Name: Dissection of Larval Zebrafish Gonadal Tissue (Video) | JoVE Journal
Uploaded: 2017-04-26T14:00:00.000+00:00
Duration: 10 min 43 s
Description: Learn to dissect gonadal tissue from larval zebrafish as early as 17 days post-fertilization. This method enables molecular analysis of sex differentiation and developmental biology research.

ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

We thank C Zhang for fish care. This work was supported by the National Natural Science Foundation of China (31171074, 31371099 and 31571067 to GP) and by the Pujiang Talent Project (09PJ1401900 to GP).

Zebrafish experiments were approved by the Fudan University Institutional Animal Care and Use Committee. Zebrafish were raised and bred according to standard procedures20.
1. Preparations
<ol>
	<li>Cultivate 17 dpf and 25 dpf larval zebrafish
	<ol>
		<li>Transfer 2 male and 2 female adult zebrafish (healthy, 3 to 6 months old, laboratory AB strain) to a crossing tank in the late afternoon before the crossing day. Separate the males and females with a barrier. The next morning, refresh the tank water and remove the barrier to allow them to mate. Collect eggs in 100 mm Petri dishes 1 to 2 h after fertilization.</li>
		<li>Keep about 40 embryos in a 100 mm plate with 40 mL embryo medium (EM) at 28.5 &#176;C during the early development period (4 days) and refresh the EM twice a day. Transfer larvae to 1 L tanks (40 larvae to 300 mL system water) and feed with live rotifers (full supply, twice a day) after 5 dpf. Feed live brine shrimp instead of rotifer diet after 10 dpf. Transfer the fish into re-circulating water system at 14 dpf21.</li>
		<li>Raise larval zebrafish in the re-circulating water system till 17 dpf or 25 dpf. Ensure the light/dark cycle is 14/10 h and pH value of system water is about 7.2. Measure the body length of 17 dpf (5.5 to 6.8 mm) and 25 dpf (8 to 11 mm) larvae22.</li>
	</ol>
	</li>
	<li>Prepare 2% agar plates for the dissection.
	<ol>
		<li>Add 4 g agar to 200 mL sterile water. Heat the mixture in a microwave oven until it turns transparent.</li>
		<li>Cool the agar solution for about 15 min, then pour it into 60 mm diameter Petri dishes (approximately 1/3 volume of the plate). Store the solidified agar plates at 4 &#176;C.</li>
	</ol>
	</li>
</ol>
2. Protocol 1: Dissect the Gonadal Tissue of 17 and 25 dpf Larvae
<ol>
	<li>Add crushed ice into the tank to anesthetize 17 dpf larvae. Transfer the anesthetized larvae to a 100 mm chilled Petri dish with 30 mL cold Ringer&#39;s solution. Keep the fish incubated in the chilled Ringer&#39;s solution for at least 15 min to fully anesthetize the larvae.</li>
	<li>Transfer the larvae to a precooled agar plate with a small plastic spoon. Submerge the entire fish body in 10 mL chilled Ringer&#39;s solution and gently lay it on its side.</li>
	<li>Do the following operations under the vision field of 25X stereo microscope. Clamp the fish trunk with tweezers for stabilization. Rip the abdomen longitudinally from the anus to the heart with another pair of tweezers. Gently remove the skin and muscles on one side of the body to expose the internal organs.</li>
	<li>Remove the mass of organs ventral to the swim bladder carefully. Avoid damaging the gonad attached to the swim bladder.</li>
	<li>Cut off the connection between the swim bladder and anterior body. Pull out the entire swim bladder and gonadal tissue gently. 
	NOTE: In most cases, the gonadal tissue at 17 dpf contains surrounding epithelial tissue and protonephridium. They are not easily separated from each other, but at 25 dpf it can be easily separated. The gonad is also connected to the anus. A junction with left and right gonad connected to each other at the anus will be clearly visible.</li>
	<li>Use tweezers to carefully separate the gonadal tissue from the swim bladder and clean up the surrounding adipose tissues.</li>
	<li>Immediately transfer the isolated gonadal tissue to a prechilled 1.5 mL centrifuge tube containing 200 &#181;L Ringer&#39;s solution. Keep the tube on ice until all gonadal tissues are separated from the larvae.</li>
	<li>Dissect the gonads of 25 dpf larvae as described in steps 2.1 -&#160; 2.7.</li>
</ol>
3. Protocol 2: Analyze Gene Expression of the Isolated Gonadal Tissues
<ol>
	<li>Extract total RNA from the larval gonadal tissues.
	<ol>
		<li>Transfer the isolated gonadal tissues to a new RNase-free 1.5 mL tube and remove Ringer&#39;s solution. Add 100 &#181;L lysis solution. Vortex until the tissues are completely lysed.</li>
		<li>Perform the total RNA extraction procedure according to the manufacturer&#39;s instructions.</li>
		<li>Add 1/10 volume of 10x DNase I buffer and 1 &#181;L of DNase I to the RNA solution and mix gently. Incubate for 20 min at 37 &#176;C.</li>
		<li>Add 1/10 volume DNase inactivation reagent to the RNA solution. Incubate for 10 min at 70 &#176;C. Measure the concentration of the total RNA using a spectrophotometer. Store at -20 &#176;C.</li>
	</ol>
	</li>
	<li>Perform first-strand cDNA synthesis
	<ol>
		<li>Use an oligo(dT)-linker primer to perform first-strand cDNA synthesis following the manufacture&#39;s protocol. Add 1 to 2 &#181;g of RNA to a total reaction volume to 20 &#181;L.</li>
		<li>Incubate the reaction solution for 90 min at 45 &#176;C. Terminate the reaction by heating at 70 &#176;C for 5 min.</li>
		<li>Add 1 &#181;L RNase H to the cDNA solution to remove the residual RNA. Mix gently and centrifuge for 10 s at ~ 13,000 x g. Incubate for 20 min at 37 &#176;C. Add 20 &#181;l nuclease free water. Store at -70 &#176;C.</li>
	</ol>
	</li>
	<li>Perform fluorescent quantitative PCR
	<ol>
		<li>Perform qPCR on a cycler system with a fluorescent dye. Use the following PCR cycling conditions: 35 cycles at 95 &#176;C for 15 s, Tm-5 &#176;C for 15 s, 68 &#176;C for 30 s. Use primer sequences as follows: amh (fwd: GTGGATGGCAGCAGTACGAC; rev: GCGGAGAGGTGGAAGAGAGAATG), cyp19a1a (fwd: GTCCTGTTGTCTCCTACTGTCG; rev: CATTTGAGTTGAATATGATGCCCTG), nanos3 (fwd: GCTCGGTGTACGCCAAATCAACAT; rev: CCAAGTGAAAACACAACACCAGTGC), vasa (fwd: ATCGCATAGGAAGAACTGGACGCT; rev: CCAAGTGAAAACACAACACCAGTGC) and &#946;-actin (fwd: AGTGCGACGTGGACATCCGTA; rev: GCACTTCCTGTGGACGATGGA)19.</li>
	</ol>
	</li>
</ol>

<ol><li>Wilson, C. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Wild+sex+in+zebrafish%3A+loss+of+the+natural+sex+determinant+in+domesticated+strains%5BTitle%5D)+AND+%22Genetics%22%5BJournal%5D)">Wild sex in zebrafish: loss of the natural sex determinant in domesticated strains.</a> Genetics. 198 (3), 1291-1308 (2014).</li>
<li>Liew, W. C., Orban, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Zebrafish+sex%3A+a+complicated+affair%5BTitle%5D)+AND+%22Genomics%22%5BJournal%5D)">Zebrafish sex: a complicated affair.</a> Genomics. 13 (2), 172-187 (2014).</li>
<li>Orban, L., Sreenivasan, R., Olsson, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Long+and+winding+roads%3A+Testis+differentiation+in+zebrafish%5BTitle%5D)+AND+%22Mol.+Cell.+Endocrinol%22%5BJournal%5D)">Long and winding roads: Testis differentiation in zebrafish.</a> Mol. Cell. Endocrinol. 312 (1-2), 35-41 (2009).</li>
<li>Blaser, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Transition+from+non-motile+behaviour+to+directed+migration+during+early+PGC+development+in+zebrafish%5BTitle%5D)+AND+%22J.+Cell+Sci%22%5BJournal%5D)">Transition from non-motile behaviour to directed migration during early PGC development in zebrafish.</a> J. Cell Sci. 118, 4027-4038 (2005).</li>
<li>Wang, X. G., Orban, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Anti-M%C3%BCllerian+hormone+and+11+%CE%B2-hydroxylase+show+reciprocal+expression+to+that+of+aromatase+in+the+transforming+gonad+of+zebrafish+males%5BTitle%5D)+AND+%22Dev.+Dynam%22%5BJournal%5D)">Anti-Müllerian hormone and 11 β-hydroxylase show reciprocal expression to that of aromatase in the transforming gonad of zebrafish males.</a> Dev. Dynam. 236 (5), 1329-1338 (2007).</li>
<li>Siegfried, K. R., Nüsslein-Volhard, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Germ+line+control+of+female+sex+determination+in+zebrafish%5BTitle%5D)+AND+%22Dev.+Biol%22%5BJournal%5D)">Germ line control of female sex determination in zebrafish.</a> Dev. Biol. 324 (2), 277-287 (2008).</li>
<li>Uchida, D., Yamashita, M., Kitano, T., Iguchi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Oocyte+apoptosis+during+the+transition+from+ovary-like+tissue+to+testes+during+sex+differentiation+of+juvenile+zebrafish%5BTitle%5D)+AND+%22J.+Exp.+Biol%22%5BJournal%5D)">Oocyte apoptosis during the transition from ovary-like tissue to testes during sex differentiation of juvenile zebrafish.</a> J. Exp. Biol. 205 (Pt 6), 711-718 (2002).</li>
<li>Groh, K. J., Schönenberger, R., Eggen, R. I. L., Segner, H., Suter, M. J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Analysis+of+protein+expression+in+zebrafish+during+gonad+differentiation+by+targeted+proteomics%5BTitle%5D)+AND+%22Gen.+Comp.+Endocr%22%5BJournal%5D)">Analysis of protein expression in zebrafish during gonad differentiation by targeted proteomics.</a> Gen. Comp. Endocr. 193, 210-220 (2013).</li>
<li>Siegfried, K. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((In+search+of+determinants%3A+gene+expression+during+gonadal+sex+differentiation%5BTitle%5D)+AND+%22J.+Fish+Biol%22%5BJournal%5D)">In search of determinants: gene expression during gonadal sex differentiation.</a> J. Fish Biol. 76 (8), 1879-1902 (2010).</li>
<li>Small, C. M., Carney, G. E., Mo, Q., Vannucci, M., Jones, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+microarray+analysis+of+sex-+and+gonad-biased+gene+expression+in+the+zebrafish%3A+evidence+for+masculinization+of+the+transcriptome%5BTitle%5D)+AND+%22BMC+Genomics%22%5BJournal%5D)">A microarray analysis of sex- and gonad-biased gene expression in the zebrafish: evidence for masculinization of the transcriptome.</a> BMC Genomics. 10, 579(2009).</li>
<li>Chiang, E. F., Yan, Y. L., Guiguen, Y., Postlethwait, J., Chung, B. <a target="_blank" href="https://www.ncbi.nlm.nih.gov/pubmed/11264405">Two Cyp19 (P450 aromatase) genes on duplicated zebrafish chromosomes are expressed in ovary or brain.</a> Mol. Biol. Evol. 18 (4), 542-550 (2001).</li>
<li>Kishida, M., Callard, G. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Distinct+cytochrome+P450+aromatase+isoforms+in+zebrafish+%28Danio+rerio%29+brain+and+ovary+are+differentially+programmed+and+estrogen+regulated+during+early+development%5BTitle%5D)+AND+%22Endocrinology%22%5BJournal%5D)">Distinct cytochrome P450 aromatase isoforms in zebrafish (Danio rerio) brain and ovary are differentially programmed and estrogen regulated during early development.</a> Endocrinology. 142 (2), 740-750 (2001).</li>
<li>Rodríguez-Marí, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Characterization+and+expression+pattern+of+zebrafish+anti-M%C3%BCllerian+hormone+%28amh%29+relative+to+sox9a%2C+sox9b%2C+and+cyp19a1a%2C+during+gonad+development%5BTitle%5D)+AND+%22Gene+Expr.Patterns%22%5BJournal%5D)">Characterization and expression pattern of zebrafish anti-Müllerian hormone (amh) relative to sox9a, sox9b, and cyp19a1a, during gonad development.</a> Gene Expr.Patterns. 5 (5), 655-667 (2005).</li>
<li>Krovel, A. V., Olsen, L. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Expression+of+a+vas%3A%3AEGFP+transgene+in+primordial+germ+cells+of+the+zebrafish%5BTitle%5D)+AND+%22Mech+Dev%22%5BJournal%5D)">Expression of a vas::EGFP transgene in primordial germ cells of the zebrafish.</a> Mech Dev. 116 (1-2), 141-150 (2002).</li>
<li>Krovel, A. V., Olsen, L. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Sexual+dimorphic+expression+pattern+of+a+splice+variant+of+zebrafish+vasa+during+gonadal+development%5BTitle%5D)+AND+%22Dev.+Biol%22%5BJournal%5D)">Sexual dimorphic expression pattern of a splice variant of zebrafish vasa during gonadal development.</a> Dev. Biol. 271 (1), 190-197 (2004).</li>
<li>Tzung, K. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Early+depletion+of+primordial+germ+cells+in+zebrafish+promotes+testis+formation%5BTitle%5D)+AND+%22Stem+Cell+Reports%22%5BJournal%5D)">Early depletion of primordial germ cells in zebrafish promotes testis formation.</a> Stem Cell Reports. 4 (1), 61-73 (2015).</li>
<li>Hsiao, C., Tsai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Transgenic+zebrafish+with+fluorescent+germ+cell%3A+a+useful+tool+to+visualize+germ+cell+proliferation+and+juvenile+hermaphroditism+in+vivo%5BTitle%5D)+AND+%22Dev.+Biol%22%5BJournal%5D)">Transgenic zebrafish with fluorescent germ cell: a useful tool to visualize germ cell proliferation and juvenile hermaphroditism in vivo.</a> Dev. Biol. 262 (2), 313-323 (2003).</li>
<li>Jorgensen, A., Nielsen, J. E., Morthorst, J. E., Bjerregaard, P., Leffers, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Laser+capture+microdissection+of+gonads+from+juvenile+zebrafish%5BTitle%5D)+AND+%22Reprod+Biol+Endocrinol%22%5BJournal%5D)">Laser capture microdissection of gonads from juvenile zebrafish.</a> Reprod Biol Endocrinol. 7, 97(2009).</li>
<li>Chen, S., Zhang, H., Wang, F., Zhang, W., Peng, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((nr0b1+%28DAX1%29+mutation+in+zebrafish+causes+female-to-male+sex+reversal+through+abnormal+gonadal+proliferation+and+differentiation%5BTitle%5D)+AND+%22Mol.+Cell.+Endocrinol%22%5BJournal%5D)">nr0b1 (DAX1) mutation in zebrafish causes female-to-male sex reversal through abnormal gonadal proliferation and differentiation.</a> Mol. Cell. Endocrinol. 433, 105-116 (2016).</li>
<li>Westerfield, M. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aWesterfield%2C+M+%22The+Zebrafish+Book%3A+A+Guide+for+The+Laboratory+Use+of+Zebrafish+%28Danio+rerio%29%22">The Zebrafish Book: A Guide for The Laboratory Use of Zebrafish (Danio rerio)</a>. , Eugene: University of Oregon Press. University of Oregon. (2000).</li>
<li>Liew, W. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Polygenic+sex+determination+system+in+zebrafish%5BTitle%5D)+AND+%22PLoS+One%22%5BJournal%5D)">Polygenic sex determination system in zebrafish.</a> PLoS One. 7 (4), e34397(2012).</li>
<li>Parichy, D. M., Elizondo, M. R., Mills, M. G., Gordon, T. N., Engeszer, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Normal+table+of+postembryonic+zebrafish+development%3A+staging+by+externally+visible+anatomy+of+the+living+fish%5BTitle%5D)+AND+%22Dev+Dyn%22%5BJournal%5D)">Normal table of postembryonic zebrafish development: staging by externally visible anatomy of the living fish.</a> Dev Dyn. 238 (12), 2975-3015 (2009).</li>
<li>Gupta, T., Mullins, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Dissection+of+Organs+from+the+Adult+Zebrafish%5BTitle%5D)+AND+%22J.+Vis+Exp%22%5BJournal%5D)">Dissection of Organs from the Adult Zebrafish.</a> J. Vis Exp. (37), (2010).</li>
<li>Arnaout, R., Reischauer, S., Stainier, D. Y. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Recovery+of+Adult+Zebrafish+Hearts+for+High-throughput+Applications%5BTitle%5D)+AND+%22J.+Vis+Exp%22%5BJournal%5D)">Recovery of Adult Zebrafish Hearts for High-throughput Applications.</a> J. Vis Exp. (94), (2014).</li>
<li>Gerlach, G. F., Schrader, L. N., Wingert, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Dissection+of+the+Adult+Zebrafish+Kidney%5BTitle%5D)+AND+%22J.+Vis+Exp%22%5BJournal%5D)">Dissection of the Adult Zebrafish Kidney.</a> J. Vis Exp. (54), (2011).</li>
<li>Yoon, C., Kawakami, K., Hopkins, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Zebrafish+vasa+homologue+RNA+is+localized+to+the+cleavage+planes+of+2-+and+4-cell-stage+embryos+and+is+expressed+in+the+primordial+germ+cells%5BTitle%5D)+AND+%22Development%22%5BJournal%5D)">Zebrafish vasa homologue RNA is localized to the cleavage planes of 2- and 4-cell-stage embryos and is expressed in the primordial germ cells.</a> Development. 124 (16), 3157-3165 (1997).</li>
<li>Braat, A. K., Speksnijder, J. E., Zivkovic, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Germ+line+development+in+fishes%5BTitle%5D)+AND+%22Int.+J.+Dev.+Biol%22%5BJournal%5D)">Germ line development in fishes.</a> Int. J. Dev. Biol. 43 (7), 745-760 (1999).</li>
<li>Huang, H. Y., Ketting, R. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Isolation+of+zebrafish+gonads+for+RNA+isolation%5BTitle%5D)+AND+%22Methods+Mol+Biol%22%5BJournal%5D)">Isolation of zebrafish gonads for RNA isolation.</a> Methods Mol Biol. 1093, 183-194 (2014).</li>
</ol>

The authors declare that they have no competing financial interests.

The zebrafish has become a powerful model and is extensively used in development and disease-related research. The methods for isolation of organs in adult zebrafish such as brain, heart, gonad, and kidney, have been well documented23,24,25. Due to the small size and dynamic remodeling of the gonadal tissues in the larval zebrafish, isolation of gonadal tissue is a challenging task. Previous studies used whole dissected trunk ti...

The major female sex determinant in wild zebrafish chromosome 4 is lost or modified in the domesticated zebrafish (i.e. common lab strains)1. Instead, they have a polygenic sex determination system accompanied by environmental factors such as temperature, hypoxia, food availability and population density. The detailed mechanisms of zebrafish sex development are not fully understood. Fundamental questions such as when zebrafish sex determination occurs, what the primary sex determination signal(s) is/are, and which genes regulate the first step of gonad transformation remain to be answered2,3.
In the process of zebrafish sex development, several important stages have been recognized. In the early stage of development, starting from 4 hpf (hours post fertilization) primordial germ-cells (PGCs) undergo specification, migration to genital ridge and proliferation. PGC numbers and reciprocal interactions between germ cells and somatic cells are important for gonad differentiation4. At 13 dpf (days post fertilization), the gonads are in the undifferentiated stage. By 17 dpf, the gonads develop into bi-potential ovaries in both future females and males. The apoptosis-dependent transition from ovary to testis begin at 21 to 25 dpf and may continue for several weeks. By 35 dpf, the sex of the gonad has been determined and sex-specific gamete production is underway in both ovaries and testes5,6,7.
To date, diverse candidate genes and mechanisms of sex determination have been proposed. Proteomics and transcriptomic analysis have isolated many genes with sexually dimorphic expression and these genes have been utilized to study sex differentiation in zebrafish8,9,10. For example, in larval zebrafish, the cyp19a1a gene is specifically expressed in the ovary but not in the testis11,12. In addition, amh gene is weakly expressed in the ovarian follicle granulosa cells, but strongly in testis Sertoli cells13. In contrast, vasa gene is continuously expressed in the germ cells of both female and male zebrafish, making it a suitable gonad marker14,15.
Investigating gonadal gene expression levels is critical to understand the molecular mechanism of sex determination and differentiation especially in the bi-potential ovary stage3,9. However, the small size of larval zebrafish and correspondingly small gonads complicate the isolation of gonadal tissue for further molecular analysis. Previous studies used dissected whole trunk region between the opercula and anal pore16. This preparation, although containing gonads, consists of multiple tissues and organs. Alternatively, transgenic animals with gonad-specific GFP expression such as vasa: EGFP were used for gonadal tissue isolation via fluorescence activated cell sorting (FACS) and laser capture micro-dissection17,18. But their widespread application is limited. Here, we describe a simple procedure to isolate gonadal tissue from larval zebrafish at 17 dpf and 25 dpf. We demonstrate the position of the gonads with respect to other organs and isolate the morphologically intact gonads from the surrounding tissues. We further show the gonad-specific genes such as vasa and cyp19a1a are highly expressed in the isolated gonads compared with the trunk tissue through quantitative PCR (qPCR) analysis. The present protocol allows identification, isolation, RNA purification and amplification of gonadal specific genes from larval zebrafish, thereby enabling subsequent molecular analysis of gonadal tissue19.

<table><tbody><tr><td>Cell culture dish 100 mm</td><td>Corning</td><td>430167</td><td>For embryo incubation</td></tr><tr><td>20x EM</td><td></td><td></td><td>For a 1 L needed: add 17.5 g NaCl, 0.75 g KCl and 2.9 g CaCl&amp;#183;2H&lt;sub&gt;2&lt;/sub&gt;O; then add 0.41 g KH&lt;sub&gt;2&lt;/sub&gt;PO4, 0.412 g Na&lt;sub&gt;2&lt;/sub&gt;HPO4 anhydrous and 4.9 g MgSO&lt;sub&gt;4&lt;/sub&gt;&amp;#183;7H&lt;sub&gt;2&lt;/sub&gt;O.</td></tr><tr><td>1x EM</td><td></td><td></td><td>Dilute 20x EM in distilled water</td></tr><tr><td>AGAROSE G-10</td><td>Gene</td><td>121985</td><td>For preparing the 2% agar plates</td></tr><tr><td>Trizol Reagent</td><td>Invitrogen</td><td>15596-026</td><td>For RNA isolation</td></tr><tr><td>Meter glass</td><td>Shen Bo</td><td>250 ml</td><td>For preparing the 2% agar plates</td></tr><tr><td>Microwave Oven</td><td>Midea</td><td>M1-211A</td><td>For heating the AGAR</td></tr><tr><td>Tweezer DUMONT#5INOX</td><td>World Precision Instrument</td><td>500341</td><td>For dissection</td></tr><tr><td>Stereomicroscope</td><td>Motic</td><td>SMZ168</td><td>For dissection</td></tr><tr><td>Pure water equipment</td><td>Millipore</td><td></td><td></td></tr><tr><td>Ringer&amp;rsquo;s solution</td><td></td><td></td><td>For a 1 L needed: Add 6.78 g NaCl, 0.22 g KCl, 0.26 g CaCl&lt;sub&gt;2&lt;/sub&gt; and 1.19 g Hepes; then fill to 1 L; Adjust pH to 7.2. Sterilize by filtration and keep in an autoclaved clear polycarbonate container.</td></tr><tr><td>Transfer pipette</td><td>Samco</td><td>202, 204</td><td></td></tr><tr><td>Metal bath</td><td>QiLinbeier</td><td></td><td>Model GL-150</td></tr><tr><td>Microscope</td><td>Leica&amp;nbsp;</td><td>M205 FA</td><td>For photomicrograph</td></tr><tr><td>Centrifuge</td><td>Eppendorf</td><td>5417R</td><td></td></tr><tr><td>Micro Scale RNA Isolation Kit</td><td>Ambion</td><td>AM1931</td><td>For RNA isolation from gonad tissues</td></tr><tr><td>Dnase I</td><td>Sigma</td><td>AMPD1-1KT</td><td>For DNA digestion in the RNA solution</td></tr><tr><td>RevertAid First Strand cDNA Synthesis Kit</td><td>Thermo Scientific</td><td>#K1631</td><td>For first-strand cDNA synthesis</td></tr><tr><td>Rnase H</td><td>Thermo Scientific</td><td>#EN0202</td><td>For digesting the residual RNA in the cDNA solution.</td></tr><tr><td>SYBR Green Realtime PCR Master Mix</td><td>TOYOBO</td><td>QPK-201</td><td>This product is a Taq DNA polymerase-based 2x master mix for real-time PCR and&amp;nbsp; applicable for intercalation assay with SYBR Green I.</td></tr><tr><td>Spectrophotometer</td><td>Ne Drop</td><td>OD-2000+</td><td>Measuring the concentration of the total RNA</td></tr><tr><td>Mastercycler</td><td>Eppendorf</td><td>AG 22331 Hamburg</td><td>gene expression profiling</td></tr></tbody></table>

dissection of larval zebrafish gonadal tissue

Dissection of Larval Zebrafish Gonadal Tissue

Although wild zebrafish possess a ZZ/ZW sex-determination system, domesticated zebrafish have lost the sex chromosome. They utilize a polygenic sex determination system, where several genes distributed throughout the genome collectively determine the sex identities of individual fish. Currently, the genes involved in regulating gonad development and how they work remain elusive. Normally, isolating gonadal tissue is the first step to examine the sex developmental processes. Here, we present a procedure to isolate gonadal tissue from 17 dpf (days post fertilization) and 25 dpf zebrafish larvae. The isolated gonadal tissue may be subsequently examined by morphology and gene expression profiling.

Dissections of the gonads were performed on AB strain larval zebrafish. Figure 1 shows typical gonadal tissue of larval zebrafish at 17 dpf and 25 dpf. Firstly, the skin and muscles of one side of the abdomen is cut to expose the internal organs. After removing the mass of internal organs, the swim bladder together with the gonad remain in the trunk. The gonad was attached to the ventral side of swim bladder (arrow in Figure 1B<s...

Here, we present a protocol for isolating gonadal tissue of larval zebrafish, which will facilitate investigations of zebrafish sex differentiation and maintenance.

Although wild zebrafish possess a ZZ/ZW sex-determination system, domesticated zebrafish have lost the sex chromosome. They utilize a polygenic sex ...

The overall goal of this procedure is to isolate gonadal tissue from larval zebrafish and analyze the molecular properties of the isolated tissue This method that can help answer key questions in the zebrafish's sex development field. Such as the conservation of genes in regulating gonad development and the molecular underpinnings of the zebrafish sex development. The main advantage of this technique is that gonadal tissues from zebrafish larvae as early as 17 days post fertilization can be dissected for cellular and the molecular biological status.Generally, individuals new to this method will struggle because of the small size and the dynamic remodel of the gonadal tissues in the larval zebrafish. To prepare for gondal disection, transfer two male and two female adult zebrafish to either side of a divided crossing tank. The following morning refresh the tank water and remove the barrier to initiate mating.One to two hours after fertilization collect and transfer about forty eggs into a 100 millimeter plate with 40 milliliters of embryo medium, or EM.Incubate the embryos at 28.5 degrees Celsius for four days, refreshing the EM twice per day. Following the incubation transfer the larvae to one liter tanks. After five days post-fertilization, or DPF, feed live rotifers to the fish.When the larvae reach ten DPF feed the fish live brine shrimp. Then, at 14 DPF, transfer the fish into a recirculating water system. Raise the larval zebra fish to 17 or 25 DPF.Then measure the body length of the larvae at 17 and 25 DPF. Prepare two percent agar plates for dissection by adding four grams of agar to 200 milliliters of sterile water. Heat the mixture in a microwave until it turns transparent.Cool the agar for 15 minutes, then pour it into 60 millimeter diameter petri dishes. Store the solidified agar plates at four degrees Celsius. To anesthetized 17 DPF larvae add crushed ice into the tank.Transfer the anesthetized larvae to a 100 millimeter chilled petri dish with 30 milliliters of cold Ringer's solution. Incubate the fish in the chilled Ringer's solution for at least 15 minutes to fully anesthetize the larvae. With a plastic spoon transfer the larvae to a pre-cooled agar plate.Submerge the entire fish body in ten milliliters of chilled Ringer's Solution and gently lay it on it's side. Under a stereomicroscope, at 25x magnification, use tweezers to clamp the fish trunk for stabilization. Then, with another pair of tweezers, rip the abdomen longitudinally from the anus to the heart.Next, gently remove the skin and muscles on one side of the body to expose the internal organs. Then, carefully remove the massive organs ventral to the swim blader. Avoid damaging the gonad attached to the swim bladder.Cut the connection between the swim bladder and interior body. Then, carefully pull out the entire swim bladder and the gonadal tissue. With tweezers, carefully separate the gondal tissue from the swim bladder.And clean up the surrounding adipose tissue. Immediately transfer the isolated gonadal tissue to a pre-chilled, 1.5 milliliters centrifuge tube, containing 200 microliters of Ringer's Solution. Keep the tube on ice until all gonadal tissues are separated from the larvae.To extract total RNA from larval gonadal tissue transfer the isolated gonads to a new RNase free 1.5 milliliter tube and remove the Ringer's Solution. Then, add 100 microliters of lysis solution. And vortex the tube until the tissue is completely lysed.After performing a total RNA extraction, according to the manufacturer's instructions, add one tenth the volume of DNase I buffer, and one microliter of DNase I to the RNA solution, and gently mix the contents of the tube. Incubate the sample at 37 degrees Celsius for 20 minutes. Next, add one tenth the volume of DNase inactivation reagent to the RNA solution.Incubate the sample at 70 degrees Celsius for ten minutes. Then, use a spectrophotometer to measure the concentration of the total RNA. To perform first strand cDNA synthesis use an oligo-dT linker primer and one to two micrograms of RNA to perform first strand cDNA synthesis, following the manufacturer's protocol.Incubate the reaction at 45 degrees Celsius for 90 minutes. Then, terminate the reaction by heating the sample at 70 degrees Celsius for five minutes. Add one microliter on RNase H to the cDNA solution to remove the residual RNA.Gently mix the contents of the tube and centerfuge the sample at approximately 13, 000 times G for ten seconds. Incubate the tube at 37 degrees Celsius for 20 minutes. Then, add 20 microliters of neucleous free water to the sample.And store the cDNA at negative 70 degrees Celsius. Finally, use fluorescent dye to perform QCPR using the condition and primers listed in the text protocol. This figure shows typical gonadal tissue of lavaral zebrafish at 17 DPF.The gonad is attached to the ventral side of the swim bladder, as seen here. At 17 DPF, the larvae contain the left and the right gonads, which are translucent. In most cases the gonads are surrounded by epithelial tissue and protonephridium.At 25 DPF, the gonad is often wrapped by adipose tissue, and big or small gonads may be observed. Finally, to analyze the molecular properties of the isolated gonadal tissue, expression levels of the gonadal markers amh, cyp19a1a, nanos3, and vasa were examined by QPCR. The results show significant increases in marker genes in gonad tissue compared to controlled tissue.Once mastered this technique can be done in an hour if it's performed properly. While attempting this procedure it's important to remember to provide consistent rearing conditions for larvae zebrafish, as it's critical to yield expected results. After it's development, this technique paved the way for researches in the field of sex development to explore sex determining mechanisms of zebra fish.After watching this video you should have a good understanding of how to isolate gonadal tissues from larval zebra fish.

dissection-of-larval-zebrafish-gonadal-tissue

Research

JoVE Journal

Developmental Biology

This protocol describes a procedure for identifying and dissecting organs from the adult zebrafish.

Dissection of Organs from the Adult Zebrafish

This article describes an approach to microdissect zebrafish retinas with and without retinal pigment epithelium attached, from one to three days postfertilization embryos.

Microdissection of Zebrafish Embryonic Eye Tissues

A clear, standardized method for dissection and isolation of the zebrafish heart at multiple developmental stages are described. Annotation and quantification techniques are also discussed.

Heart Dissection in Larval, Juvenile and Adult Zebrafish, Danio rerio

We present a novel method for microgavage of larval zebrafish utilizing standard embryo microinjection and stereomicroscopy equipment. We demonstrate that microgavage is a safe and efficient technique useful for delivering controlled amounts of diverse materials specifically into the larval zebrafish intestinal lumen.

Microgavage of Zebrafish Larvae

After spinal transection, adult zebrafish have functional recovery by six weeks post-injury. To take advantage of larval transparency and faster recovery, we present a method for transecting the larval spinal cord. After transection, we observe sensory recovery beginning at 2 days post-injury, and C-bend movement by 3 days post-injury.

Spinal Cord Transection in the Larval Zebrafish

Here, we present a standardized series of protocols to observe the superior ocular sulcus, a recently-identified, evolutionarily-conserved structure in the vertebrate eye. Using zebrafish larvae, we demonstrate techniques necessary to identify factors that contribute to the formation and closure of the superior ocular sulcus.

Visualization of the Superior Ocular Sulcus during Danio rerio Embryogenesis

Here, we provide a dissection protocol required to live-image the late embryonic Drosophila male gonad. This protocol will permit observation of dynamic cellular processes under normal conditions or after transgenic or pharmacological manipulation.

Dissection and Live-Imaging of the Late Embryonic Drosophila Gonad

This protocol describes the procedure for removing the ventral lobe of the liver in adult zebrafish to enable the study of liver regeneration.

Partial Hepatectomy in Adult Zebrafish

The article explains how to surgically remove eyes from living zebrafish larvae as the first step toward investigating how retinal input influences optic tectum growth and development. In addition, the article provides information about larval anesthetization, fixation, and brain dissection, followed by immunohistochemistry and confocal imaging.

Eye Removal in Living Zebrafish Larvae to Examine Innervation-dependent Growth and Development of the Visual System

This is a commonly used method for C. elegans gonad dissection followed by freeze crack, which produces germline samples for immunofluorescence via antibody staining, or for simple DAPI staining to visualize DNA. This protocol has been successful for undergraduates in a research lab and in a course-based undergraduate research experience.

C. elegans Gonad Dissection and Freeze Crack for Immunofluorescence and DAPI Staining

Here, we describe a method for gut isolation from zebrafish larvae at 5 days post fertilization, for single-cell RNA sequencing analysis.

Gut Isolation from Zebrafish Larvae for Single-cell RNA Sequencing

Learn to dissect gonadal tissue from larval zebrafish as early as 17 days post-fertilization. This method enables molecular analysis of sex differentiation and developmental biology research.

Dissection of Larval Zebrafish Gonadal Tissue

Explore More Videos