A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

RNA-Seq Reveals Th17 Cell Differentiation Pathway as a Mechanism of Radiation-Induced Brain Injury

575 views

⸱

DOI:

10.3791/68322

⸱

June 20th, 2025

In This Article

Summary

This study aims to investigate the activation of the Th17 cell differentiation pathway in mice with radiation-induced brain injury.

Abstract

Radiotherapy is a prevalent therapeutic modality for head and neck malignancies; however, it invariably results in radiation-induced damage to normal cerebral tissue, culminating in radiation-induced brain injury (RBI). Despite extensive research on radiation-induced neuroinflammation, the association between RBI and the Th17 cell differentiation pathway remains inadequately understood. C57BL/6 mice underwent a single administration of 30 Gy cranial irradiation to develop the RBI model. Cognitive function was evaluated through the Morris water maze (MWM), open field test, novel object recognition test, and rotarod test. Histopathological alterations in brain tissue were analyzed using hematoxylin and eosin (H&E) staining. Immunofluorescence staining was employed to assess the activation of microglia (IBA-1) and astrocytes (GFAP). RNA sequencing was conducted to identify differentially expressed genes, while Simple Western and qPCR were utilized to examine key signaling molecules involved in Th17 cell differentiation. RBI mice demonstrated marked cognitive deficits, particularly in spatial learning and memory retention. Histological examination indicated activation of microglia and astrocytes within the cortex and hippocampus of irradiated mice. RNA sequencing analysis identified a significant enrichment of the Th17 cell differentiation pathway in the cortex of the RBI group. Further validation through Simple Western and qPCR analyses confirmed the upregulation of TGF-β, IL-6, RORγt, IL-17, and P-STAT3 in the cortex of RBI mice. These findings suggested that the Th17 cell differentiation pathway played a pivotal role in the pathogenesis of radiation-induced brain injury. Neuroinflammation mediated by Th17 cells may be a critical mechanism underlying radiation-induced cognitive dysfunction.

Introduction

Radiotherapy is a crucial treatment for both primary and metastatic head and neck tumors, but radiation-induced brain injury (RBI) can occur as a severe complication, characterized by central nervous system damage. RBI incidence varies by tumor type and treatment modality, with reported rates ranging from 28%-50% following stereotactic radiotherapy for meningiomas1, 1.9%-5% for nasopharyngeal carcinoma2,3, 1%-24% for low-grade gliomas4,5, and 8%-20% for brain metastases6,7. RBI is classified into acute, early-delayed, and late-delayed types, with cognitive dysfunction, particularly memory impairment, and learning deficits being prominent in the late-delayed form. Radiation-induced cognitive dysfunction (RICD), which affects 50%-90% of long-term survivors of head and neck cancers, significantly impacts quality of life8, yet its pathogenesis remains poorly understood, and effective preventive and therapeutic strategies are lacking.

Neuroinflammation is a key pathological feature of RBI, exacerbating blood-brain barrier disruption and hindering neurogenesis in the hippocampus. Th17 cells, a subset of CD4+ T cells known for producing the pro-inflammatory cytokine IL-179, have been linked to various neurodegenerative diseases, including multiple sclerosis and Parkinson's disease10,11. These cells, under certain inflammatory conditions, can cross the blood-brain barrier and contribute to neuroinflammation12. Since their discovery in 2005, Th17 cells have garnered attention for their role in both immune responses against pathogens and their involvement in inflammatory diseases, making them a potential target for studying the mechanisms of RBI and related cognitive dysfunction13.

In this study, only male mice were used. The exclusion of females aimed to avoid potential confounding effects arising from estrous cycle-associated neuroinflammatory fluctuations, as progesterone levels can vary by up to tenfold across different phases of the cycle14. Moreover, our experimental model was designed to reflect the clinical context of head and neck cancer radiotherapy, in which approximately 72% of patients are male15. Consistent with this, the majority of published studies investigating the mechanisms of radiation-induced brain injury (RBI) have utilized male rodents to establish baseline pathological features16.

While various models have been employed to study RBI, traditional methodologies like histopathological staining and simple Western blotting face limitations in terms of sensitivity, throughput, and accuracy17. Recent advances such as RNA sequencing (RNA-Seq) and high-throughput proteomics have provided more robust insights into the molecular mechanisms underlying RBI18. These technologies allow for a comprehensive understanding of gene expression changes and protein alterations, providing more precise data than earlier methods19. Simple Western, in particular, is a novel and automated technique that combines the advantages of capillary electrophoresis with protein detection via chemiluminescence, facilitating high-throughput analysis with minimal sample volume and increased reproducibility20. Compared to traditional Western blotting, Simple Western eliminates the need for membrane transfer and provides quantitative protein expression data, offering several advantages in terms of sensitivity and reproducibility, especially in low-abundance protein detection21,22.

Practical guidelines for RNA extraction and preparation are crucial to the success of high-quality sequencing and quantification. For optimal RNA extraction, we recommend using high-quality RNA isolation kits and ensuring the concentration is within the range of 100-1000 ng/µL, with an RNA integrity number (RIN) above 7.0 to avoid degradation. When performing protein analysis using Simple Western, it is important to ensure that protein samples are properly denatured and loaded at a concentration of approximately 1-5 µg per capillary. For qPCR validation, use high-quality cDNA synthesized from at least 1 µg of RNA, ensuring consistent reverse transcription conditions. Common pitfalls in RNA preparation, such as contamination with genomic DNA or RNA degradation, should be avoided by using RNAse-free equipment and performing phase separation promptly to prevent RNA degradation.

By incorporating these methods, this study aims to investigate whether the Th17 cell differentiation pathway is activated in murine models of RBI and how it contributes to the pathogenesis of radiation-induced cognitive dysfunction.

Access restricted. Please log in or start a trial to view this content.

Protocol

The experimental procedures conducted here are in strict accordance with the ARRIVE guidelines (Animal Research: Reporting of In Vivo Experiments). Approval was obtained from the Institutional Animal Care and Use Committee of the Beijing Institute of Radiation Medicine (Approval No. AF/SC-08/02; Date: Feb 25, 2024).

1. Mice cranial irradiation

  1. Use a total of 10 male C57BL/6 mice aged 6-8 weeks in the study, allocating five animals to the RBI group and five to the control group, where the control group consists of blank control mice that did not receive RBI. Maintain the mice under controlled environmental conditions, including regulated temperature, humidity, and a 12 h light/dark cycle. Acclimate the mice for 1 week before starting the experiment.
  2. Anesthetize animals using an intraperitoneal injection of 1% pentobarbital sodium at 50 mg/kg body weight. Confirm proper anesthetization by checking the absence of reflexive response to a firm paw pinch. Apply veterinary ophthalmic ointment to both eyes immediately after the onset of anesthesia to prevent corneal drying.
  3. Position animals in a prone orientation using a dedicated wooden restraint device and cover the non-targeted areas of the body with a 3 mm thick lead (Pb) shielding plate (99.9% purity) to ensure localized irradiation.
  4. Collimate the 2 x 2 cm2 irradiation field with inherent filtration (1.5 mm Al + 0.25 mm Cu). Align the field to the cranial midline with integrated laser crosshairs (λ = 635 nm ± 0.5 mm accuracy) and verify real-time positioning with an integrated CMOS camera system and IR backlighting. Irradiate the cranial region with a single 30 Gy X-ray dose at 1.325 Gy/min using an X-RAD 320 system under the following parameters: 320 kVp/12.5 mA, SSD = 50 cm.
  5. Perform weekly dose calibration using a traceable ionization chamber positioned at the isocenter. Maintain beam parameters at 320 kVp/12.5 mA with 3.2 mm Cu HVL filtration to achieve a dose rate of 1.325 Gy/min (± 3% variation). Verify beam uniformity daily (> 95% within the field) using Gafchromic EBT3 film.
  6. Administer meloxicam (1-2 mg/kg, subcutaneously) once daily for 3 days to manage post-surgical pain. Place animals in a pre-warmed recovery chamber and monitor continuously until they regain full consciousness and can maintain sternal recumbency. Do not leave animals unattended during the recovery period.
  7. Record the body weight of all mice weekly throughout the study. Observe the mice for a total of 4 weeks, including 1 week of acclimatization and 3 weeks post-irradiation.

2. Animal behavior analysis

  1. Perform behavioral experiments 3 weeks after RBI.
  2. Morris water maze
    1. Fill a circular pool (diameter: 120 cm, height: 50 cm) with opaque water (20-22 °C) using powdered milk to obscure the submerged platform. Place a hidden platform (diameter: 10 cm) 1 cm below the water surface in a fixed quadrant.
    2. Acclimate mice to the testing room for at least 30 min before trials. Begin the training phase by placing each mouse into the water from one of four pseudo-randomly selected start points (N, S, E, W).
    3. Allow the mouse to swim for up to 60 s to locate the hidden platform. If the mouse fails to find the platform within 60 s, guide it to the platform and allow it to remain there for 15 s.
    4. Conduct four trials per day per mouse with a 15 min inter-trial interval. Dry each mouse thoroughly with a warm towel between trials to prevent hypothermia. Continue training for 5 consecutive days to assess learning acquisition.
    5. On the probe trial day, remove the platform and allow the mouse to swim freely for 60 s. Record parameters such as time spent in the target quadrant, platform crossings, and swim paths.
    6. Track and analyze all trials using an automated video tracking system with experimenters blinded to group allocation.
  3. Open field test
    1. Acclimate mice to the testing room for at least 30 min before the experiment. Use an open field apparatus (50 cm x 50 cm x 40 cm) made of opaque plastic. Illuminate the arena uniformly (typically 25-30 lux) to avoid strong shadows and minimize stress.
    2. Clean the arena with 70% ethanol before testing each animal to eliminate odor cues. Place the mouse gently in the center of the open field to begin the test. Allow the mouse to explore the arena freely for 10 min.
    3. Record locomotor activity and position using an automated tracking system. Define the central zone as the inner 20%-25% of the total area. Measure the time spent in the central zone and the total distance traveled.
    4. After the session, return the mouse to its home cage and clean the apparatus thoroughly.
  4. Novel object recognition test
    1. Acclimate mice to the testing room for at least 30 min prior to the experiment. Use an open field arena (50 cm x 50 cm x 40 cm) with uniform lighting (20-30 lux). Clean the arena thoroughly with 70% ethanol between animals to eliminate olfactory cues.
    2. Place each mouse in the empty arena and allow it to freely explore for 10 min. Do not place any objects during this phase.
    3. After 24 h, place two identical objects (A and A′) in opposite corners of the arena (at least 8 cm from the walls). Gently place the mouse in the center of the arena and allow it to explore for 10 min.
    4. Record object interaction using an automated video system. Define object exploration as the mouse's snout being within 2 cm of the object while oriented toward it.
    5. Return the mouse to its home cage after the trial and clean the arena and objects.
    6. After a 1 h retention interval, place one familiar object (A) and one novel object (B) in the same positions. Return the mouse to the arena and allow it to explore for 5 min.
    7. Record time spent exploring each object using the same criteria as before. Calculate the recognition index as:
      ​Recognition Index (%) = [Time on novel object / (Time on novel + familiar object)] x 100
  5. Rotarod test
    1. Acclimate mice to the testing room for at least 30 min prior to testing. Use a motorized rotarod apparatus with a rod diameter of ~3 cm and a height of ~30 cm above the base.
    2. Set the rotation mode to accelerating speed (from 4 rpm to 40 rpm over 5 min). Clean the rod surface with 70% ethanol before placing each mouse.
    3. Place the mouse gently on the center of the rotating rod, facing forward. Start the rotation and begin timing immediately.
    4. Record the latency to fall automatically by the system. Catch the mouse safely upon falling to avoid injury. Allow a rest period of at least 15 min between trials to prevent fatigue.
    5. Conduct 3 consecutive trials per mouse per day and average the latency as the final result. Ensure all testing is performed by blinded experimenters under consistent conditions. Return the mouse to its home cage after testing and disinfect the apparatus thoroughly.

3. Animal euthanasia and sample preparation

  1. Collect tissue samples 5 weeks after RBI.
  2. Prepare sodium pentobarbital (100 mg/kg) and a sterile syringe. Inject sodium pentobarbital intraperitoneally. Wait for the mouse to stop breathing and for the heartbeat to cease, confirming death.
  3. Rapidly decapitate at the occipital junction and sagittally incise cranial sutures using fine scissors, then carefully elevate bilateral cranial flaps with curved forceps while preserving meningeal integrity before severing neural connections.
  4. Transfer the intact brain to a pre-chilled matrix within 60 s for midsagittal bisection using sterile razor blades. Immediately record anteroposterior dimensions (8.2 ± 0.3 mm), mediolateral width (4.5 ± 0.2 mm), and tissue mass (112 ± 8 mg) with precision instrumentation.
  5. Dissect the cortical and hippocampal tissues on ice. Flash-freeze the left hemisphere in liquid nitrogen for RNA sequencing, qPCR, and Simple Western.
  6. Fix the right hemisphere in 4% paraformaldehyde (PFA) for histology. Dehydrate the fixed brains in graded ethanol from 70% to 100%, with each step lasting 30 min.
  7. Clear the brains in xylene for 2 h. Infiltrate the tissues with molten paraffin at 60°C for 4 h. Embed the cleared brains in paraffin blocks and let them solidify at room temperature. Cut coronal sections at a thickness of 5 µm using a microtome.

4. Hematoxylin and eosin staining

  1. Deparaffinize tissue sections by immersing slides in xylene for 5 min, 3x. Rehydrate the sections through a graded ethanol series: 100%, 95%, 70%, and distilled water, for 5 min each.
  2. Stain the sections with Hematoxylin for 5 min, depending on the desired staining intensity. Rinse the sections in running tap water for 5 min to remove excess Hematoxylin.
  3. Differentiate the sections in 1% hydrochloric acid in ethanol for a few seconds to achieve the desired contrast. Rinse again in running tap water for 5 min. Stain the sections with Eosin for 1 min.
  4. Rinse the sections briefly in distilled water. Dehydrate the sections through a graded ethanol series: 70%, 95%, and 100%, for 5 min each.
  5. Clear the sections in xylene for 5 min, 3x. Mount the sections with a coverslip using a mounting medium. Acquire images using a Nikon Eclipse Ni-U microscope with a 20x objective.

5. Immunofluorescence

  1. Fix the tissue by immersing slides in 4% PFA for 15 min at room temperature. Wash the slides in phosphate-buffered saline (PBS) for 5 min, 3x, to remove excess PFA.
  2. Permeabilize the tissue by incubating slides with 0.3% Triton X-100 in PBS for 10 min at room temperature. Block non-specific binding by incubating the slides with 5% normal serum for 1 h at room temperature.
  3. Incubate with primary antibodies IBA-1 and GFAP, diluted in blocking buffer at a 1:2000 dilution, overnight at 4 °C, depending on the antibody specifications. Wash the slides in PBS for 5 min, 3x, to remove unbound primary antibody.
  4. Incubate with Goat Anti-Rabbit IgG secondary antibody conjugated to Alexa Fluor 488, diluted at 1:1000 for 1 h at room temperature in the dark. Wash the slides in PBS for 5 min, 3x, to remove excess secondary antibody.
  5. Mount the slides with an antifade mounting medium containing DAPI. Seal the coverslip with clear nail polish.
  6. Capture fluorescence images using a confocal microscope system with a 20x objective.
  7. Quantify fluorescence intensity using ImageJ. Perform quantitative analysis using ImageJ's Analyze Particles tool with size thresholds of 50-200 µm2 (microglia) and 100-500 µm2 (astrocytes). Subtract the background using the Rolling Ball algorithm (radius = 50 pixels).

6. qPCR analysis

  1. Extract total RNA from tissue using an RNA extraction kit. Follow the manufacturer's protocol for homogenization, lysis, and RNA purification.
  2. Quantify the extracted RNA using a spectrophotometer to measure the concentration and assess the purity (A260/A280 ratio). Ensure the RNA concentration is appropriate for cDNA synthesis (100-500 ng/µL).
  3. Assess the quality of the RNA by using a bioanalyzer. Ensure that the RNA shows no degradation (sharp bands for 18S and 28S rRNA) and has an RNA integrity number (RIN) above 7.
  4. Prepare a 20 µL reaction mixture with 1 µg of RNA, reverse transcription buffer, oligo-dT, dNTPs, RNase inhibitor, and reverse transcriptase.
  5. Incubate at 42 °C for 60 min to synthesize cDNA. Heat at 85 °C for 5 min to inactivate the reverse transcriptase.
  6. Combine cDNA, master mix, forward primer, reverse primer (Table 1), and nuclease-free water in a 96-well PCR plate. Use 2 µL of cDNA per 20 µL reaction and ensure a final primer concentration of 200 nM. Seal the plate with an optical adhesive film to prevent evaporation.
Geneprimer sequence (5'-3', forward/reverse)
TGF-β1CCACCTGCAAGACCATCGAC
CTGGCGAGCCTTAGTTTGGAC
TGF-β3GGACTTCGGCCACATCAAGAA
TAGGGGACGTGGGTCATCAC
IL-6CTGCAAGAGACTTCCATCCAG
AGTGGTATAGACAGGTCTGTTGG
RORγtTCCACTACGGGGTTATCACCT
AGTAGGCCACATTACACTGCT
IL-17ATCAGCGTGTCCAAACACTGAG
CGCCAAGGGAGTTAAAGACTT
IL-17FTGCTACTGTTGATGTTGGGAC
CAGAAATGCCCTGGTTTTGGT
GAPDHAGGTCGGTGTGAACGGATTTG
GGGGTCGTTGATGGCAACA

Table 1: qPCR sequence primers.

  1. Place the reaction plate in a real-time PCR instrument and program the thermal cycler. Use the following cycling conditions: initial denaturation at 95 °C for 3 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 30 s.
  2. Normalize the expression of the target genes to GAPDH. Calculate relative expression levels using the ΔΔCt method and present the data as fold changes compared to the control group.

7. RNA sequencing analysis

  1. Anesthetize and euthanize the mouse following institutional animal care protocols. Immediately perfuse with cold PBS to remove circulating blood.
  2. Dissect the brain on ice. Isolate the cerebral cortex using sterile dissection tools. Minimize dissection time to preserve RNA integrity.
  3. Flash-freeze the cortical tissue in liquid nitrogen. Store at -80 °C if RNA extraction is not performed immediately.
  4. Homogenize the frozen cortex (30-50 mg) in 1 mL of RNA extraction reagent using a motorized homogenizer until no visible fragments remain.
  5. Perform chloroform phase separation. Add 200 µL of chloroform, shake vigorously for 15 s, incubate for 2-3 min at room temperature, then centrifuge at 12,000 x g for 15 min at 4 °C.
  6. Transfer the upper layer to a new tube, add an equal volume of 70% ethanol, and proceed with RNA purification using a silica column-based kit.
  7. Use on-column DNase digestion to remove genomic DNA during RNA purification. Collect total RNA in 30-50 µL and keep on ice for immediate use.
  8. Use a spectrophotometer to quantify RNA concentration and purity. Confirm A260/A280 ratio of ~2.0. Analyze 1 µL of RNA on a Bioanalyzer. Ensure RIN is greater than 8.0 for sequencing.
  9. Use a poly(A) selection protocol and a stranded library prep kit. Follow the manufacturer's protocol to generate 300-400 bp libraries. Purify libraries with a commercial kit.
  10. Use a Bioanalyzer to confirm fragment size and quantify with a pool libraries equimolarly. Perform paired-end sequencing (2x, 150 bp) using an Illumina platform.
  11. Trim adaptors using Trim Galore, assess quality with FastQC, align reads to the mouse genome (GRCm39) using STAR, and quantify gene expression with featureCounts. Identify differentially expressed genes using DESeq2.
  12. Use the output from DESeq2, and filter for significantly differentially expressed genes DEGs (adjusted p-value < 0.05 and |log2FC| > 1). Perform GO and KEGG pathway enrichment analysis using Phyper based on the hypergeometric test. Identify pathways with corrected P value ≤ 0.05 as statistically significant.

8. Simple Western analysis

  1. Homogenize mouse cerebral cortex in RIPA buffer with protease and phosphatase inhibitors, then centrifuge at 12,000 x g for 10 min at 4 °C to remove debris. Determine protein concentration using a BCA assay.
  2. Denature the protein samples by mixing them with sample buffer and incubating at 95°C for 5 min to ensure complete denaturation.
  3. Load 3 µL denatured protein samples into the Simple Western capillaries. Ensure that the samples are loaded properly to prevent overflow. Place the capillaries into the Simple Western instrument.
  4. Incubate the separated proteins with 1:50 diluted primary antibodies, including p-STAT3, STAT3, RORγt, TGF-β, IL-6, and IL-17, for 30 min.
  5. Wash the capillary system with wash buffer for three washes of 5 min each to remove unbound primary antibodies. Add the HRP-conjugated secondary antibody diluted in blocking buffer and incubate for 30 min.
  6. Perform 3 washes of 5 min each with wash buffer to remove excess secondary antibody. Run the detection program on the Simple Western system to automatically detect the proteins using chemiluminescence.
  7. Analyze the data using the Compass for Simple Western software. Quantify the protein expression by comparing the relative peak areas in the electropherogram. Normalize the data to GAPDH protein.

9. Statistical analysis

  1. Open GraphPad Prism 9.0.0. software. Click on File > Import Data for data loading. Present data as means ± SD. Use the unpaired t-test for comparisons between two groups.
  2. Assess normality using the Shapiro-Wilk test. If normality is violated (p < 0.05), apply the Mann-Whitney U test for between-group comparisons. If normality is satisfied (p ≥ 0.05), perform an independent samples t-test to evaluate group differences.
  3. Report results with p-values. Consider p < 0.05 as statistically significant. Use the following notation: n.s. for not significant, * for p < 0.05, ** for p < 0.005, *** for p < 0.0005, and **** for p < 0.0001.

Access restricted. Please log in or start a trial to view this content.

Results

Cognitive impairment in RBI mice
Following exposure to a 30 Gy whole-brain irradiation, the body weight of the mice was monitored on a weekly basis. Cognitive function was evaluated during the 4th week (Figure 1A). Initial measurements indicated that the body weights of the control and RBI groups were similar. However, between 1- and 3-weeks post-irradiation, the RBI group demonstrated a significant decrease in body weight (

Access restricted. Please log in or start a trial to view this content.

Discussion

Critical steps within the protocol
This protocol involves the induction of RBI in mice, followed by comprehensive assessments of neuroinflammation and the Th17 cell differentiation pathway (Figure 6). A critical step is cranial irradiation of C57BL/6 mice with a 30 Gy dose, a well-established model for RBI1. Accurate dose calibration using ionization chambers ensures reproducibility28. Behavioral assays, including the MWM...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors have no conflicts of interest to declare.

Acknowledgements

Support for this work was provided by the Beijing Institute of Radiation Medicine

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
12-230 kDa Separation Module, 8 x 25 capillary cartridgesProteinSimpleSM-W004for SimpleWestern
anti-GAPDH antibodyProteintechHRP-600041:500 dilution/antibody for SimpleWestern
anti-GFAP antibodyAbcamab72601:2000 dilution/antibody for Immunofluorescence
anti-IBA-1 antibodyAbcamab1788461:2000 dilution/antibody for Immunofluorescence
anti-IL-17 A/F antibodyThermoMA5-237481:10 dilution/antibody for SimpleWestern
anti-IL-1β antibodyCST122421:50 dilution/antibody for SimpleWestern
anti-IL-6 antibodyThermoMA5-238001:5 dilution/antibody for SimpleWestern
Anti-Mouse Detection ModuleProteinSimpleDM-002secondary antibody for SimpleWestern
anti-P-STAT3(Try705) antibodyThermoMA5-151931:2 dilution/antibody for SimpleWestern
Anti-Rabbit Detection ModuleProteinSimpleDM-001secondary antibody for SimpleWestern
anti-RORγt antibodyThermo14-6988-821:5 dilution/antibody for SimpleWestern
anti-STAT3 antibodyThermo7100771:20 dilution/antibody for SimpleWestern
anti-TGF β-1,2,3 antibodyThermoMA5-237951:10 dilution/antibody for SimpleWestern
BAC assayThermoA55860protein assays
EZ Standard Pack 1 12-230 kDaProteinSimplePS-ST01EZ-8for SimpleWestern
Goat Anti-Rabbit IgG H&LAbcamab1500771:1000 dilution/antibody for Immunofluorescence
RNeasy KitQiagen74134RNA Extraction
SuperScript IV First-Strand Synthesis SystemThermo Fisher Scientific18091050Reverse Transcription
SYBR Green Master MixTakara Bio RR820AQ-PCR
TRIzol ReagentInvitrogen15596026RNA Extraction

References

  1. Milano, M. T., et al. Radiation-induced edema after single-fraction or multifraction stereotactic radiosurgery formeningioma: a critical review. Int J Radiat Oncol Biol Phys. 101 (2), 344-357 (2018).
  2. Tian, Y., et al. Radiation encephalopathy in nasopharyngeal carcinoma patients in mainland China: a systematic evaluation. Zhonghua Zhong Liu Za Zhi. 24 (5), 471-473 (2002).
  3. Na, A., et al. Cerebral radiation necrosis. Asia Pac J Clin Oncol. 10 (1), 11-21 (2014).
  4. Deangelis, L. M. Brain tumors. N Engl J Med. 344 (2), 114-123 (2001).
  5. Kumar, A. J., et al. Malignant gliomas: MR imaging spectrum of radiation therapy-and chemotherapy-induced necrosis of the brain after treatment. Radiology. 217 (2), 377-384 (2000).
  6. Minniti, G., et al. Single-fraction versus multifraction (3 x 9 Gy) stereotactic radiosurgery for large (>2 cm) brain metastases: acomparative analysis of local control and risk of radiation-induced brain necrosis. Int J Radiat Oncol Biol Phys. 95 (4), 1142-1148 (2016).
  7. Minniti, G., et al. Repeated stereotactic radiosurgery for patients with progressive brain metastases. J Neurooncol. 126 (1), 91-97 (2016).
  8. Turnquist, C., Harris, B. T., Harris, C. C. Radiation-induced brain injury: current concepts and therapeutic strategies targeting neuroinflammation. Neurooncol Adv. 2 (1), vdaa057(2020).
  9. Raphael, I., et al. T cell subsets and their signature cytokines in autoimmune and inflammatory diseases. Cytokine. 74 (1), 5-17 (2015).
  10. Moser, T., et al. The role of TH17 cells in multiple sclerosis: Therapeutic implications. Autoimmun Rev. 19 (10), 102647(2020).
  11. MacMahon, C. A., et al. The Pathogenesis of Parkinson's Disease: A Complex Interplay Between Astrocytes, Microglia, and T Lymphocytes. Front Neurol. 12, 666737(2021).
  12. Kebir, H., et al. Human TH17 lymphocytes promote blood-brain barrier disruption and central nervous system inflammation. Nat Med. 13 (10), 1173-1175 (2007).
  13. Omenetti, S., et al. The Intestine Harbors Functionally Distinct Homeostatic Tissue-Resident and Inflammatory Th17 Cells. Immunity. 51 (1), 77-89.e6 (2019).
  14. Mangold, C. A., et al. Sexually divergent induction of microglial-associated neuroinflammation with hippocampal aging. J Neuroinflammation. 14 (1), 141(2017).
  15. SEER Cancer Stat Facts: Head and Neck Cancer. , National Cancer Institute. https://seer.cancer.gov/statfacts/html/headneck.html (2025).
  16. Holmes-Hampton, G. P., et al. Time- and sex-dependent delayed effects of acute radiation exposure manifest via miRNA dysregulation. iScience. 27 (2), 108867(2024).
  17. Kempf, S. J., et al. The cognitive defects of neonatally irradiated mice are accompanied by changed synaptic plasticity, adult neurogenesis and neuroinflammation. Mol Neurodegener. 9, 57(2014).
  18. Zhao, J., et al. RNA-seq reveals Nup62 as a potential regulator for cell division after traumatic brain injury in mice hippocampus. PeerJ. 11, e14913(2023).
  19. Zhang, P., et al. Quantitative proteomics analysis to identify diffuse axonal injury biomarkers in rats using iTRAQ coupled LC-MS/MS. J Proteomics. 133, 93-99 (2016).
  20. Sormunen, A., et al. Comparison of Automated and Traditional Western Blotting Methods. Methods Protoc. 6 (2), 43(2023).
  21. Mishra, M., et al. Protein purification and analysis: next generation Western blotting techniques. Expert Rev Proteomics. 14 (11), 1037-1053 (2017).
  22. Edouard, S., et al. Automated Western immunoblotting detection of anti-SARS-CoV-2 serum antibodies. Eur J Clin Microbiol Infect Dis. 40 (6), 1309-1317 (2021).
  23. Galland, F., et al. Astrocyte culture models: Molecular and function characterization of primary culture, immortalized astrocytes and C6 glioma cells. Neurochem Int. 131, 104538(2019).
  24. Wu, B., et al. The TGF-β superfamily cytokine Activin-A is induced during autoimmune neuroinflammation and drives pathogenic Th17 cell differentiation. Immunity. 54 (2), 308-323.e6 (2021).
  25. Korn, T., et al. IL-17 and Th17 Cells. Annu Rev Immunol. 27, 485-517 (2009).
  26. Kumar, R., et al. RORγt protein modifications and IL-17-mediated inflammation. Trends Immunol. 42 (11), 1037-1050 (2021).
  27. Qin, Z., et al. TCR signaling induces STAT3 phosphorylation to promote TH17 cell differentiation. J Exp Med. 221 (3), e20230683(2024).
  28. Lampert, P. W., et al. Delayed effect of radiation on the human central nervous system, 'early' and 'late' delayed reactions. Neurology. 14, 912-917 (1964).
  29. Martin, A., et al. Neurological imaging of brain damages after radiotherapy and/or chemotherapy. J Neuroradiol. 41 (1), 52-70 (2014).
  30. Conesa, A., et al. A survey of best practices for RNA-seq data analysis. Genome Biology. 17, 13(2016).
  31. Allen, B. D., et al. Mitigation of helium irradiation-induced brain injury by microglia depletion. J Neuroinflammation. 17 (1), 159(2020).
  32. Singh, R. P., et al. Th17 cells in inflammation and autoimmunity. Autoimmun Rev. 13 (12), 1174-1181 (2014).
  33. Monje, M. L., Toda, H., Palmer, T. D. Inflammatory blockade restores adult hippocampal neurogenesis. Science. 302 (5651), 1760-1765 (2003).
  34. Pazzaglia, S., et al. Neurocognitive Decline Following Radiotherapy: Mechanisms and Therapeutic Implications. Cancers. 12 (1), 146(2020).
  35. Zhang, X., et al. DNA methylation changes and their role in radiation-induced brain injury,". Neurobiol Dis. 129, 96-104 (2019).
  36. Lee, H. J., et al. Profiling of gene expression in the brain associated with anxiety-related behaviors in the chronic phase following cranial irradiation. Sci Rep. 12 (1), 13162(2022).
  37. Cañada-García, D., Arévalo, J. C. A Simple, Reproducible Procedure for Chemiluminescent Western Blot Quantification. Bio Protoc. 13 (9), e4667(2023).
  38. Raber, J., et al. Radiation-induced cognitive impairments are associated with changes in indicators of hippocampal neurogenesis. Radiat Res. 162 (1), 39-47 (2004).
  39. Zhang, J., et al. Th17 cell-mediated neuroinflammation is involved in neurodegeneration of aβ1-42-induced Alzheimer's disease model rats. PLoS One. 8 (10), e75786(2013).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

RNA SequencingNeuroinflammationCognitive DysfunctionMicroglia ActivationAstrocyte ActivationMorris Water MazeSimple WesternqPCR Analysis

This article has been published

Video Coming Soon