A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

A Digital Microfluidic Electroporation Platform for Low-Input CRISPR Genome Editing and mRNA Transfection In Suspension T Cells and 3D Cell Models

117 views

⸱

DOI:

10.3791/70573

⸱

July 17th, 2026

In This Article

Summary

This protocol describes miniaturized CRISPR–Cas9 genome editing of TCRα/β receptor in primary human T cells using ‘DMF-ection’, a digital microfluidic (DMF) electroporation platform. The method enables parallel, low-input gene editing with high viability and is further adaptable for mRNA delivery into multicellular 3D spheroids.

Abstract

Digital microfluidic (DMF) electroporation enables precise, low-volume genetic manipulation of mammalian cells while minimizing cellular input by up to 100x and preserving viability. This study presents a high-throughput DMF-based transfection workflow for CRISPR-mediated knockout of the TRAC locus in primary human suspension T cells and for mRNA transfection of three-dimensional HEK293T spheroids. Using spatially deposited CRISPR guide RNAs and on- cartridge ribonucleoprotein (RNP) assembly, efficient TRAC locus disruption was achieved in both CD4⁺ and CD8⁺ T-cell populations using only 10,000 cells per condition, with post-editing viabilities exceeding 85%. Biophysical characterization using flow-induced and Taylor dispersion analyses revealed that polymer additives stabilize Cas9–sgRNA complexes under electroporation buffer conditions, supporting reproducible editing at sub microliter volumes. The workflow was further adapted for 3D applications by delivering EGFP mRNA into intact HEK293T spheroids, resulting in robust and spatially uniform fluorescence without impairing spheroid growth or morphology. Together, these results demonstrate that DMF electroporation enables efficient genome editing and mRNA delivery across both suspension immune cells and multicellular spheroids. This platform provides a scalable and low-input solution for applications in CAR-T cell therapy, functional genomics, and advanced 3D cellular models.

Introduction

Gene editing in primary human cells is increasingly central to both therapeutic development and basic research, including applications in immuno-engineering, rare disease modeling, and functional genomics1. Although electroporation enables highly efficient genome editing, conventional cuvette-based systems typically require up to millions of cells per condition, restricting their use for patient-derived samples and rare immune populations2. In addition, these systems are poorly suited for large-scale screening due to limitations in throughput, automation, and reagent consumption3.

Access restricted. Please log in or start a trial to view this content.

Protocol

Primary human T cells used in this protocol were obtained from commercial suppliers under informed donor consent and in compliance with applicable institutional, ethical, and regulatory guidelines. All handling of human-derived biological materials was conducted in accordance with institutional biosafety protocols. Researchers implementing this protocol are responsible for ensuring that their use of primary human cells complies with local institutional review board (IRB) or ethics committee requirements, applicable biosafety regulations, and any relevant national or regional legislation governing the use of human biological material. No patient-identifiable informatio....

Access restricted. Please log in or start a trial to view this content.

Results

Expected outcomes
Electroporation of 10,000 activated T cells per condition typically results in >85% TRAC knockout efficiency with >95% viability 72 h post-transfection. Flow cytometry reveals a clear loss of TCRα/β staining in the TRAC-targeting condition relative to non-targeting sgRNA controls (NTC) and controls not exposed to any electric fields. Unless otherwise stated, n represents independent DMF-ection runs performed on separate days. Technical replicates from th.......

Access restricted. Please log in or start a trial to view this content.

Discussion

This protocol describes a miniaturized digital microfluidic electroporation workflow that enables efficient intracellular delivery into primary human T cells using nanoliter-scale droplets. A central advantage of this method is the ability to perform CRISPR–Cas9 genome editing using only 10,000 cells per reaction, dramatically reducing material requirements compared to conventional electroporation. The droplet-based architecture supports automation, ensuring reproducible reagent handling and reaction assembly acros.......

Access restricted. Please log in or start a trial to view this content.

Disclosures

M.A.P, H.S, P.Q.N.V, A.B.C, A.E, M.W, and A.H are either current or former employees, or shareholders of DropGenie. M.S. is either a current or former employee or shareholder of FIDA Biosciences. The other authors have no competing interests to declare.

Acknowledgements

We thank John Fuller, Nick Morgan, and Beckman Coulter Life Sciences (BCLS) for logistical support and protocol development with the ECHO Acoustic Dispenser. We thank Mitchell Kozakoff at the ICCB-Longwood Screening Facility at Harvard Medical School for infrastructure and technical resources. The KNMRC facility at Northeastern University for cleanroom services. The authors would like to thank Laura Shumate from Keytech, as well as the group at Shakotis Ltd. Funding for student internships was generously provided by the Massachusetts Life Sciences Center (Mass Life Sciences). This work was also supported in part by MEDTEQ+, whose contribution helped advance developmen....

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
12 Channel VOYAGER Adjustable Tip Spacing PipetteIntegra4732Instrumentation
1x PBSGibcoFlow Buffer 
96 Well Plate, Sphera Low-Attachment SurfaceThermo Fisher174927Spheroid protocol
96-well conical-bottom plate Sarstedt82.1583.001Spheroid protocol
Alexa Fluor 647 anti-human CD4 AntibodyBiolegend3574211 in 200, Clone A161A1
Attune Flow CytometerThermoFisherInstrumentation
DMEM MediaGibco10564011Media Supplement- Spheroid culture
DMF compatible bufferDropGenieTransfection
DropGenie Transfection SystemDropGenieInstrumentation
Echo Acoustic Dispenser 650 SeriesBeckman Coulter Life Scienes
Echo Qualified 384-well Low Dead VolumeBeckman Coulter Life Scienes
EDTAInvitrogenFlow Buffer
EGFP mRNATrilinkL-7201
EVOS Fluorescent MicroscopeThermoFisherInstrumentation
Fetal Bovine SerumGibco16000044Media Supplement- Spheroid culture
Fida 1 instrument and Fida Neo 480 nm detectorFida Biosystems ApSInstrumentation
Ghost Dye Violet 510Cytek Biosciences13-0870
HEK293T CellsATCCSpheroid protocol
Human IL-2 Recombinant Protein,Peprotech200-02 50ugT cell media supplement
Human Primary Pan CD3+ T CellsAll CellsPeripheral Blood, Cryopreserved, pan CD3+ Helper T Cells, Negatively Selected
Immunocult CD3/CD28 ActivatorStemCell Technologies10970T Cell Activation media
Immunocult Expansion MediaStemCell Technologies10981T Cell Activation media
Incucyte Live Cell Analysis SystemSartoriusInstrumentation
INTEGRA ASSIST PLUS pipetting robotIntegra4505, 4-Position Portrait Deck (PN 4521), Instrumentation
non targeting synthetic guide RNASynthego5’ GCACTACCAGAGCTAACTCA 3'
NucleoCounter NC-202Chemometec
PE anti-human TCR α/β Recombinant AntibodyBiolegend3808051 in 200, Clone QA20B12 
PE-Cy 7 Anti-Human CD8BD Pharmingen5577501 in 200, Clone RPA-T8
Penicillin-Streptomycin (10,000 U/mL)Gibco15140122Media Supplement- Spheroid culture
Poly-L-glutamic Acid (PGA)Sigma AldrichP4761-100MGUse a at 100mg/ml
Prism version 8.0.0GraphPad Software, Inc.Software
sNLS-SpCas9-sNLS NucleaseIDT10017687
Spheroid MicroplateCorning3830Spheroid protocol
Surfactant FDropGenieTransfection- use at 1:20 in DMF compatible buffer to make compete Transfection buffer
TRAC synthetic guide RNASynthego5’ AGAGTCTCTCAGCTGGTACA 3'
Trypsin-EDTA (0.05%), phenol redGibco25-300-062Spheroid protocol

References

  1. Roth, T. L., Puig-Saus, C., Yu, R., Shifrut, E., Carnevale, J., et al. Reprogramming human T cell function and specificity with non-viral genome targeting. Nat Biotechnol. 36 (4), 285-297 (2018).
  2. Li, L. H., McCarthy, P., Hui, S. W.

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Digital Microfluidics3D Cell ModelsRNP AssemblyTRAC Locus KnockoutFlow CytometrySpheroid Transfection