Fifty specific pathogen-free (SPF) male Sprague-Dawley rats (weighing 180–200 g) were supplied by the Hubei Provincial Center for Disease Control and Prevention (Hubei Provincial Academy of Preventive Medicine) (Wuhan, China; Animal License Certificate No. SCXK(JB) 2023-0005). All experimental procedures involving animals were conducted in strict accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals (8th edition, 2011). The study protocol was reviewed and approved by the Experimental Animal Ethics Committee of Tianjin Genink Biological Technology Co., Ltd. (Approval No. GENINK-20250074). Key reagents and equipment used in this study are listed in the accompanying Table of Materials.
Cell culture
The human rheumatoid arthritis (RA) cell line MH7A was cultured in Dulbecco's Modified Eagle Medium (DMEM) medium supplemented with 10% (v/v) fetal bovine serum (FBS) and maintained at 37 °C in a humidified incubator with 5% CO₂17.
Animals and treatments
Animals were kept in a standard specific pathogen-free (SPF) facility with an individually ventilated cage (IVC) system under strictly controlled environmental conditions: a climate-controlled temperature of 21.0–25.0 °C, relative humidity of 40–70%, a 12 h photoperiod, and complete air renewal 15 times per hour. After a 7-day acclimatization period, rats were randomly divided into six experimental groups, with additional rats reserved as backups for unforeseen circumstances. An acute inflammatory adjuvant arthritis (AA) model was induced by subcutaneous injection of 100 µL complete Freund's adjuvant (CFA; 10 mg·mL-1) into the right hind paw18. The experimental groups were designed as follows: a blank control group, an AA model group, a positive control group (methotrexate, 0.9 mg·kg-1)19, and three smirnotine A treatment groups administered at low- (0.962 mg·kg-1), medium- (1.923 mg·kg-1), and high-dose (3.846 mg·kg-1) levels based on the IC₅₀ value.
Prediction of disease and compound targets
Based on preliminary activity screening conducted by our research group, six compounds demonstrating favorable bioactivity were selected for investigation: five diterpenoid alkaloids (Figure 3), benzoylaconine (1), 14-benzoyl-8-O-methylaconine (2), (−)-(A-b)-14α-benzoyloxy-N-ethyl-13β, 15α-dihydroxy-1α,6α,8β,16β,18-pentamethoxyaconitane (3), smirnotine A (4), and aconitine (5), along with one coumarin derivative, scopoletin (6)20. The simplified molecular-input line-entry system (SMILES) notations of these compounds were retrieved from the PubChem database (https://pubchem.ncbi.nlm. nih.gov/) or generated using ChemDraw 18.0. These notations were subsequently imported into the SwissTargetPrediction database (https://swisstargetprediction.ch/), with the species specified as "Homo sapiens". Potential targets were identified by selecting genes with a probability value > 0, and corresponding Target Names and UniProt IDs were collected21,22.
PPI networks
The overlapping target genes were analyzed by protein-protein interaction (PPI) network using the STRING database (https://string-db.org/)23. The resulting TSV-formatted data was then imported into Cytoscape 3.9.1 for further visualization and analysis. Topological parameters of the network were calculated using the built-in Network Analyzer plugin. In the visualized network, node size and color intensity were mapped to degree value, while edge thickness reflected the strength of interaction between targets. Core targets were identified and ranked based on their association degree24.
Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis
The common targets were submitted to the Metascape database (https://metascape.org) for GO and KEGG pathway enrichment analyses25. Functional results were visualized using the WeiShengXin bioinformatics platform (https://www.bioinformatics.com.cn).
The network construction of the "drug-active components-disease-targets-pathways"
Active components and their corresponding targets were systematically screened, followed by functional enrichment analysis to identify major signaling pathways and their associated targets. These elements were subsequently integrated using Cytoscape 3.9.1 to construct a comprehensive "drug–active components–disease–targets–pathways" network. Topological analysis was then performed with the Network Analyzer tool, in which nodes were ranked based on key parameters, including Degree and Betweenness, to identify central elements within the network.
Molecular docking of key compounds to core targets
The three-dimensional structures of core target proteins, including ESR1 (9BQE), PTGS2 (5F19), EGFR (2XKN), GSK3B (5HLN), SRC (5MTJ), and ERBB2 (8U8X), were retrieved from the RCSB Protein Data Bank (http://www.rcsb.org/; accessed on 7 May 2025). Compound structures were constructed in ChemDraw (version 18.0) and subsequently converted into three-dimensional SDF format using the integrated Chem3D module. The molecular docking results were visualized with PyMOL, and the binding affinities were assessed according to interaction energy (kcal·mol-1)26.
Cell viability assay
MH7A cells in the logarithmic growth phase were seeded into 96-well plates at a density of 5 × 103 cells per well. Upon reaching 80% confluence, the cells were first treated with lipopolysaccharide (LPS) (1 µg·mL-1) for 6 h and then exposed to varying concentrations of smirnotine A (5, 25, 50, 75, and 100 µg·mL-1). Each treatment group was set up in quadruplicate and incubated for 24 h at 37 °C under 5% CO₂. After incubation, 100 µL of 10% CCK8 solution was added to each well, followed by additional incubation at 37 °C for 2 h. The absorbance at 450 nm was measured using a microplate reader.
ELISA assay in MH7A cells
The supernatant was collected by centrifugation at 2000 × g for 20 min at 4 °C. Levels of inflammatory cytokines, including IL-6, IL-1β, TNF-α, and IL-10, were quantified in the supernatant using corresponding ELISA kits, strictly according to the manufacturer's instructions.
Toe swelling degree measurement
The swelling degree of the right hind paw was evaluated by measuring paw volume every 3 days post-modeling. Measurements were taken twice per rat and averaged. The inflammatory response was quantified as the percentage increase in paw volume relative to the baseline.

Organ index measurement
All rats were anesthetized and euthanized 24 h after the final administration. The humane method recognized by the international veterinary community is adopted. First, a high concentration (5%) of isoflurane is used to deeply anesthetize the animal. Once it loses consciousness and all reflexes, the chest is opened, and the heart is cut, ensuring that the animal dies painlessly and without any sensation. The spleen and thymus were promptly excised and weighed. After rinsing with normal saline, excess moisture on the tissue surfaces was removed by blotting with filter paper, and the wet weights of the organs were recorded27,28.

Hematoxylin and eosin (HE)
To preserve the integrity of the paw tissue samples, the entire portion distal to the right ankle joint of each rat was collected and stored. For sectioning, the swollen paw tissue was used. The sampling procedure was as follows: The tissue approximately 1 cm above the right ankle joint was completely dissected, the fur was removed, and the bone shaft was cut at the proximal end. The specimen was immediately fixed in 10% paraformaldehyde solution. After fixation, the tissue was placed in 15% EDTA decalcifying solution. Decalcification was monitored every 3 days, and the solution was refreshed as needed until the tissue softened, indicating completion of decalcification. The tissue was then dehydrated through a graded ethanol series (75% for 4 h, 85% for 2 h, 90% for 1.5 h, 95% for 1 h, and two changes of 100% ethanol for 0.5 h). Sections were deparaffinized, rehydrated through ethanol, stained with hematoxylin for 10 min, rinsed with tap water, differentiated in hydrochloric acid–ethanol for 10 s, rinsed with tap water, blued, rinsed again, immersed in 85% ethanol for 5 min, counterstained with eosin for 5 min, rinsed with tap water for 3 s, dehydrated, cleared, and mounted for observation29.
ELISA assay of rat serum
Blood samples were centrifuged at 2000 × g for 20 min at 4 °C, and the resulting supernatant was collected for cytokine analysis. The concentrations of IL-1β, IL-6, and TNF-α were determined using commercial ELISA kits, strictly in accordance with the manufacturer's protocols. A standard curve was generated and fitted using the cvxpt32 software, and the expression levels of each cytokine were calculated by interpolating the absorbance values into the corresponding standard curve equation. Final protein concentrations were calculated from the actual experimental measurements.
Quantitative polymerase chain reaction analysis (qPCR)
Total RNA was isolated from synovial cells using TRIzol reagent, with phase separation achieved by chloroform addition30. A commercial reverse transcription kit was then employed to synthesize cDNA from the isolated RNA, strictly following the manufacturer's instructions. qRT-PCR was performed using a SYBR Premix reagent. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the endogenous reference gene, and relative gene expression levels were calculated using the 2-ΔΔCt method. The following primer sequences were used: GAPDH Forward: ACAGCAACAGGGTGGTGGAC, and GAPDH Reverse: TTTGAGGGTGCAGCGAACTT; IL-17A Forward: CTGATGCTGTTGCTGCTACTGA, and IL-17A Reverse: TGGAACGGTTGAGGTAGTCTGA; TRAF6 Forward: ACATTTCCCTCTTTGTCCACAC, and TRAF6 Reverse: TTAGCATCCATGACCTCTTCGT; IL-10 Forward: CTGCAGGACTTTAAGGGTTACTT, and IL-10 Reverse: CTTGCTTTTATTCTCACAGGGGA; IL-1β Forward: CCTGTGTGATGAAAGACGGC, and IL-1β Reverse: TATGTCCCGACCATTGCTGT; IL-6 Forward: GTTGCCTTCTTGGGACTGATG, and IL-6 Reverse: TACTGGTCTGTTGTGGGTGGT.
Protein extraction and western blotting
Synovial tissue was lysed in phosphatase/protease inhibitor-supplemented radioimmunoprecipitation assay (RIPA) buffer, and protein concentrations were measured with a bicinchoninic acid (BCA) assay kit. For Western blotting, lysates containing equal amounts of protein were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and subsequently transferred onto polyvinylidene fluoride (PVDF) membranes. After blocking with 5% skim milk in Tris-buffered saline with 0.1% Tween (TBST) for 2 h at 25 °C, the membranes were incubated overnight at 4 °C with primary antibodies (GAPDH 1:50000; P-PI3K 1:1000; PI3K 1:1000; P-AKT 1:3000; AKT 1:6000). Following extensive washing with TBST, the membranes were reacted with horseradish peroxidase (HRP)-conjugated secondary antibodies (Anti-Mouse IgG 1:10000; Anti-rabbit IgG 1:1000) for 2 h at room temperature. Following another series of TBST washes, protein bands were visualized using an enhanced chemiluminescence (ECL) substrate. Band intensities were quantified with ImageJ software and normalized to GAPDH as the loading control.
Statistical analysis
All data were analyzed using Graphpad Prism 9.5 software and are presented as the mean ±± standard deviation. Statistical comparisons were performed using one-way ANOVA where appropriate. A p-value of less than 0.05 was considered statistically significant. Compared to the Control group: *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001; Compared to the Model/LPS group: #p < 0.05, ##p < 0.01, ###p < 0.001, and ####p < 0.0001.