Name: Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice. (Video) | JoVE Journal
Uploaded: 2017-07-14T15:00:00.000+00:00
Duration: 8 min 4 s
Description: Learn to detect N-acetylneuraminic acid and N-glycolylneuraminic acid in mouse liver and milk using HPLC analysis. This method enables quantification of sialic acids in CMAH knock-out mice.

ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

This work was supported in part by the Natural Science Foundation of China (grant numbers 31471703, A0201300537 and 31671854 to J.V. and L.L.), and the 100 Foreign Talents Plan (grant number JSB2014012 to J.V.).

Procedures involving animal subjects have been approved by the Ethical Committee of the Experimental Animal Center of Nanjing Agricultural University in accordance to the National Guidelines for Experimental Animal Welfare (Ministry of Science and Technology, PR of China, 2006) with the animals housed in a SPF facility (Permission ID: SYXK-J-2011-0037).
1. Cmah Knock-out Mouse Model
<ol>
	<li>Use wild-type C57Bl/6 mice from the Comparative Medicine Centre of Yangzhou University (China). 
	NOTE: Cmah knock-out mice were generated based on the information provided from previous Cmah knock-out studies17,19 and obtained commercially using a CRISPR/Cas920 strategy by removing 92 base pairs from exon 6 of the Cmah gene, which is also deleted in the human CMAH gene19. Positive F0-mice (2 individuals) were crossed with wild type mice to obtain heterozygous F1-mice. After crossing heterozygous F1-mice (5 individuals), homozygous Cmah knock-out F2-mice could be successfully obtained (3 individuals).</li>
	<li>Perform genotyping of mice using genomic DNA according to the method shown by Zangala21 using a commercial DNA purification kit.
	<ol>
		<li>Amplify a corresponding DNA fragment of the Cmah gene by using commercial DNA polymerase and the primer pair 5&#39;gaaagggctcggctctgtatgaa3&#39; and 5&#39;tttaaaatgtcccgggtgagaagc3&#39;. Perform the gene amplification using 34 PCR cycles consisting of denaturation at 94 &#176;C for 40 s, annealing at 63 &#176;C for 40 s, and elongation at 72 &#176;C for 1 min.</li>
		<li>Visualize PCR products on an 1% agarose gel. One should observe a single band (0.5 kb) for the wild-type individual, a double band (0.4 and 0.5 kb) for the heterozygous knock-out individual, and a single band (0.4 kb) for the homozygous knock-out individual.</li>
	</ol>
	</li>
</ol>
2. Sample Collection
<ol>
	<li>Collect mouse milk using the protocol described by Willingham et al.22.</li>
	<li>Collect mouse liver tissue using the protocol described by Gon&#231;alves et al.23 and store samples at -80 &#176;C.</li>
</ol>
3. Isolation of Sialic Acids from Milk
<ol>
	<li>Prepare 100 mL of a 2 M acetic acid solution by adding 12 mL of glacial acetic acid into 88 mL of distilled H2O.</li>
	<li>Transfer 50 &#181;L of milk into a 1.5 mL centrifuge tube and add 1.2 mL of the prepared aqueous acetic acid solution.</li>
	<li>Incubate the suspension for 4 h at 80 &#176;C and centrifuge the sample at 14,000 x g for 10 min.</li>
	<li>Transfer the top 1,000 &#181;L of the supernatant into a fresh 1.5 mL centrifuge tube and remove the solvent by centrifugal evaporation at room temperature to complete dryness (depending on the attached vacuum pump this will take 4 - 20 h). Re-dissolve the sample in 500 &#181;L of distilled H2O.</li>
	<li>Prepare a micro-anion exchange column. This step will specifically enrich anionic compounds and remove cationic and neutral compounds from the milk and liver samples, and therefore increases the selectivity of the fluorogenic OPD labeling agent for sialic acid derivatization.
	<ol>
		<li>Transfer for each sample 200 mg of the anion exchange resin (Dowex 1X8) into empty 3 mL column tubes with an attached stopcock.</li>
		<li>Add 2 mL of the aqueous acetic acid solution prepared in step 3.1 to replace the chloride ions in the resin with acetate ions. Close the stopcock as soon as the solvent reaches the top of the resin.</li>
		<li>Gently add 2 mL of distilled H2O, open the stopcock and stop the flow as soon as most of the solvent reaches the top of the resin. Make sure that the resin is always covered with solvent.</li>
		<li>Wash the resin column two more times with 2 mL of distilled H2O for removing the excess acetate.</li>
	</ol>
	</li>
	<li>Transfer the resulting 500 &#181;L of sample solvent from step 3.4. onto the resin column and discard the flow-through. Gently wash the resin with 2 mL of distilled H2O. Elute the sample anions from the resin using 1 mL of a 50 mM ammonium acetate solution (386 mg of ammonium acetate dissolved in 100 mL of distilled H2O) into a 1.5 mL centrifuge tube. Remove the solvent by centrifugal evaporation at room temperature to dryness. 
	NOTE: Dry samples can be stored at 4-6 &#176;C for up to 12 months.</li>
</ol>
4. Isolation of Sialic Acids from Liver Tissue
<ol>
	<li>Gently thaw 20 - 50 mg of mouse liver and transfer it into a Dounce tissue grinder (1 mL or 2 mL of volume). Add 1.2 mL of the aqueous acetic acid solution prepared in step 3.1 and homogenize the tissue by gentle shearing for 10 s. Transfer the resulting suspension into a 1.5 mL centrifuge tube.</li>
	<li>Follow steps 3.3. to 3.6. 
	NOTE: Dry samples can be stored at 4-6 &#176;C for up to 12 months.</li>
</ol>
5. Preparation of a Mixed Sialic Acid Standard
<ol>
	<li>Weigh in between 5 - 8 mg of N-acetylneuraminic acid on an analytical balance into a 1.5 mL centrifuge tube. Note the exact weight and add 164 &#181;L of distilled H2O for every mg (i.e. if the weight of Neu5Ac is 7.2 mg then add 7.2 x 164 = 1, 181 &#181;L of distilled H2O). This results in a 20 mM Neu5Ac stock solution which can be stored at -20 &#176;C for up to 12 months.</li>
	<li>Obtain N-glycolylneuraminic acid at smaller quantities at a moderate price such as in 1 mg aliquots. Add 154 &#181;L of distilled H2O directly to the compound in order to obtain a ~20 mM Neu5Gc stock solution. Transfer the solution into a 1.5 mL centrifuge tube. This solution can be stored at -20 &#176;C for up to 12 months.</li>
	<li>Combine 5 &#181;L from each stock solution from step 5.1 and 5.2 into a fresh 1.5 mL centrifuge tube and remove the solvent by centrifugal evaporation at room temperature to dryness. 
	NOTE: The mixed sialic acid standard can be stored at 4 - 6 &#176;C for up to 12 months.</li>
</ol>
6. Fluorescence Derivatization of Sialic Acids
<ol>
	<li>Prepare 10 mL of OPD-solution, consisting of 100 mg of o-phenylenediamine and 208 mg of sodium hydrogen sulfite in 10 mL of distilled H2O.</li>
	<li>Add 20 &#181;L of OPD-solution to the sialic acid samples derived from mouse milk (step 3), mouse liver (step 4), or the mixed sialic acid standard (step 5). Vortex vigorously for 30 s and incubate samples for 4 h at 80 &#176;C in the dark (i.e. wrap the microtubes in aluminum foil).</li>
	<li>Let the samples cool down for 5 min, add 80 &#181;L of distilled H2O and centrifuge the tubes at 14,000 x g for 1 min.</li>
	<li>Transfer 80 &#181;L from the supernatant into a 300 &#181;L high-recovery HPLC vial. The derivatized sialic acid samples can be stored at 4 - 6 &#176;C for up to one week.</li>
</ol>
7. HPLC Analysis of Sialic Acid Derivatives
<ol>
	<li>Analyze the samples using a standard HPLC system connected to an online fluorescence detector.</li>
	<li>Use a reversed phase C18 column with the standard dimensions of 250 mm length and 4.6 mm diameter for the analysis.</li>
	<li>Prepare solvent A by diluting 200 mL of stock solution with 800 mL of LCMS-grade water (LCMS - liquid chromatography mass-spectrometry). The stock solution itself can be prepared as follows:
	<ol>
		<li>Add 46 g of formic acid to 800 mL of LCMS-grade H2O.</li>
		<li>Adjust the pH to 4.5 by dropwise adding ammonium hydroxide solution (puriss. p.a.).</li>
		<li>Transfer the solvent to a measuring cylinder and fill up to 1,000 mL with LCMS-grade H2O. This stock solution can be stored at 4 - 6 &#176;C for up to 3 months.</li>
	</ol>
	</li>
	<li>For solvent B, use LCMS-grade acetonitrile.</li>
	<li>Separate the sialic acids derivatives at a 1 mL/min flow rate with the following gradient elution:
	<ol>
		<li>Start by adding 10% of solvent B mixed to solvent A.</li>
		<li>From 0 min to 15 min, gradually increase the proportion of solvent B with a linear gradient to 60%.</li>
		<li>From 15 min to 16 min, rapidly increase the proportion of solvent B with a linear gradient from 60% to 90%. This initiates the washing of the HPLC column.</li>
		<li>To further wash the HPLC column, keep the level of solvent B at 90% between 16 min and 18 min before gradually reducing the level of solvent B again to 10% between 18 min and 19 min.</li>
		<li>Re-equilibrate HPLC column to the starting conditions of 10% B between 19 and 24 min.</li>
	</ol>
	</li>
	<li>Inject 50 &#181;L of sample into the HPLC system.</li>
	<li>Monitor eluents using the fluorescence detector excitation/emission wavelengths of 373/448 nm, and the derivatized sialic acids can be expected at the approximate retention times of 9 min (for Neu5Gc-OPD) and 10 min (for Neu5Ac-OPD).</li>
	<li>Calculate the relative amount of Neu5Gc (FNeu5Gc) from the fluorescence peak areas of the Neu5Ac (ANeu5Ac) and Neu5Gc (ANeu5Gc) as follows: FNeu5Gc [%] = 100&#215;ANeu5Gc/(ANeu5Ac+ANeu5Gc). In case of the milk and liver samples from the homozygous Cmah knock-out mouse FNeu5Gc should be 0%, whereas the values for FNeu5Gc of heterozygous and wild-type mice may vary widely depending on mouse age and tissue type (between 2% and &#62;90%) with expected error margins of &#177;12%.</li>
</ol>

<ol><li>Lamari, F. N., Karamanos, N. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Separation+methods+for+sialic+acids+and+critical+evaluation+of+their+biologic+relevance%5BTitle%5D)+AND+%22J+Chromatogr+B+Analyt+Technol+Biomed+Life+Sci%22%5BJournal%5D)">Separation methods for sialic acids and critical evaluation of their biologic relevance.</a> J Chromatogr B Analyt Technol Biomed Life Sci. 781 (1-2), 3-19 (2002).</li>
<li>Irie, A., Koyama, S., Kozutsumi, Y., Kawasaki, T., Suzuki, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+molecular+basis+for+the+absence+of+N-glycolylneuraminic+acid+in+humans%5BTitle%5D)+AND+%22J+Biol+Chem%22%5BJournal%5D)">The molecular basis for the absence of N-glycolylneuraminic acid in humans.</a> J Biol Chem. 273 (25), 15866-15871 (1998).</li>
<li>Chou, H. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+mutation+in+human+CMP-sialic+acid+hydroxylase+occurred+after+the+Homo-Pan+divergence%5BTitle%5D)+AND+%22Proc+Natl+Acad+Sci+U+S+A%22%5BJournal%5D)">A mutation in human CMP-sialic acid hydroxylase occurred after the Homo-Pan divergence.</a> Proc Natl Acad Sci U S A. 95 (20), 11751-11756 (1998).</li>
<li>Rehan, I. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Large-Scale+Glycomics+of+Livestock%3A+Discovery+of+Highly+Sensitive+Serum+Biomarkers+Indicating+an+Environmental+Stress+Affecting+Immune+Responses+and+Productivity+of+Holstein+Dairy+Cows%5BTitle%5D)+AND+%22J+Agric+Food+Chem%22%5BJournal%5D)">Large-Scale Glycomics of Livestock: Discovery of Highly Sensitive Serum Biomarkers Indicating an Environmental Stress Affecting Immune Responses and Productivity of Holstein Dairy Cows.</a> J Agric Food Chem. 63 (48), 10578-10590 (2015).</li>
<li>Wang, B., McVeagh, P., Petocz, P., Brand-Miller, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Brain+ganglioside+and+glycoprotein+sialic+acid+in+breastfed+compared+with+formula-fed+infants%5BTitle%5D)+AND+%22Am+J+Clin+Nutr%22%5BJournal%5D)">Brain ganglioside and glycoprotein sialic acid in breastfed compared with formula-fed infants.</a> Am J Clin Nutr. 78 (5), 1024-1029 (2003).</li>
<li>Yao, H. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Quantification+of+sialic+acids+in+red+meat+by+UPLC-FLD+using+indoxylsialosides+as+internal+standards%5BTitle%5D)+AND+%22Glycoconj+J%22%5BJournal%5D)">Quantification of sialic acids in red meat by UPLC-FLD using indoxylsialosides as internal standards.</a> Glycoconj J. 33 (2), 219-226 (2016).</li>
<li>Nguyen, D. H., Tangvoranuntakul, P., Varki, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Effects+of+natural+human+antibodies+against+a+nonhuman+sialic+acid+that+metabolically+incorporates+into+activated+and+malignant+immune+cells%5BTitle%5D)+AND+%22J+Immunol%22%5BJournal%5D)">Effects of natural human antibodies against a nonhuman sialic acid that metabolically incorporates into activated and malignant immune cells.</a> J Immunol. 175 (1), 228-236 (2005).</li>
<li>Byres, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Incorporation+of+a+non-human+glycan+mediates+human+susceptibility+to+a+bacterial+toxin%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">Incorporation of a non-human glycan mediates human susceptibility to a bacterial toxin.</a> Nature. 456 (7222), 648-652 (2008).</li>
<li>Hedlund, M., Padler-Karavani, V., Varki, N. M., Varki, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Evidence+for+a+human-specific+mechanism+for+diet+and+antibody-mediated+inflammation+in+carcinoma+progression%5BTitle%5D)+AND+%22Proc+Natl+Acad+Sci+U+S+A%22%5BJournal%5D)">Evidence for a human-specific mechanism for diet and antibody-mediated inflammation in carcinoma progression.</a> Proc Natl Acad Sci U S A. 105 (48), 18936-18941 (2008).</li>
<li>Tangvoranuntakul, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Human+uptake+and+incorporation+of+an+immunogenic+nonhuman+dietary+sialic+acid%5BTitle%5D)+AND+%22Proc+Natl+Acad+Sci+U+S+A%22%5BJournal%5D)">Human uptake and incorporation of an immunogenic nonhuman dietary sialic acid.</a> Proc Natl Acad Sci U S A. 100 (21), 12045-12050 (2003).</li>
<li>Svennerholm, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Quantitative+estimation+of+sialic+acids.+II.+A+colorimetric+resorcinol-hydrochloric+acid+method%5BTitle%5D)+AND+%22Biochim+Biophys+Acta%22%5BJournal%5D)">Quantitative estimation of sialic acids. II. A colorimetric resorcinol-hydrochloric acid method.</a> Biochim Biophys Acta. 24 (3), 604-611 (1957).</li>
<li>Warren, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+thiobarbituric+acid+assay+of+sialic+acids%5BTitle%5D)+AND+%22J+Biol+Chem%22%5BJournal%5D)">The thiobarbituric acid assay of sialic acids.</a> J Biol Chem. 234 (8), 1971-1975 (1959).</li>
<li>Kakehi, K., Maeda, K., Teramae, M., Honda, S., Takai, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Analysis+of+sialic+acids+by+gas+chromatography+of+the+mannosamine+derivatives+released+by+the+action+of+N-acetylneuraminate+lyase%5BTitle%5D)+AND+%22J+Chromatogr%22%5BJournal%5D)">Analysis of sialic acids by gas chromatography of the mannosamine derivatives released by the action of N-acetylneuraminate lyase.</a> J Chromatogr. 272 (1), 1-8 (1983).</li>
<li>Wheeler, S. F., Domann, P., Harvey, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Derivatization+of+sialic+acids+for+stabilization+in+matrix-assisted+laser+desorption%2Fionization+mass+spectrometry+and+concomitant+differentiation+of+alpha%282+--%3E+3%29-+and+alpha%282+--%3E+6%29-isomers%5BTitle%5D)+AND+%22Rapid+Commun+Mass+Spectrom%22%5BJournal%5D)">Derivatization of sialic acids for stabilization in matrix-assisted laser desorption/ionization mass spectrometry and concomitant differentiation of alpha(2 --> 3)- and alpha(2 --> 6)-isomers.</a> Rapid Commun Mass Spectrom. 23 (2), 303-312 (2009).</li>
<li>Hurum, D. C., Rohrer, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Determination+of+sialic+acids+in+infant+formula+by+chromatographic+methods%3A+a+comparison+of+high-performance+anion-exchange+chromatography+with+pulsed+amperometric+detection+and+ultra-high-performance+liquid+chromatography+methods%5BTitle%5D)+AND+%22J+Dairy+Sci%22%5BJournal%5D)">Determination of sialic acids in infant formula by chromatographic methods: a comparison of high-performance anion-exchange chromatography with pulsed amperometric detection and ultra-high-performance liquid chromatography methods.</a> J Dairy Sci. 95 (3), 1152-1161 (2012).</li>
<li>Ito, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((An+improved+fluorometric+high-performance+liquid+chromatography+method+for+sialic+acid+determination%3A+an+internal+standard+method+and+its+application+to+sialic+acid+analysis+of+human+apolipoprotein%5BTitle%5D)+AND+%22E.+Anal+Biochem%22%5BJournal%5D)">An improved fluorometric high-performance liquid chromatography method for sialic acid determination: an internal standard method and its application to sialic acid analysis of human apolipoprotein.</a> E. Anal Biochem. 300 (2), 260-266 (2002).</li>
<li>Naito, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Germinal+Center+Marker+GL7+Probes+Activation-Dependent+Repression+of+N-Glycolylneuraminic+Acid%2C+a+Sialic+Acid+Species+Involved+in+the+Negative+Modulation+of+B-Cell+Activation%5BTitle%5D)+AND+%22Mol+Cell+Biol%22%5BJournal%5D)">Germinal Center Marker GL7 Probes Activation-Dependent Repression of N-Glycolylneuraminic Acid, a Sialic Acid Species Involved in the Negative Modulation of B-Cell Activation.</a> Mol Cell Biol. 27 (8), 3008-3022 (2007).</li>
<li>Manzi, A. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((High-pressure+liquid+chromatography+of+sialic+acids+on+a+pellicular+resin+anion-exchange+column+with+pulsed+amperometric+detection%3A+a+comparison+with+six+other+systems%5BTitle%5D)+AND+%22Anal+Biochem%22%5BJournal%5D)">High-pressure liquid chromatography of sialic acids on a pellicular resin anion-exchange column with pulsed amperometric detection: a comparison with six other systems.</a> Anal Biochem. 188 (1), 20-32 (1990).</li>
<li>Hedlund, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((N-glycolylneuraminic+acid+deficiency+in+mice%3A+implications+for+human+biology+and+evolution%5BTitle%5D)+AND+%22Mol+Cell+Biol%22%5BJournal%5D)">N-glycolylneuraminic acid deficiency in mice: implications for human biology and evolution.</a> Mol Cell Biol. 27 (12), 4340-4346 (2007).</li>
<li>Platt, R. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CRISPR-Cas9+knockin+mice+for+genome+editing+and+cancer+modeling%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">CRISPR-Cas9 knockin mice for genome editing and cancer modeling.</a> Cell. 159 (2), 440-455 (2014).</li>
<li>Zangala, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Isolation+of+genomic+DNA+from+mouse+tails%5BTitle%5D)+AND+%22J+Vis+Exp%22%5BJournal%5D)">Isolation of genomic DNA from mouse tails.</a> J Vis Exp. (6), e246(2007).</li>
<li>Willingham, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Milk+collection+methods+for+mice+and+Reeves%27+muntjac+deer%5BTitle%5D)+AND+%22J+Vis+Exp%22%5BJournal%5D)">Milk collection methods for mice and Reeves' muntjac deer.</a> J Vis Exp. (89), (2014).</li>
<li>Goncalves, L. A., Vigario, A. M., Penha-Goncalves, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Improved+isolation+of+murine+hepatocytes+for+in+vitro+malaria+liver+stage+studies%5BTitle%5D)+AND+%22Malar+J%22%5BJournal%5D)">Improved isolation of murine hepatocytes for in vitro malaria liver stage studies.</a> Malar J. 6, 169(2007).</li>
</ol>

The authors have nothing to disclose.

The herein presented protocol allows the phenotypical assessment of homozygous Cmah knock-out mice by analyzing and quantifying the relative amounts of Neu5Gc of milk and liver samples. The analysis was performed using a standard HPLC setup with fluorescence detection. The most critical step of this procedure is the preparation of the anion exchange columns and performing the anion exchange chromatography; to settle the resin properly and to collect the right washing and elution fractions takes a bit of practice...

N-acetylneuraminic acid (Neu5Ac) and N-glycolylneuraminic acid (Neu5Gc) are the most common sialic acids in most mammals1. Although able of synthesizing Neu5Ac endogenously, humans are not capable of producing Neu5Gc due to a primary exon deletion on the CMAH gene encoding for a CMP-Neu5Ac hydroxylase2,3. However, animal-based food products can be dietary sources of Neu5Gc4,5,6, leading to the production of anti-Neu5Gc antibodies and therefore trigger an immune response towards Neu5Gc7. This dietary effect of Neu5Gc is suspected to contribute to chronic inflammation and various other diseases8,9,10. In order to comprehensively understand the effects of Neu5Gc in humans, an animal model for the systematic study of the effects of foodborne sialic acids is highly desirable. Although protocols based on polymerase chain reaction (PCR) for analyzing of knock-out mice are well established and a convenient way for the genotypical assessment, the functional analysis of phenotype on the metabolic level requires more specific analysis methods. The phenotype of a Cmah knock-out mouse model can be assessed by isolating and analyzing the composition of sialic acids in liver or milk samples. Several methods for the detection of sialic acids in animal tissues have been reported previously: reacting sialic acids with resorcinol11 or thiobarbituric acid12 result in the formation of a chromophoric product and can be simply analyzed using a platereader based setup, but only the total sialic acid content may be determined. Alternatively, the analysis of sialic acids was also described using gas chromatography13, MALDI-ToF mass spectrometry14 or amperometric methods15. However, the most commonly applied sialic acid analysis methods are based on hydrolytic release, followed by fluorescence derivatization and subsequent high performance liquid chromatography16,17,18.

<table><tbody><tr><td>&lt;strong&gt;Chemicals:&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>N-acetylneuraminic acid</td><td>Sigma</td><td>A0812</td><td></td></tr><tr><td>N-glycolylneuraminic acid</td><td>Sigma</td><td>50644</td><td>1 mg aliquot should be sufficient</td></tr><tr><td>o-Phenylenediamine</td><td>Sigma</td><td>694975</td><td></td></tr><tr><td>Sodium hydrogen sulfite</td><td>J&amp;amp;K Scientific Ltd</td><td>75234</td><td></td></tr><tr><td>&lt;strong&gt;Tools/Materials:&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>3 mL SPE tubes</td><td>Supelco</td><td>Sigma 57024</td><td>empty solid phase extraction columns</td></tr><tr><td>Luer stopcock</td><td>Sigma</td><td>S7396</td><td>to stop the flow of the SPE tube</td></tr><tr><td>Dowex 1X8</td><td>Dow Chemicals</td><td>Sigma 44340</td><td>200 - 400 mesh</td></tr><tr><td>Dounce tissue grinder</td><td>Sigma</td><td>D8938</td><td>tight fit</td></tr><tr><td>&lt;strong&gt;HPLC Analysis:&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>High-recovery HPLC vial</td><td>Agilent Technologies</td><td>#5188-2788</td><td></td></tr><tr><td>HPLC System</td><td>Shimadzu</td><td>Nexera</td><td></td></tr><tr><td>Fluorescence Detector for HPLC</td><td>Shimadzu</td><td>RF-20Axs</td><td></td></tr><tr><td>HPLC Column</td><td>Phenomenex</td><td>Hyperclone ODS</td><td>250 x 4.6 mm</td></tr><tr><td>LCMS-grade H&lt;sub&gt;2&lt;/sub&gt;O</td><td>Merck Millipore</td><td>#WX00011</td><td></td></tr><tr><td>LCMS-grade Acetonitrile</td><td>Merck Millipore</td><td>#100029</td><td>Hypergrade</td></tr><tr><td>Ammonium hydroxide solution</td><td>Fluka</td><td>#44273</td><td>puriss. P.a.</td></tr></tbody></table>

determination of sialic acids in liver and milk samples of wild-type and cmah knock-out mice.

Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice.

CMAH (cytidine monophosphate-N-acetylneuraminic acid hydroxylase) is responsible for the oxidation of cytidine monophosphate-N-acetylneuraminic acids in mammals. However, humans cannot oxidize cytidine monophosphate-N-acetylneuraminic acid to cytidine monophosphate-N-glycolylneuraminic acid due to a primary exon deletion of the CMAH gene. To understand the effects and implications of the lack of CMAH activity in more detail, a Cmah knock-out model in mice is of keen interest in basic and applied research. The analysis method to determine the phenotype of this mouse model is herein described in detail, and is based on the detection of both N-acetylneuraminic acid and N-glycolylenuraminic acid in the liver and milk of wild-type and Cmah knock-out mice. Endogenous sialic acids are released and derivatized with o-phenylenediamine to generate fluorogenic derivatives, which can be subsequently analyzed by HPLC. The presented protocol can be also applied for the analysis of milk and tissue samples from various other origins, and may be of use to investigate the nutritional and health effects of N-glycolylneuraminic acid.

A schematic overview of the described analysis method is shown in Figure 1 and includes the isolation of sialic acids from milk and liver samples of wild-type and Cmah knock-out mutant mice, and the fluorescence derivatization and HPLC analysis of these components. Figure 2 and Figure 3 show representative HPLC chromatograms of derivatized sialic acids of milk and liver samples from homo- an...

We describe a HPLC-based method for the determination of N-acetylneuraminic acid and N-glycolylenuraminic acid in mouse liver and milk.

CMAH (cytidine monophosphate-N-acetylneuraminic acid hydroxylase) is responsible for the oxidation of cytidine monophosphate-N-acetylneuraminic acids in ...

The overall goal of this methodology is the detection of N-Acetylneuraminic acid and N-Glycolylneuraminic acid in the liver and milk of wild-type and CMAH knock-out mice using HPLC analysis. This method can help to answer questions in the field of glycoscience, specifically the effect genotypes of CMAH mouse models have on the actual sialic acid contents of these animals. The main advantage that this technique has in comparison to genetic screens is that relative sialic acid levels can be determined also for heterozygous mice.Evaluating this method will be Cui Cao and Wang Wenjiao, two graduate students from our laboratory. Begin this procedure with collection of mouse milk and mouse liver tissue from CMAH knock-out mice as described in the text protocol. To isolate sialic acids from milk, transfer 50 microliters of milk into a 1.5 milliliter centrifuge tube, and add 1.2 milliliters of prepared aqueous acetic acid solution.To isolate sialic acids from liver tissue, gently thaw 20 to 50 milligram of mouse liver and transfer it into a dounce tissue grinder. Add 1.2 milliliters of the aqueous acetic acid solution and homogenize the tissue by gentle shearing for 10 seconds. Transfer the resulting suspension into a 1.5 milliliter centrifuge tube.Next, incubate the acidified milk or tissue suspension for four hours at 80 degrees Celsius. Then, centrifuge the sample at 14 thousand times g for 10 minutes. Transfer the top 1000 microliters of the supernatant into a fresh 1.5 milliliter centrifuge tube.Remove the solvent by centrifugal evaporation at room temperature to complete dryness. Redissolve the sample in 500 microliters of distilled water. Next, prepare a microanion exchange column by transferring 200 milligrams of anion exchange resin per sample into empty 3 milliliter tubes with an attached stopcock.Add 2 milliliters of the aqueous acetic acid solution to replace the chloride ions in the resin with acetate ion. Close the stopcock as soon as the solvent reaches the top of the resin. Gently add 2 milliliters of distilled water and open the stopcock.Stop the flow as soon as most of the solvent reaches the top of the resin. Make sure that the resin is always covered with solvent. Then, wash the resin column two more times with two milliliters of distilled water for removing the excess acetate.Transfer the resulting 500 microliters of sample solvent onto the resin column and discard the flow-through. Gently was the resin with 2 milliliters of distilled water. Elute the sample anions from the resin using 1 milliliter of a 50 millimolar ammonium acetate solution into a 1.5 milliliter centrifuge tube.Remove the solvent by centrifugal evaporation at room temperature to dryness. Weigh between 5 and 8 milligrams of N-Acetylneuraminic acid on an analytical balance into a 1.5 milliliter centrifuge tube. Note the exact weight and add 164 microliters of distilled water for every milligram.Obtain N-Glycolylneuraminic acid in smaller quantities at a moderate price, such as in 1 milligram aliquots. Add 154 microliters of distilled water directly to compound to obtain a stock solution of approximately 20 millimolar Neu5Gc. Transfer the solution into a 1.5 milliliter centrifuge tube.This solution can be stored at minus 20 degrees Celsius for up to 12 months. Combine 5 microliters from each stock solution into a fresh 1.5 milliliter centrifuge tube. Then, remove the solvent by centrifugal evaporation at room temperature to dryness.Add 20 microliters of the OPD solution to the sialic acid samples derived from mouse milk, mouse liver, or the mixed sialic acid standard. Vortex the sample vigorously for 30 seconds. Then, incubate the samples for four hours at 80 degrees Celsius in the dark.After letting the samples cool down for five minutes, add 80 microliters of distilled water. Then, centrifuge the tubes at 14 thousand times g for one minute. Next, transfer 80 microliters from the supernatant into a 300 microliter high-recovery HPLC vial.The derivitized sialic acid samples can be stored at four to six degrees Celsius for up to one week. Analyze the samples using a standard HPLC system connected to an online fluorescence detector. Use a reversed phase C18 column with a 250 millimeter length and 4.6 millimeter diameter for the analysis.After preparing solvent A and solvent B, and setting up the HPLC run as detailed in the protocol, inject 50 microliters of the sample into the HPLC system. Monitor eluence using the fluorescence detector excitation wavelength of 373 nanometers and an emission wavelength of 448 nanometers. Finally, calculate the relative amount of Neu5Gc as described in the text protocol.Shown here are representative HPLC chromatograms of fluorescence labeled sialic acids from milk samples, derived from homozygous knock-out CMAH mice and heterozygous knock-out CMAH mice. wild-type mice are also shown. Similarly, chromatograms of the mouse liver derived fluorescence labeled sialic acids are shown here.Comparing the relative amounts of Neu5Gc shows that homozygous CMAH knock-out mice contain no Neu5Gc, whereas heterzygous CMAH knock-outs and wild-type mice contain between 10 and 75%Neu5Gc. Once mastered, samples can be prepared within eight hours if the procedure was performed properly. And the samples can be analyzed by HPLC autosampling overnight.While attempting this procedure, it's important to remember to perform the isolation of sialic acid and the derivitization procedure on the same day. Following the procedure, other methods like mass spectrometric analysis can be performed in order to confirm the nature of the obtained fluorescent signals. The development of this technique allows researchers to explore the sialic acid distribution in biological samples.Don't forget that working with concentrated acetic acid and formic acid can be extremely hazardous, and precautions such as wearing protective gear should always be taken while performing this procedure.

determination-sialic-acids-liver-milk-samples-wild-type-cmah-knock

Research

JoVE Journal

Biology

Unfixed frozen tissue samples embedded in Optimal Cutting Temperature medium (OCT) can be used to study natural distribution and glycosylation of secreted mucus. In this approach tissue processing is minimal and the natural presentation of glycolipids, mucins and glycan-epitopes is preserved. Tissue sections can be analyzed by immunohistochemistry using fluorescence or chromogenic detection.

Using Unfixed, Frozen Tissues to Study Natural Mucin Distribution

In this video, we demonstrate the detection of sialic acids, N-acetylneuraminic acid and N-glycolylneuraminic acid, using high-performance liquid chromatography, HPLC, following derivatization with a suitable fluorescent labeling reagent to aid in fluorescence detection.

Reversed-Phase High-Performance Liquid Chromatography: A Robust Method for Quantitation of Fluorescently Labeled and Derivatized Sialic Acids Isolated from Mouse Liver

Milk collection from animal models facilitates various research avenues: understanding passive immunity, identifying pathogens responsible for vertical transmission and, through the use of transgenic mice, even commercial production of proteins found in human breast milk. Here we illustrate a simple method for milk collection in mice and Reeves’ muntjac deer.

Milk Collection Methods for Mice and Reeves' Muntjac Deer

The indirect immunofluorescence protocol described in this article allows the detection and the localization of proteins in the mouse mammary gland. A complete method is given to prepare mammary gland samples, to perform immunohistochemistry, to image the tissue sections by fluorescence microscopy, and to reconstruct images.

Indirect Immunofluorescence on Frozen Sections of Mouse Mammary Gland

The transfer of bm12 lymphocytes into a C57BL/6 recipient is an established model of systemic lupus erythematosus. Here we describe how to initiate disease using this model and how to characterize T follicular helper cells, germinal center B cells and plasma cells by flow cytometry.

The bm12 Inducible Model of Systemic Lupus Erythematosus (SLE) in C57BL/6 Mice

Sialic acid is a typical monosaccharide-unit found in glycoconjugates. It is involved in a plethora of molecular and cellular interactions. Here we present a method to modify cell surface sialic acid expression using metabolic glycoengineering with N-acetylmannosamine derivatives.

Metabolic Glycoengineering of Sialic Acid Using N-acyl-modified Mannosamines

Salivary gland hypofunction is a frequent consequence of autoimmune disease and radiation therapy. Reproducible evaluation of salivary gland function in mouse models of these diseases is a technical challenge. Here, a simple method for accurate and reproducible measurement of saliva production in mice is described.

A Method for the Measurement of Salivary Gland Function in Mice

This work shows the potential of printed glycan array (PGA) technology for the analysis of circulating anti-carbohydrate antibodies in small animals.

Printed Glycan Array: A Sensitive Technique for the Analysis of the Repertoire of Circulating Anti-carbohydrate Antibodies in Small Animals

Here we present a protocol to investigate the effect of the nullification of gustation-related genes on immune responses in a dextran sulfate sodium (DSS)-induced inflammatory bowel disease (IBD) mouse model.

Effects of Taste Signaling Protein Abolishment on Gut Inflammation in an Inflammatory Bowel Disease Mouse Model

We describe an in vivo immunization, translational hepatitis model in BALB/c mice that can be utilized to study the pathogenesis of drug-induced autoimmune hepatitis including sex differences seen in this disease. We will describe how this model demonstrates reproducible analyses using in vivo and in vitro experimental techniques.

Induction of Drug-Induced, Autoimmune Hepatitis in BALB/c Mice for the Study of Its Pathogenic Mechanisms

This article describes how to assemble a device that can be used to collect milk from laboratory mice. This device is affordable, portable, and allows a collection of 0.1–0.5 mL of milk by one trained person. A detailed milking protocol is also...

An Efficient Single-Person Technique for Milk Sampling from Laboratory Mice

Learn to detect N-acetylneuraminic acid and N-glycolylneuraminic acid in mouse liver and milk using HPLC analysis. This method enables quantification of sialic acids in CMAH knock-out mice.

Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice.

Explore More Videos