnology Co., Ltd. (China) | LJS-160408H | |
| Pyruvate dehydrogenase (PDH)ELISA kits | Wuhan Lingjiesi Biotechnology Co., Ltd. (China) | LJS-160300H | |
| RNA Easy Fast Tissue/Cell Kit | Tiangen Biotech Co., Ltd. (China). | DP451 | |
| SIRT3 Antibody | Wuhan Lingjiesi Biotechnology Co., Ltd. (China) | LJS-A-5135 | |
| Talent SYBR Green qPCR PreMix | Tiangen Biotech Co., Ltd. (China). | FP209-02 | |
| total cholesterol (TC)assay kits | Nanjing Jiancheng Bioengineering Institute (China) | A110-1-1 | |
| triglycerides (TG)assay kits | Nanjing Jiancheng Bioengineering Institute (China) | A111-1-1 |