Research Article

Bioinformatics and Quantitative Real-Time Polymerase Chain Reaction Analysis of SUCNR1 and GPR37L1 in Schizophrenia

DOI:

10.3791/71356

August 11th, 2026

In This Article

Summary

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

This study evaluates SUCNR1 and GPR37L1 as candidate schizophrenia-associated molecular markers through integrated bioinformatics analysis of the GSE54913 dataset, quantitative real-time polymerase chain reaction (qRT-PCR) validation, and correlation analysis with verbal memory in an independent cohort.

Abstract

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Schizophrenia is a severe, complex, and multifactorial mental disorder involving numerous genetic susceptibility elements, leading to substantial disability, morbidity, and mortality. Despite significant progress in understanding its pathophysiology and etiology, specific diagnostic biomarkers for schizophrenia remain elusive. This study aimed to identify candidate molecular markers associated with schizophrenia. An integrated bioinformatics analysis was performed on the public microarray dataset GSE54913. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses revealed that the most significantly enriched GO terms were related to channel activity, including passive transmembrane transporter activity, ion channel activity, gated channel activity, and substrate-specific channel activity. The top five enriched KEGG pathways were insulin secretion, cAMP signaling pathway, nucleotide excision repair, TNF signaling pathway, and glutathione metabolism. Validation was conducted using quantitative real-time polymerase chain reaction (qRT-PCR) on an independent sample set from Wuhan Rongjun Youfu Hospital. The qRT-PCR results were largely consistent with the microarray analysis (Pearson r = 0.89, 95% CI: 0.66–0.97). Protein-protein interaction (PPI) network analysis identified two hub genes, SUCNR1 and GPR37L1, which were significantly associated with the GO term ‘ion channel activity’ and enriched in the KEGG pathway ‘insulin secretion’. Furthermore, SUCNR1 expression showed a negative correlation with verbal memory scores (r = -0.54, P = 0.015), whereas GPR37L1 expression showed a positive correlation (r = 0.59, P = 0.0034). These findings suggest that altered SUCNR1 and GPR37L1 expression may be associated with schizophrenia and may represent candidate molecular markers for further investigation.

Introduction

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Schizophrenia is a chronic and complex mental disorder of unidentified etiology, characterized by severe brain dysfunction, cognitive impairment, and psychosocial deficits1. It poses a major global health burden, affecting over 21 million people worldwide2. Although diagnostic and therapeutic approaches have evolved considerably over the past fifty years, the core pathogenesis remains unclear, and long-term outcomes associated with substantial disability, morbidity, and mortality have not markedly improved3. Therefore, identifying potential pivotal genes and regulatory targets is imperative.

The pathophysiology of schizophrenia, while not fully elucidated, is widely attributed to genetic polymorphisms and expression variations4. For instance, genetic variation in the estrogen alpha gene may influence susceptibility to schizophrenia through alternative gene regulation and transcript processing5. Similarly, a functional promoter variant of NRG1 has been linked to schizophrenia and correlated with reduced expression of the type III NRG1 isoform6. Postmortem studies have shown significantly reduced expression of PDE4B isoforms in schizophrenic brains, suggesting its predictive potential7. Other candidates include the dopamine transporter (DAT), vesicular monoamine transporter (VMAT2), and monoamine oxidase (MAO), which regulate synaptic dopamine levels and may serve as biomarkers8. Additionally, TCP1 may contribute to cytoskeletal deficits via improper actin folding in schizophrenia9. Thus, elucidating gene expression profiles in the pathogenesis of schizophrenia could provide insights into risk prediction, mechanistic understanding, and therapeutic evaluation.

Recent computational approaches have advanced the identification of disease-associated genes through integrated network analysis and machine learning methods10,11,12. Despite numerous genetic studies, no reliable blood-based diagnostic biomarkers have been translated into clinical practice for schizophrenia. To address this gap, the present study employed an integrated bioinformatics approach to reanalyze the GSE54913 dataset, which contains blood-derived transcriptomic data from well-characterized patients with schizophrenia and healthy controls. The dataset was selected because (1) peripheral blood samples are minimally invasive and clinically practical, (2) it includes a relatively large sample size among publicly available schizophrenia microarray datasets, and (3) raw data were available for reanalysis. The objectives of this study were to: (1) identify differentially expressed genes in schizophrenia patients compared to healthy controls using the GSE54913 dataset; (2) perform functional enrichment and PPI network analyses to identify hub genes; (3) validate the expression of candidate genes by qRT-PCR in an independent cohort; and (4) explore the correlation of hub gene expression with verbal memory performance. To the authors’ knowledge, this is the first study to identify SUCNR1 and GPR37L1 as candidate blood-based molecular markers for schizophrenia.

Protocol

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

This study was approved by the Ethics Committee of Wuhan Rongjun Youfu Hospital (project identification code, YF-IRB202310215) and conducted in accordance with the principles of the Declaration of Helsinki. All participants were Chinese community residents and provided written informed consent.

Study subjects and blood sampling
Ten adults diagnosed with schizophrenia and ten healthy control volunteers with no family history of mental illness within three generations were enrolled. Inclusion criteria for schizophrenia patients: (1) diagnosis of schizophrenia according to DSM-5 criteria confirmed by two independent senior psychiatrists; (2) age 18–65 years; (3) no change in antipsychotic medication for at least 4 weeks prior to blood sampling; (4) willingness to provide written informed consent. Exclusion criteria: (1) comorbid major medical illnesses (e.g., diabetes, cardiovascular disease, cancer); (2) substance abuse or dependence within the past 6 months; (3) intellectual disability; (4) pregnancy or lactation. Inclusion criteria for healthy controls: (1) no personal or family history (within three generations) of any mental illness; (2) no current or past antipsychotic medication use; (3) age- and sex-matched to the schizophrenia group; (4) no major medical illnesses. Mean disease duration for schizophrenia patients was 12.5 ± 6.8 years; all patients were on stable antipsychotic medication (6 on risperidone, 4 on olanzapine); mean PANSS total score was 76.4 ± 12.3. Controls were matched for age (±5 years) and sex (5 males, 5 females per group). Verbal memory was assessed using the total recall score on the Hopkins Verbal Learning Test–Revised (HVLT-R). All subjects were recruited from Wuhan Rongjun Youfu Hospital between January 1 and July 31, 2025. Baseline demographics are summarized in Table 1.

Sample size was determined using sample size calculation software for a two-tailed independent t-test with an effect size of 1.2, α = 0.05, and power (1-β) = 0.80, yielding a minimum of nine subjects per group.

Venous blood was drawn into EDTA-anticoagulated tubes and processed without delay. Peripheral blood mononuclear cells (PBMCs) were then separated from the samples by density gradient centrifugation using density gradient medium. Briefly, blood was diluted 1:1 with phosphate-buffered saline (PBS, pH 7.4), layered onto the density gradient medium, and centrifuged at 400 × g for 30 min at 20 °C with the brake off. After centrifugation, the PBMC-containing interface was carefully transferred to a new tube. The cells were rinsed twice with PBS, with each wash followed by centrifugation at 300 × g for 10 min at 4 °C, and the final pellet was suspended in PBS. Viability was evaluated using the trypan blue dye-exclusion method, and only preparations with ≥95% viable cells were used. Isolated PBMCs were aliquoted and stored at −80 °C for a maximum of 3 months before RNA extraction.

Microarray data
The workflow of the study is shown in Figure 1. The microarray dataset GSE54913 was downloaded from the GEO database (http://www.ncbi.nlm.nih.gov/geo/). This dataset was selected because (1) it contains transcriptomic data from peripheral blood samples, which are minimally invasive and clinically practical for biomarker discovery; (2) it includes a relatively large sample size among publicly available schizophrenia microarray datasets (18 patients, 12 controls); (3) the raw data were available for reanalysis. According to the GEO record, the samples were derived from peripheral blood mononuclear cells (PBMCs), not plasma. The original description ‘plasma samples’ in the previous version was an error and has been corrected.

Data preprocessing and differentially expressed gene (DEG) screening
Raw data (.CEL files) were preprocessed using microarray preprocessing software. Background correction was performed using the Robust Multichip Average (RMA) method, followed by quantile normalization and log2 transformation. Probesets without any gene annotation were filtered out. Probes with >20% missing values across samples were excluded; missing values for remaining probes were imputed using the k-nearest neighbors algorithm (k = 10) implemented in missing-value imputation software. Batch effects were not present as all samples were processed in a single batch according to the GEO record. After preprocessing, expression values for 17,200 genes were obtained for downstream analysis. DEGs between schizophrenia patients and healthy controls were identified using differential expression analysis software. Genes with a false discovery rate (FDR) < 0.05, absolute fold change (FC) > 1.2, and P < 0.05 were considered differentially expressed. A relatively low FC threshold (absolute FC > 1.2) was chosen because schizophrenia is a complex psychiatric disorder in which individual gene expression differences are often subtle rather than dramatic.

GO and pathway enrichment analyses
Functional enrichment analyses for Gene Ontology (GO) terms and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways were performed using functional enrichment analysis software. The background gene set consisted of all genes that passed preprocessing (17,200 genes). Enrichment terms and pathways with raw P-values < 0.05 were reported. Because raw P-values were used for GO and KEGG enrichment outputs, these results should be interpreted as exploratory.

PPI network analysis and hub gene identification
A protein-protein interaction database was used to construct a PPI network, with a combined interaction score > 0.9 set as the threshold. The network was visualized using network visualization software. Hub genes were identified using a hub gene identification plugin with the Degree algorithm. The top 10 nodes with the highest degree scores were selected as hub genes. The subnetwork of key hub genes was extracted using a subnetwork extraction plugin with default parameters (degree cutoff = 2, node score cutoff = 0.2, K-core = 2, max depth = 100).

Total RNA isolation and qRT-PCR
β-Actin was used as the internal reference (housekeeping) gene. The stability of β-actin expression across samples was confirmed by no significant difference in Ct values between the schizophrenia and control groups (P > 0.05). Relative quantification was performed using the 2−ΔΔCt method. All reactions were performed in triplicate, and the mean Ct value was used for calculation (see primer sequences in Table 2). The top ten DEGs (five most significantly upregulated and five most significantly downregulated by fold change) were selected for initial qRT-PCR validation to confirm the overall reliability of the microarray data. Subsequently, SUCNR1 and GPR37L1 were selected for focused validation based on three criteria: (1) they were identified as hub genes in the PPI network analysis (degree ≥ 7); (2) they were significantly associated with the top enriched GO term ‘ion channel activity’ and the KEGG pathway ‘insulin secretion’; (3) both encode GPCRs, which are known drug targets in schizophrenia.

Statistical analysis
Normality was evaluated with the Shapiro–Wilk test. Variables showing an approximately normal distribution (P > 0.05) were analyzed using parametric methods, including Student’s t-test for two-group comparisons and one-way ANOVA for comparisons involving more than two groups. When the normality assumption was not met, Mann–Whitney U or Kruskal–Wallis tests were used, as appropriate. All statistical tests were two-tailed. For multiple comparisons (e.g., in ANOVA post-hoc tests), the Benjamini-Hochberg false discovery rate (FDR) method was applied, with an FDR threshold of 0.05. For correlation analyses, no multiple-comparison correction was applied, as only two correlations were performed; the raw P-values are reported with caution.

Results

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Identification of DEGs and hierarchical clustering
Analysis of the GSE54913 dataset identified 473 differentially expressed genes (DEGs), including 357 upregulated and 116 downregulated genes, between schizophrenia patients and controls (Figure 2A,B). Hierarchical clustering of these DEGs distinguished schizophrenia samples from controls (Figure 2C).

Functional enrichment analysis of DEGs
GO enrichment analysis identified terms related to channel activity, including passive transmembrane transporter activity, ion channel activity, gated channel activity, and substrate-specific channel activity (raw P < 0.05; Table 3). KEGG pathway analysis identified insulin secretion, the cAMP signaling pathway, nucleotide excision repair, the TNF signaling pathway, and glutathione metabolism as the top enriched pathways (raw P < 0.05; Figure 3C and Table 4).

Validation of top DEGs by qRT-PCR
The top five downregulated genes (HCN3, OLFML2A, NOX1, MRGPRX1, and BRIP1) and the top five upregulated genes (CCL22, PNMA2, TBX20, ERAS, and C12orf68) were validated by qRT-PCR. The validated genes and corresponding microarray logFC values are listed in Table 5, qRT-PCR validation is shown in Figure 4, and raw Ct values are provided in Supplemental Table S1. The qRT-PCR fold changes were directionally consistent with microarray data for all ten genes (all P < 0.05 by Mann-Whitney U test). Pearson correlation between microarray logFC and qRT-PCR logFC was r = 0.89 (95% CI: 0.66–0.97, P = 0.0004), indicating strong agreement. SUCNR1 and GPR37L1 expression differences were also confirmed (Figure 5A,B).

PPI network analysis
A PPI network was constructed from all DEGs (interaction score > 0.9; Figure 6A). The top ten hub proteins based on degree of connectivity were RTP5 (degree = 14), CXCL1 (degree = 8), CXCL10, GPR37L1, HCAR1, OPRL1, P2RY4, SSTR4, SUCNR1 (degree = 7), and ATM (degree = 5) (Figure 6B and Table 6). A subnetwork of key hub genes was extracted using a subnetwork extraction plugin with default parameters. The subnetwork extraction algorithm identified a densely connected cluster containing RTP5, CXCL1, CXCL10, GPR37L1, HCAR1, OPRL1, P2RY4, SSTR4, and SUCNR1, with a cluster score of 6.2. ATM was not included in the subnetwork because it had lower connectivity with the core cluster (Figure 6C).

Association between verbal memory and SUCNR1/GPR37L1
SUCNR1 expression was significantly elevated, whereas GPR37L1 expression was reduced, in patients with schizophrenia compared with healthy controls (Figure 5A,B). SUCNR1 expression showed a negative correlation with verbal memory scores (r = -0.54, 95% CI: -0.79 to -0.13, R2 = 0.287, P = 0.015; Figure 5C), whereas GPR37L1 expression showed a positive correlation with verbal memory scores (r = 0.59, 95% CI: 0.20 to 0.82, R2 = 0.349, P = 0.0034; Figure 5D). Correlation analyses were performed on all 20 subjects, including 10 schizophrenia patients and 10 healthy controls. With a sample size of 20, the study had 80% power to detect a correlation coefficient of |r| > 0.6 at α = 0.05. Given the modest sample size, these correlational findings are preliminary and require validation in larger independent cohorts.

Data Availability Statement
The GSE54913 dataset analyzed in this study is publicly available from the Gene Expression Omnibus. Raw qRT-PCR Ct values are provided in Supplemental Table S1. The analysis scripts, DEG output files, enrichment results, PPI network files, and figure source files are available at https://sandbox.zenodo.org/records/514960 or 10.5072/zenodo.514960.

figure-results-1
Figure 1: Flow diagram: data collection, preprocessing, analysis, and validation. mRNA microarray analyses on PBMCs obtained from GSE54913. GO functional and pathway enrichment analyses were performed on the DEGs. The top 10 genes ranked by fold change were selected for validation of microarray data using qRT‑PCR. PPI network analysis identified two hub genes. Finally, ex vivo analysis of the two hub genes SUCNR1 and GPR37L1 was conducted. Abbreviations: DEGs = differentially expressed genes; mRNA = messenger RNA; PBMCs = peripheral blood mononuclear cells; qRT‑PCR = quantitative real‑time polymerase chain reaction; PPI = protein–protein interaction. Please click here to view a larger version of this figure.

figure-results-2
Figure 2: DEG selection and hierarchical clustering analysis. (A) Volcano plot of DEGs. The horizontal axis represents log₂(fold change), and the vertical axis represents –log₁₀(P value). Green and red dots represent differentially expressed genes, and black dots represent non-differentially expressed genes. (B) Numbers of downregulated and upregulated DEGs. (C) Heat map of differentially expressed genes. Red indicates upregulation and green indicates downregulation. Abbreviation: DEGs = differentially expressed genes. Please click here to view a larger version of this figure.

figure-results-3
Figure 3: GO and KEGG enrichment analyses of DEGs. (A,B) GO enrichment and (C) KEGG enrichment are shown based on raw P-values. Abbreviations: DEGs = differentially expressed genes; GO = Gene Ontology; KEGG = Kyoto Encyclopedia of Genes and Genomes; BP = biological process; CC = cellular component; MF = molecular function. Please click here to view a larger version of this figure.

figure-results-4
Figure 4: Validation of microarray data for the top ten dysregulated genes using qRT-PCR. (A) Downregulated top five DEGs. (B) Upregulated top five DEGs. Data are mean ± standard error of the mean. P values are shown in the corresponding panels. Abbreviations: DEGs = differentially expressed genes; qRT‑PCR = quantitative real‑time polymerase chain reaction. Please click here to view a larger version of this figure.

figure-results-5
Figure 5: SUCNR1 and GPR37L1 expression in schizophrenia patients and healthy controls. (A) SUCNR1 and (B) GPR37L1 expression determined by qRT-PCR. Correlation between verbal memory and (C) SUCNR1 and (D) GPR37L1 expression. Data are shown as mean ± standard error of the mean where applicable. P values for correlations are shown in the corresponding panels. Please click here to view a larger version of this figure.

figure-results-6
Figure 6: Protein-protein interaction network analysis. (A) PPI network analyzed using a protein-protein interaction database. (B) Proteins ranked by degree of association in the PPI network. (C) Subnetwork visualized using network visualization software after subnetwork extraction analysis. Abbreviation: PPI = protein-protein interaction. Please click here to view a larger version of this figure.

VariableControl subjects (n = 10)Schizophrenia patients (n = 10)
Age (year)36.5 ± 10.644.5 ± 9.5
Female sex, n (%)5 (50)5 (50)
Daily sleep time (h)5.4 ± 3.17.5 ± 1.2
Body mass index (BMI; kg/m²)25.2 ± 4.122.9 ± 2.3
Verbal memory score61 ± 1830.2 ± 10.8
Data are presented as mean ± standard deviation or number (%).

Table 1: Baseline characteristics of schizophrenia patients and control subjects.

Gene symbolForward primer sequence (5'→3')Reverse primer sequence (5'→3')
HCN3GTCCGCCGGGGCCTGGATCCTCCCACTGGTGTATGTAGC
OLFML2ACAGGCAGAGCGGGCGAAGAATATTTGCGGACTGGGTCA
NOX1CACCCCAAGTCTGTAGTGGGAGCCAGACTGGAATATCGGTGACA
MRGPRX1CTAGGGTACCACGGAGGATTTGGTTCTGGAGGCTCCTTGC
BRIP1CAGATGAGGGCG-TAAGTGACGTCCTCCGGAGCTCTCTAG
CCL22TCCATCATCTCTTCTGACTCTGACTGTGGGTCAGAGTCAGAAGAGA
PNMA2GCGGGTCAATTCTCGGGACAGTCCTGCCCCCAGGTGGTTT
TBX20GAGGGAAAGTGTGGAGAGCCAAGGCTGACCCTCGATTTGG
ERASAGTCTATTATTTCGGGCACCCCTTCGTGGTTCCCTGAGAC
C12orf68TTCAACCCCTACACCGAGTTCTTGAACGTGGACTGCAGC
GPR37L1ATGTTTCTTGCCGAGCAGTGCCACATGGAATCGGTCTAT
SUCNR1ACAGAAGCCGACAGCAGAATGCACAGGAAAGCAAAGTCAG
β-ActinCTAAGGCCAACCGTGAAAAGGCATACAGGGACAACACAG
qRT-PCR: quantitative real-time polymerase chain reaction.

Table 2: PCR primers for qRT-PCR.

GO IDTermRaw P-valueCount
GO:0015267channel activity0.00000005613
GO:0022803passive transmembrane transporter activity5.78E-0813
GO:0005216ion channel activity0.00000012712
GO:0022839ion gated channel activity0.00000013111
GO:0022836gated channel activity0.00000013611
GO:0022838substrate-specific channel activity0.0000001712
GO:0005261cation channel activity0.000006689
GO:0015276ligand-gated ion channel activity0.0003155
GO:0022834ligand-gated channel activity0.00031520
GO:0022890inorganic cation transmembrane transporter activity0.00048720
GO:0008324cation transmembrane transporter activity0.000918
GO:0099094ligand-gated cation channel activity0.0012816
GO:0005244voltage-gated ion channel activity0.00138216
GO:0022832voltage-gated channel activity0.00138218
GO:0046873metal ion transmembrane transporter activity0.00183621
GO:0022824transmitter-gated ion channel activity0.00276219
GO:0022835transmitter-gated channel activity0.00276213
Note: P-values are raw and unadjusted; significance was defined as raw P < 0.05.

Table 3: Gene ontology analysis of differentially expressed genes (raw P < 0.05).

IDDescriptionRaw P-valueCount
hsa04911Insulin secretion0.0070666
hsa04024cAMP signaling pathway0.01066110
hsa03420Nucleotide excision repair0.0137244
hsa04668TNF signaling pathway0.0236946
hsa00480Glutathione metabolism0.024664
hsa04740Olfactory transduction0.03210415
hsa05222Small cell lung cancer0.035725
hsa00590Arachidonic acid metabolism0.0359914
hsa04080Neuroactive ligand-receptor interaction0.03754612
hsa05031Amphetamine addiction0.0456534
hsa05203Viral carcinogenesis0.0464048
hsa04933AGE-RAGE signaling pathway in diabetic complications0.048315
Note: P-values are raw and unadjusted; significance was defined as raw P < 0.05.

Table 4: Kyoto Encyclopedia of Genes and Genomes enrichment analysis of genes (raw P < 0.05).

Gene symbolOfficial full namelogFCRaw P-value
Downregulated
HCN3Hyperpolarization-activated cyclic nucleotide-gated channel 3-1.4890.0001
OLFML2AOlfactomedin-like protein 2A-1.5210.0042
NOX1NADPH oxidase 1-1.5220.0022
MRGPRX1Mas-related G-protein coupled receptor member X1-1.5260.0003
BRIP1Fanconi anemia group J protein-1.6990.0018
Upregulated
CCL22C-C motif chemokine 222.5170.0041
PNMA2Paraneoplastic Ma antigens2.1590.0062
TBX20T-box transcription factor TBX201.8660.0001
ERASGTPase Eras1.8460.0008
C12orf68Coiled-coil domain containing 1841.8390.0002
Note: logFC and raw P-values are from the microarray differential expression analysis.

Table 5: Top ten DEGs ranked by fold change in upregulated and downregulated genes.

Gene symbolDescriptionCo-genes (n)P-value
RTP5Receptor transporter protein 5140.000276
CXCL1Growth-regulated alpha protein 180.011423
CXCL10C-X-C motif chemokine 1070.046144
GPR37L1Prosaposin receptor GPR37L170.003792
HCAR1Hydroxycarboxylic acid receptor 170.046572
OPRL1Nociceptin receptor 170.039753
P2RY4P2Y purinoceptor 470.001279
SSTR4Somatostatin receptor type 470.006742
SUCNR1Succinate receptor 170.000105
ATMSerine-protein kinase ATM50.004961
PPI: protein-protein interaction; DEGs: differentially expressed genes.

Table 6: Top 10 hub genes identified in the PPI network for DEGs.

Supplementary Table 1: Raw qRT‑PCR Ct Values, Complete Bioinformatics Analysis Workflow, and Processed Results (DEG, GO/KEGG, and PPI) for the Study Please click here to download this File.

Discussion

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Schizophrenia is a severe, multifactorial disorder involving numerous genetic susceptibility factors13,14. While progress has been made in understanding its pathophysiology, reliable diagnostic biomarkers are still lacking. In this study, an integrated bioinformatics approach identified 473 DEGs in blood samples from patients with schizophrenia. GO and KEGG analyses highlighted enrichment in channel activity-related terms and pathways, including insulin secretion, cAMP signaling, nucleotide excision repair, TNF signaling, and glutathione metabolism. PPI network analysis further identified SUCNR1 and GPR37L1 as hub genes, and their expression was associated with verbal memory performance, suggesting their potential relevance as schizophrenia-associated molecular markers.

The enrichment of "channel activity" GO terms aligns with prior schizophrenia research. Voltage-gated calcium channels (e.g., CACNA1C, CACNB2) and potassium channels (e.g., Kv3, Kv2.1) have been implicated in susceptibility to schizophrenia and neuronal excitability 15,16. Similarly, the top KEGG pathways identified are consistent with existing literature. Hyperinsulinemia and insulin secretion abnormalities are reported in early schizophrenia17. The cAMP signaling pathway is increasingly linked to disease pathophysiology18. Nucleotide excision repair mechanisms, including histone variant H2AX modification, may also play a role19,20,21,22. Furthermore, TNF signaling and glutathione metabolism have been associated with schizophrenia pathogenesis23,24.

Verbal memory impairment is a core cognitive deficit in schizophrenia, is present at illness onset, and is associated with functional outcomes. The Hopkins Verbal Learning Test–Revised (HVLT-R) is a well-validated measure of verbal learning and memory. Assessing the correlation between candidate marker expression and verbal memory performance helps establish clinical relevance, as cognitive impairment is a major determinant of disability in schizophrenia.

Although the top ten DEGs validated by qRT-PCR matched microarray data, they did not align closely with the primary GO/KEGG findings. In contrast, SUCNR1 (upregulated) and GPR37L1 (downregulated) were significantly associated with "ion channel activity" and enriched in "insulin secretion." Both genes encode G protein-coupled receptors (GPCRs), which are critical targets of antipsychotics and modulate ion channel activity25.

SUCNR1 (GPR91) links metabolic stress to insulin secretion and resistance26,27, and insulin resistance is a known risk factor for schizophrenia28. GPR37L1, an orphan receptor highly expressed in the brain, is involved in cerebellar development and motor function29, and has been implicated in Parkinson’s disease30 and renal sodium transport31. Its role in schizophrenia may involve modulation of ion channel activity.

Verbal memory impairment is a core feature of schizophrenia, reflecting genetic liability and disease severity32,33. The inverse correlation of SUCNR1 expression and the positive correlation of GPR37L1 expression with verbal memory scores further support their potential relevance in schizophrenia.

Several limitations should be acknowledged. First, the sample size for the validation cohort (n = 10 per group) was small, which limits statistical power and generalizability. Second, all schizophrenia patients were receiving antipsychotic medications, so the observed expression changes may reflect medication effects rather than disease pathology. Future studies should include drug-naïve first-episode patients. Third, the validation cohort lacked RNA-seq confirmation; transcriptome-wide sequencing in larger independent cohorts is warranted. Fourth, the cross-sectional design precludes assessment of causal relationships between biomarker levels and disease progression. Fifth, the correlation analyses with verbal memory were exploratory and require replication. Sixth, the GSE54913 dataset was generated on a microarray platform that has lower sensitivity than RNA-seq. Future directions include longitudinal studies to track SUCNR1 and GPR37L1 levels over the course of illness and treatment, functional studies to elucidate the mechanistic roles of these GPCRs in the pathophysiology of schizophrenia, and the development of a clinically validated assay for these biomarkers.

In summary, this integrated analysis suggests that altered SUCNR1 and GPR37L1 expression is associated with schizophrenia and verbal memory performance. These genes may represent candidate schizophrenia-associated molecular markers. However, limitations include a relatively small sample size and the partial assessment of schizophrenia severity through verbal memory. Further studies are warranted to validate these findings.

Disclosures

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The authors have no conflicts of interest to declare.

Acknowledgements

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

This study was supported by the Noncommunicable Chronic Diseases-National Science and Technology Major Project of China (2025ZD0549004).

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
affyBioconductorhttps://bioconductor.org/packages/affy/microarray preprocessing software.
Description: R package for microarray preprocessing
clusterProfilerBioconductorhttps://bioconductor.org/packages/clusterProfiler/functional enrichment analysis software.
Description: R package for functional enrichment analysis
CytoHubbaNational Institute of Bioinformaticshttps://apps.cytoscape.org/apps/cytohubbahub gene identification plugin.
Description: Cytoscape plugin for hub gene identification
CytoscapeCytoscape Consortiumhttps://cytoscape.org/network visualization software.
Description: Software for network visualization and analysis
G*PowerHeinrich Heine University Düsseldorfhttps://www.psychologie.hhu.de/arbeitsgruppen/allgemeine-psychologie-und-arbeitspsychologie/gpower sample size calculation software.
Description: Sample size calculation software
GraphPad PrismGraphPad Softwarehttps://www.graphpad.com/statistical analysis and graphing software.
Description: Statistical analysis and graphing software
Histopaque-1077Sigma-Aldrich10771density gradient medium.
Description: Density gradient medium for PBMC isolation
imputeBioconductorhttps://bioconductor.org/packages/impute/missing-value imputation software.
Description: R package for missing-value imputation
LimmaBioconductorhttps://bioconductor.org/packages/limma/differential expression analysis software.
Description: R package for differential expression analysis
MCODECytoscape apphttps://apps.cytoscape.org/apps/mcodesubnetwork extraction plugin.
Description: Cytoscape plugin for subnetwork extraction
R/BioconductorR Foundationhttps://www.r-project.org/statistical computing environment.
Description: Statistical computing environment
STRINGEMBLhttps://string-db.org/protein-protein interaction database.
Description: Protein-protein interaction database
SYBR GreenTakaraRR820A fluorescent dye for qRT-PCR.
Description: Fluorescent dye for qRT-PCR
TRIzolTakara9109RNA extraction reagent.
Description: Reagent for RNA extraction

References

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,
  1. Memetoglu O, Du F, Chouinard VA, Öngür D. Reductive stress and dysregulated energy metabolism in schizophrenia: mechanisms and therapeutic targets. Biol Psychiatry. 2025. doi:10.1016/j.biopsych.2025.10.008.
  2. GBD 2023 Intimate Partner Violence and Sexual Violence against Children Collaborators. Disease burden attributable to intimate partner violence against females and sexual violence against children in 204 countries and territories, 1990-2023: a systematic analysis for the Global Burden of Disease Study 2023. Lancet. 2025;407(10523):31-52.
  3. Raaphorst J, et al. Non-targeted immunosuppressive and immunomodulatory therapies for idiopathic inflammatory myopathies. Cochrane Database Syst Rev. 2025;8(8).
  4. Richetto J, Meyer U. Epigenetic modifications in schizophrenia and related disorders: molecular scars of environmental exposures and source of phenotypic variability. Biol Psychiatry. 2021;89(3):215-26.
  5. Martorell L, et al. Analyses of variants located in estrogen metabolism genes (ESR1, ESR2, COMT and APOE) and schizophrenia. Schizophr Res. 2008;100(1-3):308-15.
  6. Zieba J, Morris MJ, Weickert CS, Karl T. Behavioural effects of high fat diet in adult Nrg1 type III transgenic mice. Behav Brain Res. 2020;377:112217.
  7. Luo N, et al. Exploring different impaired speed of genetic-related brain function and structures in schizophrenic progress using multimodal analysis. Annu Int Conf IEEE Eng Med Biol Soc. 2018;2018:4126-9.
  8. Garcia-Alvarez L, et al. Differential blood-based biomarkers of psychopathological dimensions of schizophrenia. Rev Psiquiatr Salud Ment. 2016;9(4):219-27.
  9. Chu TT, Liu Y. An integrated genomic analysis of gene-function correlation on schizophrenia susceptibility genes. J Hum Genet. 2010;55(5):285-92.
  10. Gardner A, Mitchell B, Beckingham W, Fasugba O. A point prevalence cross-sectional study of healthcare-associated urinary tract infections in six Australian hospitals. BMJ Open. 2014;4(7).
  11. Bindu NJ, et al. Discovery of biomarkers and drug targets in different kidney diseases by explainable AI and functional genomics [conference paper]. Presented at: 2025 7th International Conference on Electrical Information and Communication Technology; 2025 Dec 17-19.
  12. Saha S, et al. Unveiling common biomarkers and therapeutic targets in T2DM, AMI, and Alzheimer’s disease using XAI and bioinformatics approaches [conference paper]. Presented at: 2025 7th International Conference on Electrical Information and Communication Technology; 2025 Dec 17-19.
  13. Ferraro F, et al. Correcting differential gene expression analysis for cyto-architectural alterations in substantia nigra of Parkinson’s disease patients reveals known and potential novel disease-associated genes and pathways. Cells. 2022;11(2):198.
  14. Reay WR, et al. Polygenic disruption of retinoid signalling in schizophrenia and a severe cognitive deficit subtype. Mol Psychiatry. 2020;25(4):719-31.
  15. Ma D, Gu C. Discovering functional interactions among schizophrenia-risk genes by combining behavioral genetics with cell biology. Neurosci Biobehav Rev. 2024;167:105897.
  16. Gawande DY, et al. GluN2D subunit in parvalbumin interneurons regulates prefrontal cortex feedforward inhibitory circuit and molecular networks relevant to schizophrenia. Biol Psychiatry. 2023;94(4):297-309.
  17. Baez-Nieto D, et al. Analysing an allelic series of rare missense variants of CACNA1I in a Swedish schizophrenia cohort. Brain. 2022;145(5):1839-53.
  18. Calovi S, et al. P2X7 receptor-dependent layer-specific changes in neuron-microglia reactivity in the prefrontal cortex of a phencyclidine-induced mouse model of schizophrenia. Front Mol Neurosci. 2020;13:566251.
  19. Petruzzelli MG, et al. Hyperprolactinemia and insulin resistance in drug-naive patients with early onset first episode psychosis. BMC Psychiatry. 2018;18(1):246.
  20. Fan R, et al. Gα13 overexpression in the medial prefrontal cortex disrupts social behavior through the Adcyap1/cAMP/PKA/NMDAR pathway. Schizophr Bull. 2025. doi:10.1093/schbul/sbaf131.
  21. Ershova ES, et al. Antipsychotics affect satellite III (1q12) copy number variations in the cultured human skin fibroblasts. Int J Mol Sci. 2023;24(14):11283.
  22. Wei Y, et al. Unraveling cannabidiol’s dual modulatory role in schizophrenia: network pharmacology and in vivo validation of neuroinflammatory and behavioral modulation. Mol Neurobiol. 2026;63:278.
  23. Górny M, Lorenc-Koci E, Iciek M. Deficyt glutationu i zaburzenia homeostazy związków siarkowych w patofizjologii schizofrenii. Postepy Biochem. 2025;71(3):228-37.
  24. Boczek T, et al. The role of G protein-coupled receptors and calcium signaling in schizophrenia: focus on GPCRs activated by neurotransmitters and chemokines. Cells. 2021;10(5):1228.
  25. Sabadell-Basallote J, et al. SUCNR1 regulates insulin secretion and glucose elevates the succinate response in people with prediabetes. J Clin Invest. 2024;134(12).
  26. van Diepen JA, et al. SUCNR1-mediated chemotaxis of macrophages aggravates obesity-induced inflammation and diabetes. Diabetologia. 2017;60(7):1304-13.
  27. Guest PC. Insulin resistance in schizophrenia. Adv Exp Med Biol. 2019;1134:1-16.
  28. Bang S, et al. Satellite glial GPR37L1 and its ligand maresin 1 regulate potassium channel signaling and pain homeostasis. J Clin Invest. 2024;134(9).
  29. Massimi M, Di Pietro C, La Sala G, Matteoni R. Mouse mutants of Gpr37 and Gpr37l1 receptor genes: disease modeling applications. Int J Mol Sci. 2022;23(8):4288.
  30. Zheng X, Asico LD, Ma X, Konkalmatt PR. G protein-coupled receptor 37L1 regulates renal sodium transport and blood pressure. Am J Physiol Renal Physiol. 2019;316(3).
  31. Tranfa M, et al. Neural substrates of verbal memory impairment in schizophrenia: a multimodal connectomics study. Hum Brain Mapp. 2023;44(7):2829-40.
  32. Sumiyoshi T. Verbal memory. Handb Exp Pharmacol. 2015;228:237-47.
  33. Grimes KM, Zanjani A, Zakzanis KK. Memory impairment and the mediating role of task difficulty in patients with schizophrenia. Psychiatry Clin Neurosci. 2017;71(9):600-11.

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Tags

Schizophrenia BiomarkersSUCNR1 ExpressionGPR37L1 ExpressionBioinformatics AnalysisQuantitative Real Time PCRMicroarray DatasetGene OntologyKEGG PathwayIon Channel ActivityProtein Interaction Network

Related Articles