Name: Synthesis and Characterization of an Aspirin-fumarate Prodrug that Inhibits NFκB Activity and Breast Cancer Stem Cells (Video) | JoVE Journal
Uploaded: 2017-01-18T12:30:00.000+00:00
Duration: 13 min 38 s
Description: Learn to synthesize and characterize the aspirin-fumarate prodrug GTCpFE for cancer therapeutics. This method demonstrates enhanced anti-NFkappaB activity against therapy-resistant breast cancer stem cells.

ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

This work was supported by grants provided by the National Institutes of Health (NIH), R01 CA200669 to JF and R01 CA121107 to GRJT, and by a postdoctoral fellowship grant from Susan G. Komen for the Cure to IK (PDF12229484).

1. Synthesis of Aspirin-fumarate Prodrug GTCpFE
<ol>
	<li>Using a plastic plunger syringe, measure 0.81 ml (20 mmol) of methanol and mix it in water (10 ml) in a round bottom flask. Cool the resulting mixture to 0 &#176;C by placing the flask in an ice-water bath. Add 4-hydroxybenzyl alcohol (2.48 mg, 20 mmol) and stir the reaction mixture until the solution is clear.</li>
	<li>Prepare a solution of O-acetylsalicyloyl chloride (3.77 mg, 19 mmol) in anhydrous toluene (10 ml) by weighing the desired amount of O-acetylsalicyloyl chloride and dissolving it in the solvent in a separate flask. Using a plastic plunger syringe, add this solution to the mixture prepared in step 1.1, and leave the reaction stirring at 0 &#176;C.</li>
	<li>Monitor the reaction using thin layer chromatography (TLC). The TLC plates should have silica as a stationary phase.
	<ol>
		<li>Prepare a mobile phase composed of 20:80 ethyl acetate (AcOEt)/hexane. In a TLC chamber (or small container) add 5 ml of mobile phase to cover the bottom of the chamber. 
		NOTE: The amount of mobile phase depends on the chamber selected. Always add enough to cover the bottom, but once the TLC is placed inside, the solvent line should not surpass the height where the compounds are spotted.</li>
		<li>Take a sample of the reaction with a syringe (0.2 ml), place it in a small vial, and dilute it with ethyl acetate (2-3 drops). With a TLC spotter, carefully take a sample of the diluted reaction mixture and spot it in the TLC. 
		NOTE: The spots should be 1-2 mm and this should be done at the lower 1/4 inch of the TLC plate.</li>
		<li>On the same TLC, place a spot of a solution of O-acetylsalicyloyl chloride (0.2 mg in 0.5 ml of ethyl acetate) as a comparison. Once the spots are dry, place it in the chamber and let it run until the solvent front has almost reached the top of the TLC.</li>
		<li>Take the TLC out, let it dry and visualize it under a UV lamp. The reaction is complete when the O-acetylsalicyloyl chloride spot disappears from the reaction mixture.</li>
		<li>When the reaction is completed, remove the ice-water bath, and allow the reaction to stir at room temperature for 20 hr.</li>
	</ol>
	</li>
	<li>Filter the precipitate using a Buchner funnel with a fritted disk of medium porosity. Place the solid in a scintillation vial, and leave the compound in vacuo overnight in a desiccator at room temperature. Use phosphorus pentoxide (P2O5) as the desiccant.</li>
	<li>Dry a round bottom flask by placing it in an oven at 80 &#176;C for at least two days before setting up this reaction. Alternatively, seal the flask with a septum and pierce it with a needle that is connected to a vacuum pump system. Turn the vacuum pump on and dry the flask using a heat gun. Allow to cool, and repeat this step 2 more times.</li>
	<li>Inflate a balloon using argon gas, and connect it to a plastic syringe (whose plunger has been removed) with a needle. Turn off the vacuum pump and remove the needle attached to it that was inserted in the now dried round bottom flask. Insert the needle connected to the argon balloon through the septum sealing the round bottom flask.
	<ol>
		<li>Add 4-hydroxymethylphenol ester of 2-acetyloxybenzoic acid (100 mg, 0.349 mmol), 4-dimethylaminopyridine (4 mg, 0.033 mmol) and triethylamine (53 mg, 0.523 mmol) to a separate flask, then dissolved them in anhydrous tetrahydrofuran (5 ml). With a plastic syringe attached to a needle, add this solution to the sealed round bottom flask. Cool the mixture down to 0 &#176;C by placing the flask in an ice water bath.</li>
	</ol>
	</li>
	<li>To the previous mixture, add a solution of ethyl fumaroyl chloride (68 mg, 0.419 mmol) in anhydrous tetrahydrofuran (5 ml), drop-wise over a period of 10 min. Stir the resulting solution at 0-5 &#176;C for 2-4 hr.</li>
	<li>Extract the reaction mixture with ethyl acetate (100 ml) and brine (50 ml). 
	NOTE: Brine is a saturated solution of sodium chloride (NaCl). To prepare it, place 200 ml of water in a clean glass container then start adding NaCl (while stirring) until it doesn&#39;t dissolve anymore.
	<ol>
		<li>After extraction, remove the aqueous phase and repeat the latter step two more times.</li>
		<li>Dry the mixture by adding sodium sulfate to the organic phase, until the solid does not clump up when the glassware is stirred. Using another Buchner funnel with a fritted disk, filter the mixture to a round bottom flask to remove the sodium sulfate, then evaporate to dryness using a rotary evaporator with the temperature set at 40 &#176;C.</li>
	</ol>
	</li>
	<li>Using a TLC, determine a proper mobile phase to use in column chromatography. 
	NOTE: For this experiment a gradient of 20:80 AcOEt/hexane was used.</li>
	<li>Prepare a column with silica gel and the appropriate solvent phase. Once the compound has been added, add a layer of sodium sulfate (or sand) to protect the column as the solvent is added.
	<ol>
		<li>As the column runs, monitor the eluate by TLC. Spot every other test tube as they are collected from the column. When the product of interest elutes, mix all samples containing pure product into a large round bottom flask, and dry them using a rotary evaporator with the bath temperature set at 40 &#176;C. 
		NOTE: Product should appear as a white solid.</li>
	</ol>
	</li>
	<li>To confirm the structure of GTCpFE, collect proton and carbon (1H and 13C, respectively) nuclear magnetic resonance (NMR) spectra as per manufacturer&#39;s instructions. 
	NOTE: In this study a 400 MHz FT NMR spectrometer was used to collect the 1H and 13C spectra. Run at least 25 scans at room temperature to obtain enough data resolution. The NMR peaks observed were the following, 1H NMR (CDCl3): &#948; 1.29 (t, 3 H, 3J = 7.0 Hz, CH3); 2.31 (s, 3 H, CH3); 4.26 (q, 2 H, 3J = 7.0 Hz, COOCH2); 5.25 (s, 2 H, OCH2); 6.89 (s, 2 H, HC=CH); 7.19 (m, 3 H, Ar); 7.42 (m, 3 H, Ar); 7.65 (m, 1 H, Ar); 8.22 (dd, 1 H, 3J = 7.8, 4J = 1.2 Hz, Ar). 13C NMR (CDCl3) &#948;: 169.70, 164.86, 164.75, 162.89, 151.28, 150.69, 134.76, 134.32, 133.26, 133.16, 132.25, 129.81, 126.26, 124.11, 122.47, 122.04, 66.40, 61.43, 21.05, 14.15.</li>
	<li>In addition, collect a high resolution mass spectrum using liquid chromatography mass spectrometry in combination with ion trap and time-of flight technology (LCMS-IT-TOF) for accurate mass measurements as per manufacturer&#39;s instructions. 
	NOTE: In this study (M+NH4+) calculated: 430.1496; observed: 430.1477.</li>
</ol>
2. GTCPFE Inhibits the NF&#312;B Activity in Breast Cancer Cells
<ol>
	<li>Cell Culture Conditions
	<ol>
		<li>Maintain human breast cancer cell lines, MCF-7 and MDA-MB-231 as per standard cell culture techniques and propagate in a humidified incubator at 37 &#176;C with 5% CO2.
		<ol>
			<li>Prepare MCF-7 cell medium from Roswell Park Memorial Institute (RPMI) 1640 medium with phenol red supplemented with 10% fetal bovine serum (FBS), 1% non-essential amino acids, 2 mM L-glutamine, 1% antibiotics penicillin-streptomycin, and 6 ng/ml insulin. Prepare MDA-MB-231 cell medium from Improved Minimum Essential Medium (IMEM) supplemented with 5% FBS, 1% non-essential amino acids, 2 mM L-glutamine, and 1% antibiotics penicillin-streptomycin.</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>NF&#954;B-RE Luciferase Reporter Assay
	<ol>
		<li>Trypsinize breast cancer MCF-7 cells using 0.25% trypsin for 5 min at 37 &#176;C, manually count using a hemocytometer and seed in 24-well plates at 90,000 cells per well density.</li>
		<li>The following day, co-transfect cells with plasmid DNA of an NF&#954;B response element (NF&#954;B-RE) luciferase construct, 1 &#181;g/well, along with the promoterless Renilla luciferase construct, 0.2 &#181;g/well. Perform transfections for each treatment group in triplicate.
		<ol>
			<li>Wash cells twice with PBS, and incubate with mixtures of plasmid DNA and 1 &#181;l per well of transfection reagent (e.g. lipofectamine) in serum free media. After 6 hr, change the medium to 1 ml of regular medium (without the antibiotics penicillin and streptomycin).</li>
		</ol>
		</li>
		<li>After 16 hr, add 1 &#181;l of vehicle or different stock solutions of the GTCpFE or ASA drugs to each well. Dissolve drug stock solutions (100, 50, 20, 10 and 1 mM) in dimethyl sulfoxide at 1,000x concentration. After adding the drugs, incubate cells for 2 hr at 37 &#176;C.</li>
		<li>To activate the NF&#954;B pathway, add the pro-inflammatory cytokine TNF&#945; (10 &#181;g/ml stock solution) into each well for a final concentration of 10 ng/ml and incubate for 4 hr. Include a TNF&#945; alone control. Aspirate the medium and store the cells at -80 &#176;C.</li>
		<li>Measure luciferase using a luciferase reporter assay system according to manufacturer&#39;s instructions. 
		NOTE: When using the luciferase assay system (e.g. Dual Luciferase assay system) for the first time, prepare a solution of luciferase assay reagent by re-suspending it in 10 ml of buffer and storing it at -80 &#176;C in 1 ml aliquots.
		<ol>
			<li>Prepare 1x lysis buffer by diluting 5x stock buffer with water. Lyse cells in each well using 100 &#181;l 1x lysis buffer. Incubate the plates on an orbital shaker for 15 min, at medium speed.</li>
			<li>Label one 1.5 ml tube per sample. Thaw luciferase assay reagent to room temperature (50 &#181;l per sample will be needed) and keep in foil. Prepare 1x quenching reagent in a glass vial, 1:49 dilution in buffer and vortex it (50 &#181;l per sample will be needed).</li>
			<li>Add 10 &#181;l of cell lysate to a labeled microcentrifuge tube. Then add 50 &#181;l of luciferase assay reagent and gently vortex. Immediately after, place the tube in a holder and measure the luminescence via the dual luciferase program in the luminometer. Select and press the following: Run Promega Protocols&#160;&#8594; Dual Glo &#8594; OK.</li>
			<li>Add 50 &#181;l of the quenching reagent to the test tube and gently vortex. Measure the luminescence. Repeat these steps for each sample.</li>
			<li>Analyze data using spreadsheet by normalizing NF&#954;B-RE to the Renilla internal control (NF&#954;B-RE/Renilla). Compare inhibitor data to TNF&#945; only control (TNF&#945; only is set at 100%).</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>NF&#954;B-Target Gene Transcription
	<ol>
		<li>Seed MCF-7 cells in 6-well plates at 250,000 cells per well in 2 ml medium volume prepared as described in section 2.1.</li>
		<li>The following day, add 2 &#181;l of different GTCpFE 1,000x stocks (100, 50, 20, 10 and 1 mM) for 2 hr prior to adding TNF&#945; 10ng/ml for another 2 hr. Run every treatment in triplicate. Include vehicle and TNF&#945; alone controls.</li>
		<li>Isolate RNA using the guanidinium thiocyanate-phenol-chloroform extraction method according to the instructions of the manufacturer22. Determine RNA concentration (in diethylpyrocarbonate (DEPC)-treated water) and RNA purity using a spectrophotometer. Keep RNA samples on ice or store at -80 &#176;C. Use only RNase-free barrier tips when handling RNA.</li>
		<li>Reverse transcribe 0.5 &#181;g total RNA using a commercially available kit of Moloney murine leukemia virus (M-MLV) reverse transcriptase. 
		NOTE: The kit includes 5x buffer and dithiothreitol (DTT), together with dNTP mixture, and random hexamers mixture.
		<ol>
			<li>Add 0.5 &#181;g of RNA to 200 units of M-MLV, 0.5 mM dNTPs, 100 ng of random hexamers, 10 mM DTT, 1x buffer and DEPC water to a final 10 &#181;l reaction volume. Carry out the reverse transcriptase reaction using a PCR cycler for 50 min at 37 &#176;C, and then 15 min at 70 &#176;C to heat-inactivate the enzyme.</li>
		</ol>
		</li>
		<li>Dilute the resulting cDNA product to 100 &#181;l with double-distilled water and use 2 &#181;l for each subsequent quantitative polymerase chain reaction (PCR) reaction.
		<ol>
			<li>Mix forward and reverse primers for the gene of interest at 1.25 &#181;M concentration each. Prepare a master mix with 2 &#181;l double distilled water, 1 &#181;l of 1.25 &#181;M primer mix and 5 &#181;l of 2x of the dye to enable detection of the double-stranded DNA. Load the 2 &#181;l of cDNA and 8 &#181;l of master mix into 96-well PCR plates.</li>
		</ol>
		</li>
		<li>Carry out quantitative PCR using a real time PCR system (40 cycles, 95-60 &#176;C) according to manufacturer&#39;s instructions and manually analyze the data. 
		NOTE: All PCR primers used have been validated and reported previously23.</li>
		<li>Calculate gene expression fold change using spreadsheet via the &#916;&#916;Ct method, with ribosomal protein 36B4 mRNA serving as the internal control23.</li>
	</ol>
	</li>
</ol>
3. GTCpFE Inhibits Breast Cancer Stem Cells In Vitro
<ol>
	<li>Mammosphere Formation Assay
	<ol>
		<li>Prepare mammosphere (MS) medium by supplementing Dulbecco&#39;s Modified Eagle Medium: Nutrient Mixture F-12 (DMEM/F12) phenol red-free medium with 1% methyl cellulose. Allow to dissolve by gentle shaking overnight at 4 &#176;C. Filter sterilize the medium and supplement with B27 1x, 1% penicillin and streptomycin, 5 &#181;g/ml insulin, 1 &#181;g/ml hydrocortisone, and 20 ng/ml recombinant human epidermal growth factor.</li>
		<li>Prepare single cells of MDA-MB-231 cell line by trypsin digestion (trypsin 0.25% for 5 min at 37 &#176;C) of monolayer cultures and filter through mesh sieves. Manually count single dissociated cells and plate in 96-well ultra-low attachment plates at a density of 400 cells/well. The next day, add different concentrations of GTCpFE (e.g., final GTCpFE concentrations: 1, 10, 20, 50 &#181;M) to a final volume is 100 &#181;l. Conduct every treatment in triplicate.</li>
		<li>After 7 days of culture in the incubator, acquire images via an imaging software using an inverted microscope. Manually count the number MS &#62;75 &#181;m in diameter. Compare the drug treatment to vehicle control. 
		NOTE: The diameter of MS &#62;75 &#181;m is determined using the imaging software.</li>
	</ol>
	</li>
	<li>CD44+CD24- CSC Immunophenotype
	<ol>
		<li>Trypsinize MDA-MB-231 cells with 0.25% trypsin for 5 min at 37 &#176;C. Count using a hemocytometer and seed in 10 cm dishes at 3 million cells per dish in 10 ml medium as described in section 2.1. Add vehicle (10 &#181;l dimethyl sulfoxide) or GTCpFE (10 &#181;l of 50 mM stock) to cells for 72 hr.</li>
		<li>For vehicle or GTCpFE treatment groups, trypsinize cells (as in step 3.2.1) and distribute 1 million cells in &#39;Test&#39; or &#39;Control&#39; 5 ml polystyrene tubes containing 2 ml of 1x Hank&#39;s Balanced Salt Solution (HBSS) buffer supplemented with 2% FBS.</li>
		<li>To stain for the surface markers CD44 and CD24, spin cells down and add 20 &#181;l of each conjugated antibody and HBSS + 2% FBS to Test tubes for a final 100 &#181;l overall volume (1:5 dilution). Add 100 &#181;l of HBSS + 2% FBS to Control tubes. Include CD44-APC conjugated antibody and CD24-PE antibody single stain controls or the IgG immunoisotype controls.</li>
		<li>Incubate cells in the dark at 4 &#176;C for 30 min. Spin down cells for 5 min at 400 x g and reconstitute in 200 &#181;l HBSS buffer with 2% FBS. Keep cells on ice in the dark.</li>
		<li>Perform Fluorescence-activated cell sorting (FACS) of live cells using a FACS analyzer instrument according to manufacturer&#39;s instructions. Collect at least 50,000 events for each tube. Run treatments in triplicate. 
		NOTE: Gating is based on controls from no staining (Control tube), IgG immunoisotypes, and the CD44-APC and CD24-PE single stains.</li>
		<li>Analyze data using an available flow cytometry software. 
		NOTE: The percent of GTCpFE-treated cell with the CD44+CD24- immunophenotype is estimated and compared to vehicle control.</li>
	</ol>
	</li>
</ol>

<ol><li>Hanahan, D., Weinberg, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Hallmarks+of+cancer%3A+the+next+generation%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">Hallmarks of cancer: the next generation.</a> Cell. 144, 646-674 (2011).</li>
<li>Cuzick, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Aspirin+and+non-steroidal+anti-inflammatory+drugs+for+cancer+prevention%3A+an+international+consensus+statement%5BTitle%5D)+AND+%22Lancet+Oncol%22%5BJournal%5D)">Aspirin and non-steroidal anti-inflammatory drugs for cancer prevention: an international consensus statement.</a> Lancet Oncol. 10, 501-507 (2009).</li>
<li>Terry, M. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Association+of+frequency+and+duration+of+aspirin+use+and+hormone+receptor+status+with+breast+cancer+risk%5BTitle%5D)+AND+%22JAMA%22%5BJournal%5D)">Association of frequency and duration of aspirin use and hormone receptor status with breast cancer risk.</a> JAMA. 291, 2433-2440 (2004).</li>
<li>Wang, D., Dubois, R. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cyclooxygenase-2%3A+a+potential+target+in+breast+cancer%5BTitle%5D)+AND+%22Semin+Oncol%22%5BJournal%5D)">Cyclooxygenase-2: a potential target in breast cancer.</a> Semin Oncol. 31, 64-73 (2004).</li>
<li>Howe, L. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Inflammation+and+breast+cancer.+Cyclooxygenase%2Fprostaglandin+signaling+and+breast+cancer%5BTitle%5D)+AND+%22Breast+Cancer+Res.+9%22%5BJournal%5D)">Inflammation and breast cancer. Cyclooxygenase/prostaglandin signaling and breast cancer.</a> Breast Cancer Res. 9. 9, 210(2007).</li>
<li>Kopp, E., Ghosh, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Inhibition+of+NF-kappa+B+by+sodium+salicylate+and+aspirin%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Inhibition of NF-kappa B by sodium salicylate and aspirin.</a> Science. 265, 956-959 (1994).</li>
<li>Yin, M. J., Yamamoto, Y., Gaynor, R. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+anti-inflammatory+agents+aspirin+and+salicylate+inhibit+the+activity+of+I%28kappa%29B+kinase-beta%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">The anti-inflammatory agents aspirin and salicylate inhibit the activity of I(kappa)B kinase-beta.</a> Nature. 396, 77-80 (1998).</li>
<li>Pierce, J. W., Read, M. A., Ding, H., Luscinskas, F. W., Collins, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Salicylates+inhibit+I+kappa+B-alpha+phosphorylation%2C+endothelial-leukocyte+adhesion+molecule+expression%2C+and+neutrophil+transmigration%5BTitle%5D)+AND+%22J+Immunol%22%5BJournal%5D)">Salicylates inhibit I kappa B-alpha phosphorylation, endothelial-leukocyte adhesion molecule expression, and neutrophil transmigration.</a> J Immunol. 156, 3961-3969 (1996).</li>
<li>Frasor, J., El-Shennawy, L., Stender, J. D., Kastrati, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((NFkappaB+affects+estrogen+receptor+expression+and+activity+in+breast+cancer+through+multiple+mechanisms%5BTitle%5D)+AND+%22Mol+Cell+Endocrinol%22%5BJournal%5D)">NFkappaB affects estrogen receptor expression and activity in breast cancer through multiple mechanisms.</a> Mol Cell Endocrinol. 418, 235-239 (2014).</li>
<li>Perkins, N. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+diverse+and+complex+roles+of+NF-kappaB+subunits+in+cancer%5BTitle%5D)+AND+%22Nat+Rev+Cancer%22%5BJournal%5D)">The diverse and complex roles of NF-kappaB subunits in cancer.</a> Nat Rev Cancer. 12, 121-132 (2012).</li>
<li>DiDonato, J. A., Mercurio, F., Karin, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((NF-kappaB+and+the+link+between+inflammation+and+cancer%5BTitle%5D)+AND+%22Immunol+Rev%22%5BJournal%5D)">NF-kappaB and the link between inflammation and cancer.</a> Immunol Rev. 246, 379-400 (2012).</li>
<li>Scarpignato, C., Hunt, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Nonsteroidal+antiinflammatory+drug-related+injury+to+the+gastrointestinal+tract%3A+clinical+picture%2C+pathogenesis%2C+and+prevention%5BTitle%5D)+AND+%22Gastroenterol+Clin+North+Am%22%5BJournal%5D)">Nonsteroidal antiinflammatory drug-related injury to the gastrointestinal tract: clinical picture, pathogenesis, and prevention.</a> Gastroenterol Clin North Am. 39, 433-464 (2010).</li>
<li>Sostres, C., Gargallo, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Gastrointestinal+lesions+and+complications+of+low-dose+aspirin+in+the+gastrointestinal+tract%5BTitle%5D)+AND+%22Best+Pract+Res+Clin+Gastroenterol%22%5BJournal%5D)">Gastrointestinal lesions and complications of low-dose aspirin in the gastrointestinal tract.</a> Best Pract Res Clin Gastroenterol. 26, 141-151 (2012).</li>
<li>Kastrati, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Dimethyl+Fumarate+Inhibits+the+Nuclear+Factor+kappaB+Pathway+in+Breast+Cancer+Cells+by+Covalent+Modification+of+p65+Protein%5BTitle%5D)+AND+%22J+Biol+Chem%22%5BJournal%5D)">Dimethyl Fumarate Inhibits the Nuclear Factor kappaB Pathway in Breast Cancer Cells by Covalent Modification of p65 Protein.</a> J Biol Chem. 291, 3639-3647 (2016).</li>
<li>Kastrati, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+novel+aspirin+prodrug+inhibits+NFkappaB+activity+and+breast+cancer+stem+cell+properties%5BTitle%5D)+AND+%22BMC+Cancer%22%5BJournal%5D)">A novel aspirin prodrug inhibits NFkappaB activity and breast cancer stem cell properties.</a> BMC Cancer. 15, 845(2015).</li>
<li>Cao, Y., Luo, J. L., Karin, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((IkappaB+kinase+alpha+kinase+activity+is+required+for+self-renewal+of+ErbB2%2FHer2-transformed+mammary+tumor-initiating+cells%5BTitle%5D)+AND+%22Proc+Natl+Acad+Sci+U+S+A%22%5BJournal%5D)">IkappaB kinase alpha kinase activity is required for self-renewal of ErbB2/Her2-transformed mammary tumor-initiating cells.</a> Proc Natl Acad Sci U S A. 104, 15852-15857 (2007).</li>
<li>Liu, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+canonical+NF-kappaB+pathway+governs+mammary+tumorigenesis+in+transgenic+mice+and+tumor+stem+cell+expansion%5BTitle%5D)+AND+%22Cancer+Res%22%5BJournal%5D)">The canonical NF-kappaB pathway governs mammary tumorigenesis in transgenic mice and tumor stem cell expansion.</a> Cancer Res. 70, 10464-10473 (2010).</li>
<li>Korkaya, H., Liu, S., Wicha, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Regulation+of+cancer+stem+cells+by+cytokine+networks%3A+attacking+cancer%27s+inflammatory+roots%5BTitle%5D)+AND+%22Clin+Cancer+Res%22%5BJournal%5D)">Regulation of cancer stem cells by cytokine networks: attacking cancer's inflammatory roots.</a> Clin Cancer Res. 17, 6125-6129 (2011).</li>
<li>Hinohara, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((ErbB+receptor+tyrosine+kinase%2FNF-kappaB+signaling+controls+mammosphere+formation+in+human+breast+cancer%5BTitle%5D)+AND+%22Proc+Natl+Acad+Sci+U+S+A%22%5BJournal%5D)">ErbB receptor tyrosine kinase/NF-kappaB signaling controls mammosphere formation in human breast cancer.</a> Proc Natl Acad Sci U S A. 109, 6584-6589 (2012).</li>
<li>Kendellen, M. F., Bradford, J. W., Lawrence, C. L., Clark, K. S., Baldwin, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Canonical+and+non-canonical+NF-kappaB+signaling+promotes+breast+cancer+tumor-initiating+cells%5BTitle%5D)+AND+%22Oncogene%22%5BJournal%5D)">Canonical and non-canonical NF-kappaB signaling promotes breast cancer tumor-initiating cells.</a> Oncogene. 33, 1297-1305 (2014).</li>
<li>Yamamoto, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((NF-kappaB+non-cell-autonomously+regulates+cancer+stem+cell+populations+in+the+basal-like+breast+cancer+subtype%5BTitle%5D)+AND+%22Nat+Commun%22%5BJournal%5D)">NF-kappaB non-cell-autonomously regulates cancer stem cell populations in the basal-like breast cancer subtype.</a> Nat Commun. 4, 2299(2013).</li>
<li>Rio, D. C., Ares, M., Hannon, G. J., Nilsen, T. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Purification+of+RNA+using+TRIzol+%28TRI+reagent%29%5BTitle%5D)+AND+%22Cold+Spring+Harb+Protoc%22%5BJournal%5D)">Purification of RNA using TRIzol (TRI reagent).</a> Cold Spring Harb Protoc. , (2010).</li>
<li>Frasor, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Positive+cross-talk+between+estrogen+receptor+and+NF-kappaB+in+breast+cancer%5BTitle%5D)+AND+%22Cancer+Res%22%5BJournal%5D)">Positive cross-talk between estrogen receptor and NF-kappaB in breast cancer.</a> Cancer Res. 69, 8918-8925 (2009).</li>
<li>Al-Hajj, M., Wicha, M. S., Benito-Hernandez, A., Morrison, S. J., Clarke, M. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Prospective+identification+of+tumorigenic+breast+cancer+cells%5BTitle%5D)+AND+%22Proc+Natl+Acad+Sci+U+S+A%22%5BJournal%5D)">Prospective identification of tumorigenic breast cancer cells.</a> Proc Natl Acad Sci U S A. 100, 3983-3988 (2003).</li>
<li>Vandermeeren, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Dimethylfumarate+is+an+inhibitor+of+cytokine-induced+nuclear+translocation+of+NF-kappa+B1%2C+but+not+RelA+in+normal+human+dermal+fibroblast+cells%5BTitle%5D)+AND+%22J+Invest+Dermatol%22%5BJournal%5D)">Dimethylfumarate is an inhibitor of cytokine-induced nuclear translocation of NF-kappa B1, but not RelA in normal human dermal fibroblast cells.</a> J Invest Dermatol. 116, 124-130 (2001).</li>
<li>Loewe, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Dimethylfumarate+inhibits+TNF-induced+nuclear+entry+of+NF-kappa+B%2Fp65+in+human+endothelial+cells%5BTitle%5D)+AND+%22J+Immunol%22%5BJournal%5D)">Dimethylfumarate inhibits TNF-induced nuclear entry of NF-kappa B/p65 in human endothelial cells.</a> J Immunol. 168, 4781-4787 (2002).</li>
<li>Seidel, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Dimethylfumarate+inhibits+NF-%7Bkappa%7DB+function+at+multiple+levels+to+limit+airway+smooth+muscle+cell+cytokine+secretion%5BTitle%5D)+AND+%22Am+J+Physiol+Lung+Cell+Mol+Physiol%22%5BJournal%5D)">Dimethylfumarate inhibits NF-{kappa}B function at multiple levels to limit airway smooth muscle cell cytokine secretion.</a> Am J Physiol Lung Cell Mol Physiol. 297, L326-L339 (2009).</li>
<li>Wilms, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Dimethylfumarate+inhibits+microglial+and+astrocytic+inflammation+by+suppressing+the+synthesis+of+nitric+oxide%2C+IL-1beta%2C+TNF-alpha+and+IL-6+in+an+in-vitro+model+of+brain+inflammation%5BTitle%5D)+AND+%22J+Neuroinflammation%22%5BJournal%5D)">Dimethylfumarate inhibits microglial and astrocytic inflammation by suppressing the synthesis of nitric oxide, IL-1beta, TNF-alpha and IL-6 in an in-vitro model of brain inflammation.</a> J Neuroinflammation. 7, 30(2010).</li>
<li>Peng, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Dimethyl+fumarate+inhibits+dendritic+cell+maturation+via+nuclear+factor+kappaB+%28NF-kappaB%29+and+extracellular+signal-regulated+kinase+1+and+2+%28ERK1%2F2%29+and+mitogen+stress-activated+kinase+1+%28MSK1%29+signaling%5BTitle%5D)+AND+%22J+Biol+Chem%22%5BJournal%5D)">Dimethyl fumarate inhibits dendritic cell maturation via nuclear factor kappaB (NF-kappaB) and extracellular signal-regulated kinase 1 and 2 (ERK1/2) and mitogen stress-activated kinase 1 (MSK1) signaling.</a> J Biol Chem. 287, 28017-28026 (2012).</li>
<li>Li, H. J., Reinhardt, F., Herschman, H. R., Weinberg, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cancer-stimulated+mesenchymal+stem+cells+create+a+carcinoma+stem+cell+niche+via+prostaglandin+E2+signaling%5BTitle%5D)+AND+%22Cancer+Discov%22%5BJournal%5D)">Cancer-stimulated mesenchymal stem cells create a carcinoma stem cell niche via prostaglandin E2 signaling.</a> Cancer Discov. 2, 840-855 (2012).</li>
<li>Li, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Intrinsic+resistance+of+tumorigenic+breast+cancer+cells+to+chemotherapy%5BTitle%5D)+AND+%22J+Natl+Cancer+Inst%22%5BJournal%5D)">Intrinsic resistance of tumorigenic breast cancer cells to chemotherapy.</a> J Natl Cancer Inst. 100, 672-679 (2008).</li>
<li>Diehn, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Association+of+reactive+oxygen+species+levels+and+radioresistance+in+cancer+stem+cells%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">Association of reactive oxygen species levels and radioresistance in cancer stem cells.</a> Nature. 458, 780-783 (2009).</li>
<li>Hollier, B. G., Evans, K., Mani, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+epithelial-to-mesenchymal+transition+and+cancer+stem+cells%3A+a+coalition+against+cancer+therapies%5BTitle%5D)+AND+%22J+Mammary+Gland+Biol+Neoplasia%22%5BJournal%5D)">The epithelial-to-mesenchymal transition and cancer stem cells: a coalition against cancer therapies.</a> J Mammary Gland Biol Neoplasia. 14, 29-43 (2009).</li>
<li>Velasco-Velazquez, M. A., Popov, V. M., Lisanti, M. P., Pestell, R. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+role+of+breast+cancer+stem+cells+in+metastasis+and+therapeutic+implications%5BTitle%5D)+AND+%22Am+J+Pathol%22%5BJournal%5D)">The role of breast cancer stem cells in metastasis and therapeutic implications.</a> Am J Pathol. 179, 2-11 (2011).</li>
<li>Dontu, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((In+vitro+propagation+and+transcriptional+profiling+of+human+mammary+stem%2Fprogenitor+cells%5BTitle%5D)+AND+%22Genes+Dev%22%5BJournal%5D)">In vitro propagation and transcriptional profiling of human mammary stem/progenitor cells.</a> Genes Dev. 17, 1253-1270 (2003).</li>
<li>Charafe-Jauffret, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cancer+stem+cells+in+breast%3A+current+opinion+and+future+challenges%5BTitle%5D)+AND+%22Pathobiology%22%5BJournal%5D)">Cancer stem cells in breast: current opinion and future challenges.</a> Pathobiology. 75, 75-84 (2008).</li>
<li>Clayton, H., Titley, I., Vivanco, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Growth+and+differentiation+of+progenitor%2Fstem+cells+derived+from+the+human+mammary+gland%5BTitle%5D)+AND+%22Exp+Cell+Res%22%5BJournal%5D)">Growth and differentiation of progenitor/stem cells derived from the human mammary gland.</a> Exp Cell Res. 297, 444-460 (2004).</li>
<li>Ginestier, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((ALDH1+is+a+marker+of+normal+and+malignant+human+mammary+stem+cells+and+a+predictor+of+poor+clinical+outcome%5BTitle%5D)+AND+%22Cell+Stem+Cell%22%5BJournal%5D)">ALDH1 is a marker of normal and malignant human mammary stem cells and a predictor of poor clinical outcome.</a> Cell Stem Cell. 1, 555-567 (2007).</li>
<li>Rosen, J. M., Jordan, C. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+increasing+complexity+of+the+cancer+stem+cell+paradigm%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">The increasing complexity of the cancer stem cell paradigm.</a> Science. 324, 1670-1673 (2009).</li>
<li>Visvader, J. E., Lindeman, G. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cancer+stem+cells+in+solid+tumours%3A+accumulating+evidence+and+unresolved+questions%5BTitle%5D)+AND+%22Nat+Rev+Cancer%22%5BJournal%5D)">Cancer stem cells in solid tumours: accumulating evidence and unresolved questions.</a> Nat Rev Cancer. 8, 755-768 (2008).</li>
</ol>

The authors have nothing to disclose.

In this protocol, we demonstrated the synthesis of an ASA prodrug, GTCpFE, where the fumarate pharmacophore was incorporated to improve the anti-NF&#312;B activity in breast cancer cells. GTCpFE is an effective NF&#312;B inhibitor, whereas ASA itself is not, even at much higher concentrations. The fumarate moiety has anti-inflammatory properties as shown by its ability to inhibit NF&#312;B signaling in a variety of cell lines and tissues14,25-29. The prodrug strategy described herein, is amendable to other mal...

Inflammation is a hallmark that underlies multiple aspects of tumorigenesis, such as incidence and promotion, and eventually progression to metastasis1. In breast cancer, this is further supported by epidemiological observations showing that regular use of the classical non-steroidal anti-inflammatory drug aspirin (acetyl salicylic acid, ASA) is associated with a reduction in both breast cancer incidence, and risk of metastasis and recurrence2,3. ASA acts primarily by inhibiting cyclooxygenase-2 activity, which is often upregulated in breast cancer4,5. However, the anti-cancer effects of ASA may also be mediated by suppressing aberrant nuclear factor &#954;B (NF&#954;B) signaling6-8. This is important because a deregulated NF&#954;B pathway promotes tumor cell survival, proliferation, migration, invasion, angiogenesis, and resistance to therapy9-11. NF&#954;B pathway activation is also critical for mounting an immune response. Therefore, for anti-cancer therapy where prolonged NF&#954;B inhibition is required, one must consider the detrimental side effects involving long-lasting immune suppression. Hence, ASA may serve as a good starting point for therapeutic optimization.
One limitation for ASA application in cancer therapy is the elevated doses required for cyclooxygenase 2 and NF&#954;B inhibition, which are associated with gastrointestinal toxicity, such as ulcers and stomach bleeding12,13. However, converting ASA into as ester prodrug, may reduce ASA&#39;s gastrointestinal toxicity. To further enhance potency and/or add functionality, additional structural elements or ancillary pharmacophores may also be incorporated into ester prodrug design. One such pharmacophore added to enhance ASA potency against the NF&#954;B pathway is fumarate, which we have previously shown to be important for NF&#954;B pathway inhibition14,15.
We synthesized an aspirin-fumarate prodrug15, GTCpFE, and hypothesized that such hybrid molecule would be safe yet potent against the NF&#954;B pathway. We tested its anti-NF&#954;B activity in breast cancer cells and its ability to block breast cancer stem cells (CSCs)15, which rely on NF&#954;B signaling for survival and growth16-21. We find that the potency of GTCpFE against the NF&#954;B pathway is significantly improved over ASA15. In addition, GTCpFE blocks mammosphere formation and attenuates the CSC surface marker CD44+CD24- immunophenotype, indicating that GTCpFE is capable of eradicating CSCs15. These results establish the aspirin-fumarate prodrug as an effective anti-inflammatory agent that can also target breast CSCs. In terms of breast cancer therapy, GTCpFE may have the potential to treat aggressive and deadly disease.

<table><tbody><tr><td>RPMI 1640 Red Medium</td><td>Life Technologies&amp;nbsp;</td><td>11875-093</td><td>Warm up to 37 &amp;deg;C before use</td></tr><tr><td>IMEM</td><td>Corning</td><td>10-024-CV</td><td>Warm up to 37 &amp;deg;C before use</td></tr><tr><td>DMEM / F12 Medium</td><td>ThermoFisher</td><td>21041-025</td><td>Warm up to 37 &amp;deg;C before use</td></tr><tr><td>MEM NEAA 10 mM 100x</td><td>Life Technologies&amp;nbsp;</td><td>11140</td><td></td></tr><tr><td>Penicillin Streptomycin</td><td>Life Technologies&amp;nbsp;</td><td>15140-122</td><td></td></tr><tr><td>L-Glutamine 100x</td><td>Life Technologies&amp;nbsp;</td><td>25030-081</td><td></td></tr><tr><td>Insulin</td><td>Sigma-Aldrich</td><td>I-1882</td><td></td></tr><tr><td>Fetal Bovine Serum&amp;nbsp;</td><td>Atlanta Biologicals</td><td>S11150</td><td></td></tr><tr><td>Trypsin 2.5% 10x</td><td>Invitrogen</td><td>15090046</td><td></td></tr><tr><td>Methyl Cellulose</td><td>Sigma&amp;nbsp;</td><td>M0262</td><td></td></tr><tr><td>B27 Supplement 50x</td><td>Gibco</td><td>17504-044</td><td></td></tr><tr><td>EGF</td><td>Gibco</td><td>PHG0311L</td><td></td></tr><tr><td>NF&amp;kappa;B-RE Luciferase Construct&amp;nbsp;</td><td>Clontech&amp;nbsp;</td><td>pGL4.32</td><td></td></tr><tr><td>Renilla Luciferase Construct&amp;nbsp;</td><td>Promega</td><td>pGL4.70</td><td></td></tr><tr><td>Lipofectamine 2000</td><td>ThermoFisher</td><td>11668-019</td><td></td></tr><tr><td>Dual-Luciferase Reporter Assay&amp;nbsp;</td><td>Promega</td><td>120000032</td><td></td></tr><tr><td>NanoDrop Spectrophotometer</td><td>ThermoFisher</td><td></td><td></td></tr><tr><td>Eppendorf Mastercycler&amp;nbsp;</td><td>Eppendorf</td><td></td><td></td></tr><tr><td>StepOne Real Time PCR System</td><td>Thermo Scientific</td><td></td><td></td></tr><tr><td>Eclipse Microscope</td><td>Nikon</td><td></td><td></td></tr><tr><td>CyAn ADP Analyzer&amp;nbsp;</td><td>Beckman Coulter</td><td></td><td></td></tr><tr><td>QCapture Software</td><td>QImaging</td><td></td><td></td></tr><tr><td>Summit Software</td><td>Beckman Coulter</td><td></td><td></td></tr><tr><td>GraphPad Software</td><td>Prism</td><td></td><td></td></tr><tr><td>TRIzol</td><td>ThermoFisher</td><td>15596-018</td><td></td></tr><tr><td>M-MLV Reverse Transcriptase</td><td>Invitrogen</td><td>28025-013</td><td></td></tr><tr><td>100 mM dNTP Set</td><td>Invitrogen</td><td>10297-018</td><td></td></tr><tr><td>Random Hexamers&amp;nbsp;</td><td>Invitrogen</td><td>48190-011</td><td></td></tr><tr><td>Fast SYBR Green Master Mix</td><td>ThermoFisher</td><td>4385612</td><td></td></tr><tr><td>Costar 96W, ultra low attachment&amp;nbsp;</td><td>Corning</td><td>3474</td><td></td></tr><tr><td>HBSS, 1x</td><td>ThermoFisher</td><td>14025134</td><td></td></tr><tr><td>CD44-APC conjugated antibody&amp;nbsp;</td><td>BD Pharmingen</td><td>560990</td><td>Store at 4 &amp;deg;C, protect from light</td></tr><tr><td>CD24-PE antibody</td><td>BD Pharmingen</td><td>560991</td><td>Store at 4 &amp;deg;C, protect from light</td></tr><tr><td>Recombinant Human TNF&amp;alpha;</td><td>Fisher</td><td>210TA100&amp;nbsp;</td><td></td></tr><tr><td>CCL2 Primer Forward Sequence</td><td></td><td></td><td>AGAATCACCAGCAGCAAGTGTCC</td></tr><tr><td>CCL2 Primer Reverse Sequence</td><td></td><td></td><td>TCCTGAACCCACTTCTGCTTGG</td></tr><tr><td>ICAM1 Primer Reverse Sequence</td><td></td><td></td><td>TGACGAAGCCAGAGGTCTCAG</td></tr><tr><td>ICAM1 Primer Forward Sequence</td><td></td><td></td><td>AGCGTCACCTTGGCTCTAGG</td></tr><tr><td>TNF Primer Forward Sequence</td><td></td><td></td><td>AAGGGTGACCGACTCAGCG</td></tr><tr><td>TNF Primer Reverse Sequence</td><td></td><td></td><td>ATCCCAAAGTAGACCTGCCCA</td></tr><tr><td>36B4 Primer Forward Sequence</td><td></td><td></td><td>GTGTTCGACAATGGCAGCAT</td></tr><tr><td>36B4 Primer Reverse Sequence</td><td></td><td></td><td>GACACCCTCCAGGAAGCGA</td></tr><tr><td>Sodium Hydroxide</td><td>Sigma-Aldrich</td><td>S5881-500G</td><td></td></tr><tr><td>4-Hydroxybenzyl Alcohol</td><td>Sigma-Aldrich</td><td>20806-10G</td><td></td></tr><tr><td>&lt;em&gt;O&lt;/em&gt;-Acetylsalicyloyl Chloride</td><td>Sigma-Aldrich</td><td>165190-5G</td><td></td></tr><tr><td>Phosphorous Pentoxide</td><td>Sigma-Aldrich</td><td>79610-100G</td><td></td></tr><tr><td>Ethyl Fumaroyl Chloride</td><td>Sigma-Aldrich</td><td>669695-1G</td><td></td></tr><tr><td>Sodium Sulfate</td><td>Sigma-Aldrich</td><td>246980-500G</td><td></td></tr><tr><td>4-Dimethylaminopyridine</td><td>Sigma-Aldrich</td><td>714844-100ML</td><td>0.5&amp;nbsp;M in tetrahydrofuran</td></tr><tr><td>Triethylamine</td><td>Sigma-Aldrich</td><td>T0886-100ML</td><td></td></tr><tr><td>Toluene</td><td>Sigma-Aldrich</td><td>244511-100ML</td><td></td></tr><tr><td>Ethyl Acetate</td><td>Sigma-Aldrich</td><td>270989-100ML</td><td></td></tr><tr><td>Tetrahydrofuran</td><td>Sigma-Aldrich</td><td>401757-2L</td><td></td></tr><tr><td>400 MHz FT NMR spectrometer&amp;nbsp;</td><td></td><td></td><td>See Bruker&amp;rsquo;s Avance User&amp;rsquo;s Manual, version 000822 for details</td></tr></tbody></table>

synthesis and characterization of an aspirin-fumarate prodrug that inhibits nf&#954;b activity and breast cancer stem cells

Synthesis and Characterization of an Aspirin-fumarate Prodrug that Inhibits NF&#954;B Activity and Breast Cancer Stem Cells

Inflammation is a cancer hallmark that underlies cancer incidence and promotion, and eventually progression to metastasis. Therefore, adding an anti-inflammatory drug to standard cancer regiments may improve patient outcome. One such drug, aspirin (acetylsalicylic acid, ASA), has been explored for cancer chemoprevention and anti-tumor activity. Besides inhibiting the cyclooxygenase 2-prostaglandin axis, ASA&#39;s anti-cancer activities have also been attributed to nuclear factor &#312;B (NF&#312;B) inhibition. Because prolonged ASA use may cause gastrointestinal toxicity, a prodrug strategy has been implemented successfully. In this prodrug design the carboxylic acid of ASA is masked and additional pharmacophores are incorporated.
This protocol describes how we synthesized an aspirin-fumarate prodrug, GTCpFE, and characterized its inhibition of the NF&#312;B pathway in breast cancer cells and attenuation of the cancer stem-like properties, an important NF&#312;B-dependent phenotype. GTCpFE effectively inhibits the NF&#312;B pathway in breast cancer cell lines whereas ASA lacks any inhibitory activity, indicating that adding fumarate to ASA structure significantly contributes to its activity. In addition, GTCpFE shows significant anti-cancer stem cell activity by blocking mammosphere formation and attenuating the cancer stem cell associated CD44+CD24- immunophenotype. These results establish a viable strategy to develop improved anti-inflammatory drugs for chemoprevention and cancer therapy.

In Figure 1, the chemical structure of aspirin-fumarate prodrug, GTCpFE, and its inhibitory activity on cytokine induced NFĸB pathway in breast cancer cells are indicated. GTCpFE inhibits both NFĸB endpoints, NFĸB-RE luciferase activity (Figure 1B) and expression of NFĸB target genes, such as Intercellular Adhesion Molecule 1 (ICAM1), Chemokine C-C Motif Ligand 2 (CCL2), and Tumor Necrosis Factor (TNF) (Figure 1C) in MCF-7 breast cancer c...

This procedure will demonstrate how we synthesized and characterized the anti-NF&#954;B and anti-cancer stem cell activity of an aspirin-fumarate prodrug.

Inflammation is a cancer hallmark that underlies cancer incidence and promotion, and eventually progression to metastasis. Therefore, adding an ...

synthesis-characterization-an-aspirin-fumarate-prodrug-that-inhibits

Research

JoVE Journal

Cancer Research

We have synthesized a novel analogue of pancratistatin with comparable anti-cancer activity as native pancratistatin; interestingly, combinatory treatment with tamoxifen yielded a drastic enhancement in apoptotic and autophagic induction by mitochondrial targeting with minimal effect on noncancerous fibroblasts. Thus, JCTH-4 in combination with tamoxifen could provide a safe anti-cancer therapy.

Enhancement of Apoptotic and Autophagic Induction by a Novel Synthetic C-1 Analogue of 7-deoxypancratistatin in Human Breast Adenocarcinoma and Neuroblastoma Cells with Tamoxifen

An example of a nano drug based on polymalic acid is presented towards the rational design of personalized medicine that is applicable to cancer. It describes the synthesis of a nano drug to treat Her2-positive human breast cancer in a nude mouse.

Polymalic Acid-based Nano Biopolymers for Targeting of Multiple Tumor Markers: An Opportunity for Personalized Medicine?

This article describes the encapsulation of falcarindiol in lipid-coated 74 nm nanoparticles. The cellular uptake of the nanoparticles by human stem cells into lipid droplets is monitored by fluorescent and confocal imaging. Nanoparticles are fabricated by the rapid injection method of solvent shifting, and their size is measured with the dynamic light scattering technique.

Uptake of New Lipid-coated Nanoparticles Containing Falcarindiol by Human Mesenchymal Stem Cells

This experimental protocol describes the isolation of BCSCs from breast cancer cell and tissue samples as well as the in vitro and in vivo assays that can be used to assess BCSC phenotype and function.

Isolation and Functional Assessment of Human Breast Cancer Stem Cells from Cell and Tissue Samples

This paper aims to provide a protocol for the isolation and culture of primary cancer-associated fibroblasts from a syngeneic murine model of triple-negative breast cancer and their application for the preclinical study of novel nanoparticles designed to target the tumor...

Isolation of Primary Cancer-Associated Fibroblasts from a Syngeneic Murine Model of Breast Cancer for the Study of Targeted Nanoparticles

The present protocol describesa comprehensive strategy for evaluating the pharmacological action and mechanism of salidroside in inhibiting MCF-7 cell proliferation and migration.

Exploring the Pharmacological Action and Molecular Mechanism of Salidroside in Inhibiting MCF-7 Cell Proliferation and Migration

Here, we describe the protocol for in vivo delivery of magnetic iron oxide nanoparticles carrying RNA oligomers to metastatic breast cancer in animal models, providing a clinically viable approach for the therapeutic silencing of oncogenic nucleic acids.

Monitoring of Nanodrug Accumulation in Murine Breast Cancer Metastases

This protocol describes a gel shift biochemical assay for measuring FEN1 (Flap Endonuclease 1) activity and inhibitor development.

Fluorescence-Based Detection of FEN1 Nuclease Activity and Screening of Small-Molecule Inhibitors

This research describes the automated process for [68Ga]Ga-3BP-3940 production with the GAIA V2 synthesizer, for PET imaging of fibroblast activation protein. The results of quality control tests performed on three test batches are also presented.

Automated Preparation of [68Ga]Ga-3BP-3940 on a Synthesis Module for PET Imaging of the Tumor Microenvironment

Here, we present a protocol for the generation of induced pluripotent Stem Cells (iPSCs) from Li-Fraumeni Syndrome (LFS) patient derived fibroblasts, differentiation of iPSCs via mesenchymal stem cells (MSCs) to osteoblasts, and modeling in vivo tumorigenesis using LFS patient-derived osteoblasts.

Modeling Osteosarcoma Using Li-Fraumeni Syndrome Patient-derived Induced Pluripotent Stem Cells

Learn to synthesize and characterize the aspirin-fumarate prodrug GTCpFE for cancer therapeutics. This method demonstrates enhanced anti-NFkappaB activity against therapy-resistant breast cancer stem cells.

Synthesis and Characterization of an Aspirin-fumarate Prodrug that Inhibits NFκB Activity and Breast Cancer Stem Cells

Explore More Videos