A subscription to JoVE is required to view this content. Sign in or start your free trial.

Research Article

A Bioactive Component from Aconitum pendulum Attenuates Rheumatoid Arthritis-Related Inflammation in Rats via PI3K/Akt Pathway Regulation

175 views

⸱

DOI:

10.3791/70473

⸱

April 21st, 2026

In This Article

Summary

Using network pharmacology and molecular docking, anti- rheumatoid arthritis (RA) components from A. pendulum were identified. In vivo studies showed diterpene alkaloids, especially smirnotine A, alleviate RA symptoms in rats via the PI3K/Akt pathway.

Abstract

In traditional Chinese medicine and various ethnic medical practices, the roots of Aconitum pendulum N. Busch are commonly used for their ability to dredge meridians, dispel rheumatism, promote blood circulation, and alleviate arthralgia. As a result, this medicinal plant has become a well-regarded treatment for sprains and rheumatic diseases across different ethnic medical systems. This study investigated the mechanisms by which six previously isolated compounds from A. pendulum ameliorate rheumatoid arthritis (RA)-related inflammation using both in vitro and in vivo approaches. A combination of techniques, including network pharmacology, molecular docking, enzyme-linked immunosorbent assay (ELISA), hematoxylin and eosin (H&E) staining, quantitative real-time polymerase chain reaction (q-PCR), and western blot (WB), was employed. Results demonstrated that smirnotine A, one of the six compounds, alleviates RA symptoms by targeting the PI3K/Akt signaling pathway and suppressing the inflammatory response. These findings provide a scientific basis for understanding the material foundation and mechanistic action underlying the traditional use of A. pendulum in treating RA.

Introduction

Rheumatoid arthritis (RA) is a chronic autoimmune disease marked by synovial inflammation, hyperplasia of the synovial lining, infiltration of immune cells, formation of invasive pannus tissue, and consequent joint destruction1,2,3. With a global prevalence of 0.5%–1%, RA poses a significant public health burden and severely impacts patients' quality of life4,5,6,7. Conventional therapies—such as methotrexate (MTX), glucocorticoids, Janus kinase (JAK) inhibitors, and non-steroidal anti-inflammatory drugs (NSAIDs)—are often limited by adverse effects and variable patient response, underscoring the need for novel treatments8.

Natural products, particularly alkaloids, have gained attention for their multi-target mechanisms and favorable safety profiles in RA management. Alkaloids such as berberine, sinomenine, and matrine modulate key inflammatory pathways, including mitogen-activated protein kinase (MAPK), nuclear factor kappa B (NF-κB), phosphatidylinositol 3-kinase/protein kinase B (PI3K/Akt), and Janus kinase/signal transducer and activator of transcription (JAK/STAT) and downregulate cytokines like tumour necrosis factor alpha (TNF-α), Interleukin (IL)-1β, and IL-6, demonstrating therapeutic potential9,10.

In Tibetan medicine, RA is classified as brum bu (dampness arthralgia), attributed to an imbalance of the three humors and accumulation of immature yellow water in joints11,12(Figure 1). Aconitum pendulum N. Busch is a traditionally used herb for expelling dampness, promoting circulation, and relieving pain13,14. Over 50 classical Tibetan formulations containing this herb have been documented, with a history of clinical use spanning more than 300 years15,16. However, its bioactive components and mechanisms remain poorly characterized.

Here, we combine network pharmacology and molecular docking to predict the anti-RA constituents of Aconitum pendulum N. Busch and their potential targets and pathways. These predictions are subsequently validated experimentally (Figure 2). This integrated approach aims to elucidate the material basis and mechanistic underpinnings of Aconitum pendulum N. Busch in RA treatment, providing a foundation for future drug development.

Access restricted. Please log in or start a trial to view this content.

Protocol

Fifty specific pathogen-free (SPF) male Sprague-Dawley rats (weighing 180–200 g) were supplied by the Hubei Provincial Center for Disease Control and Prevention (Hubei Provincial Academy of Preventive Medicine) (Wuhan, China; Animal License Certificate No. SCXK(JB) 2023-0005). All experimental procedures involving animals were conducted in strict accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals (8th edition, 2011). The study protocol was reviewed and approved by the Experimental Animal Ethics Committee of Tianjin Genink Biological Technology Co., Ltd. (Approval No. GENINK-20250074). Key reagents and equipment used in this study are listed in the accompanying Table of Materials.

Cell culture
The human rheumatoid arthritis (RA) cell line MH7A was cultured in Dulbecco's Modified Eagle Medium (DMEM) medium supplemented with 10% (v/v) fetal bovine serum (FBS) and maintained at 37 °C in a humidified incubator with 5% CO₂17.

Animals and treatments
Animals were kept in a standard specific pathogen-free (SPF) facility with an individually ventilated cage (IVC) system under strictly controlled environmental conditions: a climate-controlled temperature of 21.0–25.0 °C, relative humidity of 40–70%, a 12 h photoperiod, and complete air renewal 15 times per hour. After a 7-day acclimatization period, rats were randomly divided into six experimental groups, with additional rats reserved as backups for unforeseen circumstances. An acute inflammatory adjuvant arthritis (AA) model was induced by subcutaneous injection of 100 µL complete Freund's adjuvant (CFA; 10 mg·mL-1) into the right hind paw18. The experimental groups were designed as follows: a blank control group, an AA model group, a positive control group (methotrexate, 0.9 mg·kg-1)19, and three smirnotine A treatment groups administered at low- (0.962 mg·kg-1), medium- (1.923 mg·kg-1), and high-dose (3.846 mg·kg-1) levels based on the IC₅₀ value.

Prediction of disease and compound targets
Based on preliminary activity screening conducted by our research group, six compounds demonstrating favorable bioactivity were selected for investigation: five diterpenoid alkaloids (Figure 3), benzoylaconine (1), 14-benzoyl-8-O-methylaconine (2), (−)-(A-b)-14α-benzoyloxy-N-ethyl-13β, 15α-dihydroxy-1α,6α,8β,16β,18-pentamethoxyaconitane (3), smirnotine A (4), and aconitine (5), along with one coumarin derivative, scopoletin (6)20. The simplified molecular-input line-entry system (SMILES) notations of these compounds were retrieved from the PubChem database (https://pubchem.ncbi.nlm. nih.gov/) or generated using ChemDraw 18.0. These notations were subsequently imported into the SwissTargetPrediction database (https://swisstargetprediction.ch/), with the species specified as "Homo sapiens". Potential targets were identified by selecting genes with a probability value > 0, and corresponding Target Names and UniProt IDs were collected21,22.

PPI networks
The overlapping target genes were analyzed by protein-protein interaction (PPI) network using the STRING database (https://string-db.org/)23. The resulting TSV-formatted data was then imported into Cytoscape 3.9.1 for further visualization and analysis. Topological parameters of the network were calculated using the built-in Network Analyzer plugin. In the visualized network, node size and color intensity were mapped to degree value, while edge thickness reflected the strength of interaction between targets. Core targets were identified and ranked based on their association degree24.

Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis
The common targets were submitted to the Metascape database (https://metascape.org) for GO and KEGG pathway enrichment analyses25. Functional results were visualized using the WeiShengXin bioinformatics platform (https://www.bioinformatics.com.cn).

The network construction of the "drug-active components-disease-targets-pathways"
Active components and their corresponding targets were systematically screened, followed by functional enrichment analysis to identify major signaling pathways and their associated targets. These elements were subsequently integrated using Cytoscape 3.9.1 to construct a comprehensive "drug–active components–disease–targets–pathways" network. Topological analysis was then performed with the Network Analyzer tool, in which nodes were ranked based on key parameters, including Degree and Betweenness, to identify central elements within the network.

Molecular docking of key compounds to core targets
The three-dimensional structures of core target proteins, including ESR1 (9BQE), PTGS2 (5F19), EGFR (2XKN), GSK3B (5HLN), SRC (5MTJ), and ERBB2 (8U8X), were retrieved from the RCSB Protein Data Bank (http://www.rcsb.org/; accessed on 7 May 2025). Compound structures were constructed in ChemDraw (version 18.0) and subsequently converted into three-dimensional SDF format using the integrated Chem3D module. The molecular docking results were visualized with PyMOL, and the binding affinities were assessed according to interaction energy (kcal·mol-1)26.

Cell viability assay
MH7A cells in the logarithmic growth phase were seeded into 96-well plates at a density of 5 × 103 cells per well. Upon reaching 80% confluence, the cells were first treated with lipopolysaccharide (LPS) (1 µg·mL-1) for 6 h and then exposed to varying concentrations of smirnotine A (5, 25, 50, 75, and 100 µg·mL-1). Each treatment group was set up in quadruplicate and incubated for 24 h at 37 °C under 5% CO₂. After incubation, 100 µL of 10% CCK8 solution was added to each well, followed by additional incubation at 37 °C for 2 h. The absorbance at 450 nm was measured using a microplate reader.

ELISA assay in MH7A cells
The supernatant was collected by centrifugation at 2000 × g for 20 min at 4 °C. Levels of inflammatory cytokines, including IL-6, IL-1β, TNF-α, and IL-10, were quantified in the supernatant using corresponding ELISA kits, strictly according to the manufacturer's instructions.

Toe swelling degree measurement
The swelling degree of the right hind paw was evaluated by measuring paw volume every 3 days post-modeling. Measurements were taken twice per rat and averaged. The inflammatory response was quantified as the percentage increase in paw volume relative to the baseline.

Toe swelling degree formula; equation showing change in foot volume, research analysis.

Organ index measurement
All rats were anesthetized and euthanized 24 h after the final administration. The humane method recognized by the international veterinary community is adopted. First, a high concentration (5%) of isoflurane is used to deeply anesthetize the animal. Once it loses consciousness and all reflexes, the chest is opened, and the heart is cut, ensuring that the animal dies painlessly and without any sensation. The spleen and thymus were promptly excised and weighed. After rinsing with normal saline, excess moisture on the tissue surfaces was removed by blotting with filter paper, and the wet weights of the organs were recorded27,28.

Organ coefficient formula; equation; calculating organ mass to body mass ratio; education.

Hematoxylin and eosin (HE)
To preserve the integrity of the paw tissue samples, the entire portion distal to the right ankle joint of each rat was collected and stored. For sectioning, the swollen paw tissue was used. The sampling procedure was as follows: The tissue approximately 1 cm above the right ankle joint was completely dissected, the fur was removed, and the bone shaft was cut at the proximal end. The specimen was immediately fixed in 10% paraformaldehyde solution. After fixation, the tissue was placed in 15% EDTA decalcifying solution. Decalcification was monitored every 3 days, and the solution was refreshed as needed until the tissue softened, indicating completion of decalcification. The tissue was then dehydrated through a graded ethanol series (75% for 4 h, 85% for 2 h, 90% for 1.5 h, 95% for 1 h, and two changes of 100% ethanol for 0.5 h). Sections were deparaffinized, rehydrated through ethanol, stained with hematoxylin for 10 min, rinsed with tap water, differentiated in hydrochloric acid–ethanol for 10 s, rinsed with tap water, blued, rinsed again, immersed in 85% ethanol for 5 min, counterstained with eosin for 5 min, rinsed with tap water for 3 s, dehydrated, cleared, and mounted for observation29.

ELISA assay of rat serum
Blood samples were centrifuged at 2000 × g for 20 min at 4 °C, and the resulting supernatant was collected for cytokine analysis. The concentrations of IL-1β, IL-6, and TNF-α were determined using commercial ELISA kits, strictly in accordance with the manufacturer's protocols. A standard curve was generated and fitted using the cvxpt32 software, and the expression levels of each cytokine were calculated by interpolating the absorbance values into the corresponding standard curve equation. Final protein concentrations were calculated from the actual experimental measurements.

Quantitative polymerase chain reaction analysis (qPCR)
Total RNA was isolated from synovial cells using TRIzol reagent, with phase separation achieved by chloroform addition30. A commercial reverse transcription kit was then employed to synthesize cDNA from the isolated RNA, strictly following the manufacturer's instructions. qRT-PCR was performed using a SYBR Premix reagent. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the endogenous reference gene, and relative gene expression levels were calculated using the 2-ΔΔCt method. The following primer sequences were used: GAPDH Forward: ACAGCAACAGGGTGGTGGAC, and GAPDH Reverse: TTTGAGGGTGCAGCGAACTT; IL-17A Forward: CTGATGCTGTTGCTGCTACTGA, and IL-17A Reverse: TGGAACGGTTGAGGTAGTCTGA; TRAF6 Forward: ACATTTCCCTCTTTGTCCACAC, and TRAF6 Reverse: TTAGCATCCATGACCTCTTCGT; IL-10 Forward: CTGCAGGACTTTAAGGGTTACTT, and IL-10 Reverse: CTTGCTTTTATTCTCACAGGGGA; IL-1β Forward: CCTGTGTGATGAAAGACGGC, and IL-1β Reverse: TATGTCCCGACCATTGCTGT; IL-6 Forward: GTTGCCTTCTTGGGACTGATG, and IL-6 Reverse: TACTGGTCTGTTGTGGGTGGT.

Protein extraction and western blotting
Synovial tissue was lysed in phosphatase/protease inhibitor-supplemented radioimmunoprecipitation assay (RIPA) buffer, and protein concentrations were measured with a bicinchoninic acid (BCA) assay kit. For Western blotting, lysates containing equal amounts of protein were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and subsequently transferred onto polyvinylidene fluoride (PVDF) membranes. After blocking with 5% skim milk in Tris-buffered saline with 0.1% Tween (TBST) for 2 h at 25 °C, the membranes were incubated overnight at 4 °C with primary antibodies (GAPDH 1:50000; P-PI3K 1:1000; PI3K 1:1000; P-AKT 1:3000; AKT 1:6000). Following extensive washing with TBST, the membranes were reacted with horseradish peroxidase (HRP)-conjugated secondary antibodies (Anti-Mouse IgG 1:10000; Anti-rabbit IgG 1:1000) for 2 h at room temperature. Following another series of TBST washes, protein bands were visualized using an enhanced chemiluminescence (ECL) substrate. Band intensities were quantified with ImageJ software and normalized to GAPDH as the loading control.

Statistical analysis
All data were analyzed using Graphpad Prism 9.5 software and are presented as the mean ±± standard deviation. Statistical comparisons were performed using one-way ANOVA where appropriate. A p-value of less than 0.05 was considered statistically significant. Compared to the Control group: *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001; Compared to the Model/LPS group: #p < 0.05, ##p < 0.01, ###p < 0.001, and ####p < 0.0001.

Access restricted. Please log in or start a trial to view this content.

Results

Effects of A. pendulum derivatives on anti-RA target
The 3D structures of the six compounds were retrieved in SDF format, and the SMILES numbers were uploaded to the SwissTargetPrediction database for target prediction. Targets with a probability greater than 0 were retained, and the results were exported as a CSV file. After removing duplicates, a total of 97 potential compound-related targets were identified.

Disease targets associated with rheumatoid arthritis ...

Access restricted. Please log in or start a trial to view this content.

Discussion

This integrated study provides novel mechanistic insights into the anti-rheumatoid arthritis activity of smirnotine A, a C19-diterpenoid alkaloid from Aconitum pendulum N. Busch. Our findings demonstrate that smirnotine A ameliorates RA inflammation through targeted inhibition of the PI3K/Akt signaling pathway, representing a distinct mechanism from previously reported diterpenoid alkaloids.

The combination of network pharmacology prediction and molecular docking validation successful...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Acknowledgements

This research was financially supported by the Qinghai Science and Technology Department Natural Science Fund youth project (No. 2022-ZJ-950Q) and the National Natural Science Foundation of China (NSFC) (No. 82460845).

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
AceQ qPCR SYBR Green Master MixVazymeQ111
AKT (60 kDa) monoclonal mouse antibodyWuhan Sanying Biotechnology60203-2-Ig
BCA Protein Assay KitGuangzhou Jiebeisi BiotechnologyG3522
BSA StandardGuangzhou Jiebeisi BiotechnologyG8532
Complete Medium for MH7A cellsShanghai Fuheng BiotechnologyFH-MH7A
ELISA Kit for IL-10Lunchangshuo BiotechnologyED-13626
ELISA Kit for IL-17ALunchangshuo BiotechnologyED-10344
ELISA Kit for IL-1βLunchangshuo BiotechnologyED-10351
ELISA Kit for IL-6Lunchangshuo BiotechnologyED-10377
ELISA Kit for TNF-αLunchangshuo BiotechnologyED-11776
Fluorescence Quantitative PCR SystemApplied BiosystemsViiA-7
GAPDH monoclonal mouse antibodyWuhan Sanying Biotechnology60004-1-Ig
High-Speed Refrigerated CentrifugeHunan Kecheng Instrument EquipmentHI-16KR
HiScript II Q Select RT SuperMix for qPCRVazymeR223
HRP-labeled goat anti-mouse secondary antibodyWuhan Sanying BiotechnologySA00001-1
HRP-labeled goat anti-rabbit secondary antibodyBeyotime BiotechnologyA0208
Human rheumatoid arthritis fibroblast-like synoviocyte line MH7AQisai BiotechnologyQS-H075
Microplate ReaderBioTekMQX200
MicroscopeLeicaFLEXACAM C1
Multimode Microplate ReaderMolecular DevicesFlexStation 3
P-AKT (60 kDa) polyclonal rabbit antibodyWuhan Sanying Biotechnology28731-1-AP
Paraffin MicrotomeLeicaRM 2016
PCR AmplifierApplied BiosystemsproFlex
Phosphate Buffered Saline (1× PBS)Qisai BiotechnologyQS-S001
PI3K (85 kDa) polyclonal rabbit antibodyAffinityAF6241
P-PI3K (85 kDa) polyclonal rabbit antibodyAffinityAF3242
Smirnotine Aisolated and identified by our laboratoryC39H49NO11
Tissue DehydratorWuhan Junjie ElectronicJT-12J
Tissue Embedding MachineWuhan Junjie ElectronicJB-L6
Tissue Spreading and Baking MachineWuhan Junjie ElectronicJK-6
TrizolAmbion15596-026
Trypsin Cell Digestion Solution (0.25% trypsin,  with EDTA, without phenol red)Qisai BiotechnologyQS-S401

References

  1. Perera, J., Delrosso, C. A., Nerviani, A., Pitzalis, C. Clinical phenotypes, serological biomarkers, and synovial features defining seropositive and seronegative rheumatoid arthritis: a literature review. Cells. 13 (9), 743(2024).
  2. Jiang, N., Tian, X. P., Zeng, X. F. Interpretation on the 2024 Chinese for the diagnosis and treatment of rheumatoid arthritis. Med J PUMCH. 16 (1), 28-34 (2025).
  3. Nygaard, G., Firestein, G. S. Restoring synovial homeostasis in rheumatoid arthritis by targeting fibroblast-like synoviocytes. Nat Rev Rheumatol. 16 (6), 316-333 (2020).
  4. Dumoulin, Q. A., et al. Development of rheumatoid arthritis after methotrexate in anticitrullinated protein antibody-negative people with clinically suspect arthralgia at risk of rheumatoid arthritis: 4-year data from the TREAT EARLIER trial. Lancet Rheumatol. 6 (12), e827-e836 (2024).
  5. Zhang, R. Y., et al. Mechanisms of NLRP3 inflammasome in rheumatoid arthritis and osteoarthritis and the effects of traditional Chinese medicine. J Ethnopharmacol. 321, 117432(2024).
  6. Parveen, A., Wal, P., Kumar Rai, A., Wal, A. An outlook of substantial progress in nanotechnology emerged in treatment approaches for rheumatoid arthritis. Curr Drug Ther. 19 (3), 289-301 (2024).
  7. Shen, P., et al. Wutou decoction attenuates rheumatoid arthritis in rats through SIRT1-mediated deacetylation of the HMGB1/NF-κB pathway. J Ethnopharmacol. 337, 118921(2025).
  8. Wang, X. W., et al. Jingfang granules alleviates the lipid peroxidation induced ferroptosis in rheumatoid arthritis rats by regulating gut microbiota and metabolism of short chain fatty acids. J Ethnopharmacol. 339, 119160(2025).
  9. Wang, X. D., Mao, J. X. Systematic pharmacology-based strategy to investigate the mechanism of beta-sitosterol for the treatment of rheumatoid arthritis. Front Genet. 15, 1507606(2024).
  10. Liu, S., et al. Treatment of rheumatoid arthritis with alkaloids in natural medicines: a review. Mod Chin Med. 24 (4), 721-727 (2022).
  11. Tan, X. Y., et al. Rapid visual characterization of alkaloid changes in traditional processing of Tibetan medicine Aconitum pendulum by high-performance thin-layer chromatography coupled with desorption electrospray ionization mass spectrometry imaging. Front Pharmacol. 14, 1104473(2023).
  12. Yu, L. Q., et al. Traditional Tibetan medicine: therapeutic potential in rheumatoid arthritis. Front Pharmacol. 13, 938915(2022).
  13. Ai, C. Q. Sibu Yidian Sman Thang Detailed. , Qinghai Ethnic Publishing House. (2012).
  14. Zhang, X. R., et al. Medication regularity of Tibetan patent medicines for gZav-Grib disease based on data mining. Shanxi Med Periodical Press. 21 (16), 29923-29928 (2023).
  15. Liu, Y., et al. An integrated strategy of UPLC-Q-TOF/MS and HPTLC/PAD-DESI-MSI for the analysis of chemical variations: a case study of Tibetan medicine Tiebangchui. J Pharm Anal. 14 (4), 100907(2024).
  16. Li, C. Y., et al. Aconitum pendulum and Aconitum flavum: a narrative review on traditional uses, phytochemistry, bioactivities and processing methods. J Ethnopharmacol. 292, 115216(2022).
  17. Xie, C. M., et al. Triptolide suppresses human synoviocyte MH7A cells mobility and maintains redox balance by inhibiting autophagy. Biomed Pharmacother. 115, 108911(2019).
  18. Wang, X. W., et al. Exploration of protective effect and mechanism of Jingfang granules on rheumatoid arthritis based on network pharmacology and metabolomics. Chin Tradit Herb Drugs. 55 (23), 8067-8078 (2024).
  19. Yin, Q., et al. Anti-rheumatoid arthritis effects of traditional Chinese medicine Fufang Xiaohuoluo pill on collagen-induced arthritis rats and MH7A cells. Front Pharmacol. 15, 1374485(2024).
  20. Dong, D., et al. A new phenolic glycoside from roots of Aconitum pendulum. China J Chin Mater Med. 50 (22), 6380-6386 (2025).
  21. Wang, X., et al. Network pharmacology provides new insights into the mechanism of traditional Chinese medicine and natural products used to treat pulmonary hypertension. Phytomedicine. 135, 156062(2024).
  22. Nam, D. G., Kim, M., Choi, A. J., Choe, J. S. Health benefits of antioxidant bioactive compounds in ginger (Zingiber officinale) leaves by network pharmacology analysis combined with experimental validation. Antioxidants. 13 (6), 652(2024).
  23. Chen, G. Y., et al. Prediction of Rhizoma drynariae targets in the treatment of osteoarthritis based on network pharmacology and experimental verification. Evid Based Complement Alternat Med. 2021, 5233462(2021).
  24. Guo, Z. W., et al. Mechanism of crocin in improving Alzheimer's disease based on network pharmacology, molecular docking and cellular validation. Chin Tradit Herb Drugs. 56 (13), 4712-4723 (2025).
  25. Chen, G. Y., et al. Network pharmacology-based strategy to investigate the mechanisms of Cibotium barometz in treating osteoarthritis. Evid Based Complement Alternat Med. 2022, 1826299(2022).
  26. Zheng, Y. T., Xia, L. J., Zhang, X. J., Jin, M. Exploration of potential anti-inflammatory targets and key ingredients of Arisaematis rhizoma in treatment of major depressive disorder based on machine learning and molecular dynamics simulation. Chin Tradit Herb Drugs. 55 (15), 5174-5188 (2024).
  27. Guo, M., et al. Levamisole ameliorates rheumatoid arthritis by downregulating the PI3K/Akt pathway in SD rats. Pharmaceuticals. 17 (11), 1504(2024).
  28. Zhang, B. L., et al. Mechanism of Yiqi Yangyin Tongluo decoction regulating miR-885-5p/PTEN signaling pathway to regulate autophagy-inflammation in collagen-induced arthritis model rats. Liaoning J Tradit Chin Med. 52 (3), 182-189 (2025).
  29. Chen, G. Y., et al. Integrating network pharmacology and experimental validation to explore the key mechanism of Gubitong recipe in the treatment of osteoarthritis. Comput Math Methods Med. 2022, 7858925(2022).
  30. Li, J. Y., et al. Effect of Danggui Niantongtang on key factors of extrinsic and intrinsic apoptotic pathway in synovial tissue of adjuvant arthritis rats. Chin J Exp Tradit Med Form. 27 (4), 1-7 (2021).
  31. Xia, Z. X., Li, Q., Tang, Z. Y. Network pharmacology, molecular docking, and experimental pharmacology explored Ermiao wan protected against periodontitis via the PI3K/AKT and NF-κB/MAPK signal pathways. J Ethnopharmacol. 303, 115900(2023).
  32. Sabbah, D. A., Hajjo, R., Sweidan, K. Review on epidermal growth factor receptor (EGFR) structure, signaling pathways, interactions, and recent updates of EGFR inhibitors. Curr Top Med Chem. 20 (10), 815-834 (2020).
  33. Guo, X., et al. The antiangiogenic effect of total saponins of Panax japonicus CA Meyer in rheumatoid arthritis is mediated by targeting the HIF-1α/VEGF/ANG-1 axis. J Ethnopharmacol. 333, 118422(2024).
  34. Jiang, L., et al. Elucidating the role of Rhodiola rosea L. in sepsis-induced acute lung injury via network pharmacology: emphasis on inflammatory response, oxidative stress, and the PI3K-AKT pathway. Pharm Biol. 62 (1), 272-284 (2024).
  35. Bai, Y. M., Liang, S., Zhou, B. Yangyinghuoxue decoction exerts a treatment effect on hepatic fibrosis by PI3K-AKT pathway in rat model: based on network pharmacology and molecular docking. Aging (Albany NY). 16 (4), 3773(2024).
  36. Ba, X., et al. WTD attenuating rheumatoid arthritis via suppressing angiogenesis and modulating the PI3K/AKT/mTOR/HIF-1α pathway. Front Pharmacol. 12, 696802(2021).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Inflammatory ResponseNetwork PharmacologyMolecular DockingEnzyme Linked ImmunosorbentWestern BlotReal Time PCRTraditional Chinese Medicine

This article has been published

Video Coming Soon