Circulerende MicroRNA Kwantificering Met behulp van DNA-bindende Dye Chemistry and Droplet Digital PCR

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Ferracin, M., Salamon, I., Lupini, L., Miotto, E., Sabbioni, S., Negrini, M. Circulating MicroRNA Quantification Using DNA-binding Dye Chemistry and Droplet Digital PCR. J. Vis. Exp. (112), e54102, doi:10.3791/54102 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Circulerende (celvrij) microRNA's (miRNA's) zijn vrijgemaakt uit cellen in de bloedbaan. De hoeveelheid specifieke miRNA bij de omloop is gekoppeld aan een ziektetoestand en heeft het potentieel om te worden gebruikt als biomarker ziekte. Een gevoelige en nauwkeurige methode voor het circuleren van microRNA kwantificering met behulp van een op kleurstoffen gebaseerde chemie en druppeltje digitale PCR-technologie is onlangs ontwikkeld. Specifiek met behulp Locked Nucleic Acid (LNA) -gebaseerde miRNA-specifieke primers met een groen fluorescerend DNA-bindende kleurstof in een compatibel digitaal druppeltje PCR systeem is het mogelijk om de absolute kwantificering van specifieke miRNAs verkrijgen. Hier wordt beschreven hoe het uitvoeren van deze techniek om miRNA hoeveelheid in biologische vloeistoffen, zoals plasma en serum beoordelen, is haalbaar en effectief.

Protocol

MicroRNA isolatie uit plasma of serum

Opmerking: Plasma en serum voorbereiding is een belangrijke fase in circulerende miRNA kwantificering. Er is geen voorkeurswerkwijze voor plasma en serum bereiding. Het enige belangrijke ding om te overwegen is dat alle monsters van hetzelfde experiment moet worden verwerkt met behulp van exact dezelfde workflow. Start vanaf 200 pl serum of plasma. Totaal RNA kan worden geïsoleerd uit serum of plasma met behulp van commercieel verkrijgbare kits.

1. Protocol voor Total RNA (inclusief miRNA) Isolatie

  1. Dooi serum / plasma monsters op ijs.
  2. Voeg 1 ml Lysis Reagent (bijv., QIAzol) aan 200 gl serum / plasma.
  3. Door vortexen gemengd en plaats de buis met het homogenaat op de bank bij kamertemperatuur 5 minuten.
  4. Voeg 3 ul van een 4,16 nM oplossing van het synthetische miRNA cel-miR-39-3p van C. elegans.
  5. Voeg 200 pl chloroform. Schud de buis krachtig gedurende 15 seconden. plaats the buis op de bank bij kamertemperatuur gedurende 2 minuten.
  6. Centrifugeer gedurende 15 minuten bij 12.000 xg bij 4 ° C om de fasen scheiding te verkrijgen: de bovenste waterfase RNA.
  7. Breng de waterige fase naar een nieuwe buis, ongeveer 700 pl, overdracht van enige witte interfase materiaal te voorkomen.
  8. Voeg 1 ml 100% ethanol en mengen door omkeren.
  9. Pipet up 700 pl monster in een mini spinkolom geplaatst op een 2 ml verzamelbuis. Sluit het deksel en centrifugeer bij 12.000 xg gedurende 15 sec. Gooi het doorstroomkanaal.
  10. Herhaal deze stap met behulp van de resterende monster.
  11. Voeg 700 ul Buffer RWT de mini centrifugeerkolom, sluit het deksel en centrifugeer 15 sec bij 12.000 xg om de kolom te wassen. Gooi het doorstroomkanaal.
  12. Pipet 500 pi Buffer RPE in de mini spin-kolom. Sluit het deksel en centrifugeer 15 sec bij 12.000 tpm. Gooi het doorstroomkanaal. Herhaal deze stap opnieuw.
  13. Centrifugeer de mini spinkolom op volle snelheid gedurende 2 minuten om de spinkolom droogmembraan van resterende ethanol.
  14. Breng de mini spinkolom een ​​nieuwe 1,5 ml verzamelbuis en pipet 35 gl RNase-vrij water op het membraan van de kolom.
  15. Centrifugeer 1 min bij 12.000 xg om het RNA te elueren.
  16. Bewaar het RNA bij -80 ° C.
    Opmerking: Aangezien RNA-concentratie niet nauwkeurig kan worden bepaald, gebruik vast volumes als maat voor input bedrag.

2. MicroRNA reverse transcriptie

  1. Ontdooi de reverse transcriptie (RT) reagens mix componenten: 5x reactie buffer, nuclease-vrij water. Meng voorzichtig omkeren van de buizen en leg ze op ijs. Vlak voor het gebruik, verwijder het enzym mix uit de vriezer en plaats op ijs. Spin down alle reagentia.
  2. Bereid het RT reagens in ijs zoals beschreven in Tabel 1. Bereid ten minste 10% overschrijden mix.
  3. Meng de reactie door pipetteren, en dan spin down.
  4. Incubeer gedurende 60 minuten bij 42 ° C.
  5. Hitte-inactiveren de reverse transcriptase gedurende 5 minuten bij 95 ° C.
  6. Onmiddellijk afkoelen tot 4 ° C.
  7. Bewaar de cDNA bij -20 ° C.

3. cDNA Verwatering

  1. Verdunnen de hoeveelheid cDNA template die nodig zijn voor de geplande ddPCR reacties in nuclease vrij water. Verdun de cDNA reactie tussen 1:50 en 1: 500 in water, afhankelijk van de doelgroep miRNA overvloed. Bewaar de verdunde cDNA bij -20 ° C. Het verdunde cDNA bleek stabiel te zijn gedurende ten minste 3 maanden bij -20 ° C.

4. Droplet Generation en PCR

Opmerking: Druppeltje generatie moet worden uitgevoerd op 8 monsters tegelijk. Technische replicaten zijn niet verplicht, vanwege de hoge reproduceerbaarheid van deze technologie 12,15 .A templateloze Control (NTC) monster moet worden uitgevoerd in elke plaat en voor elke verschillende ddPCR staat.

  1. Ontdooi en evenwicht van de master mix (bijv., EvaGreen Master Mix), microRNA primer set en cDNA bij RT.
  2. Meng de Master Mix thoroughly door het buisje meerdere malen. Spin down alle reagentia.
  3. Bereid de ddPCR mix zoals beschreven in Tabel 2. Wanneer meerdere ddPCR reacties worden uitgevoerd, stelt een ddPCR mix werkende oplossing. Maak minstens 10% meer dan mix.
  4. Als alles in elkaar, meng en spin down de ddPCR mix.
  5. Doseer 12 pi ddPCR mengen in een 96-well PCR plaat of PCR-buizen.
  6. Voeg 8 ul van verdund cDNA template aan elke buis / well.
  7. Steek de druppel generator cartridge in de houder.
  8. Overdracht 20 ul van elk bereid monster tot monster putjes (middelste rij) van de druppel generator cartridge voorzichtig met vermijding van luchtbellen aan de bodem van de put.
  9. Vul elke oliebron (onderste rij) met 70 pi druppel generator olie.
  10. Haak de pakking over de patroonhouder en in te voegen in de druppel generator.
  11. Sluit het deksel druppel generatie volgens gaan pr fabrikantotocol. Wanneer druppel generatie klaar is, opent u het deksel, verwijder de wegwerp pakking. Boven putjes van de cassette bevatten de druppeltjes.
  12. Pipet langzaam en vloeiend 40 pl van de inhoud van de acht bovenste putjes (de druppeltjes) in één kolom van een 96-well PCR plaat.
  13. Sluit de PCR-plaat met folie onmiddellijk na de overdracht van druppeltjes om verdamping te voorkomen. Gebruik doorboren is folie plaat afdichtingen die compatibel zijn met de naalden in de druppel lezer zijn.
  14. Begin thermische fietsen (PCR) binnen 30 minuten van het afdichten van de plaat.
  15. Voer de fietsen protocol volgens tabel 3.

5. Droplet Reading

  1. Schakel de druppel lezer.
  2. Beweeg de plaat uit de PCR-apparaat aan de druppel lezer.
  3. Plaats de 96-well PCR plaat met de post-PCR druppeltjes in de basis van de plaathouder.
  4. Plaats de bovenkant van de plaathouder op de plaat PCR. Druk stevig op beide ontgrendelingslipjestot aan de PCR-plaat in de houder te verzekeren.
  5. Start de software van het systeem PC.
    1. Klik op Instellingen om het experiment (Absolute kwantificering) te definiëren en klik vervolgens op Uitvoeren om de druppel lezen te starten.
    2. Wanneer druppel lezen is voltooid, klikt u op "Analyze" knop om te openen en de gegevens te analyseren.
    3. Gebruik de 2D-amplitude plot in de analyse software om de positieve druppeltjes (lasso tool) (Figuur 1B) te selecteren.
    4. Gebruik het tabblad Events om het aantal positieve en de totale druppeltjes te controleren. Een totaal aantal van 18.000 - 21.000 druppels wordt meestal bereikt met tijdbasis ddPCR.
    5. Zodra de positieve druppels worden geselecteerd, de uitvoer van de miRNA concentratie waarden met behulp van de optie export CSV uit het tabblad Concentratie.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

De absolute hoeveelheid specifieke miRNAs per ml plasma of serum kunnen worden bepaald met een groene fluorescerende DNA-bindende kleurstof en druppeltje digitale PCR techniek. Figuur 1 toont het proces van positieve-druppeltjes selectie, waarbij de uiteindelijke miRNA concentratie bepaalt (kopieën / pl ) in de amplificatiereactie berekend met de analysesoftware. De hoeveelheid van elk miRNA in het bloed zeer verschillend, waarbij sommige species miRNA overvloediger dan anderen. Met een 1:50 verdund cDNA in ddPCR reactie is het mogelijk om een ​​voldoende aantal positieve en negatieve druppels verkrijgen. In het geval van een positieve druppel verzadiging (bijv., Geen resterende negatieve druppels), zou een verdere verdunning van cDNA monsters nodig zijn.

Elke LNA primer set moet worden geoptimaliseerd om goed te laten werken op de druppel digitale PCR-systeem. De optimalisatie proces voor miR-181 A-5p isweergegeven in figuur 2 bijzonder veranderen de hoeveelheid primer (gebruikelijk in het traject van 0,25-1 gl per ddPCR reactie). en de annealing temperatuur (doorgaans in het bereik van 56 - 60 ° C), is het mogelijk om de combinatie te selecteren die bepaalt een betere scheiding tussen positieve en negatieve druppels. Bij miR-181a-5p, 60 ° C annealing temperatuur en zowel 0,5 en 1 ul primer bedragen over een beter resultaat qua amplitude druppel.

Het kan gebeuren dat een primerset geeft enkele niet-specifieke amplificatie, waarschijnlijk door primer-dimeren vormen. Bij het werken met circulerende miRNAs, kan het positieve signaal uit monsters zeer lage en derhalve vergelijkbaar met de niet-specifieke signaal. Als de "wolk" van niet-specifieke doelwit amplificatie niet overlapt het ware signaal (figuur 1C), kan het miRNA nog worden gemeten dan selecteren van de ware positieve druppels. In dit geval, de NTC monster essentieel voor druppel selectie. Alle op te nemen in dezelfde analysemonsters moeten worden verwerkt met dezelfde methode en hetzelfde ddPCR staat.

Figuur 1
Figuur 1. Positieve Droplets Selection. Positieve druppeltjes worden handmatig geselecteerd tijdens de analyse met behulp van een drempel waarboven de negatieve druppels in 1D perceel (A) of het uitvoeren van een cirkel rond de positieve druppel cloud in 2D perceel (B). Als sommige primer set geeft een niet-specifieke versterking, dit blijkt uit een tweede wolk van positieve druppels die in de negatieve controle (No Template Control, NTC) monster (C) verschijnt. De "echte" positieven kan nog steeds worden geselecteerd met uitzondering van de niet-specifieke signaal in 2D plot.e.jpg "target =" _ blank "> Klik hier om een ​​grotere versie van deze figuur te bekijken.

Figuur 2
Figuur 2. Primer Optimalisatie voor Cell-free miRNA Kwantificering met Tijdbasis ddPCR Upper panel:. Kwantificering van miR-181 A-5p in twee plasma monsters (S1 en S2) met behulp van 4 verschillende ddPCR omstandigheden. MiR-181a-5p LNA primer concentratie (0,5 en 1 pl) en de annealing temperatuur (58 en 60 ° C) van invloed op de amplitude van de positieve (blauw) en de negatieve (zwarte) druppels in-DNA intercalerende kleurstof ddPCR. Een betere scheiding van dit miRNA verkrijgbaar uitvoeren van de PCR bij 60 ° C en met behulp van 0,5 of 1 pi primer. Het controlemonster (NTC, templateloze Control) heeft geen positieve druppeltjes, zoals verwacht. Middenpaneel: eindconcentratie van miR-181-5p in de bovengenoemde omstandigheden. Resultaten zijn weergegeven als kopieën per microliter in de amplicatie reactie. Foutbalken geven de Poisson 95% betrouwbaarheidsinterval. Lower panel:. Aantal positieve druppeltjes (blauw) van het totale aantal druppels (groen) Klik hier om een grotere versie van deze figuur te bekijken.

Reagens Volume (pl)
5x Reaction buffer 4
Nuclease-vrij water 11
enzymmengsel 2
Sjabloon totaal RNA 3
Totale volume 20

Tabel 1 - reverse transcriptie reagens Mix Components

Reagens Volume (pl)
2x DNA-bindende kleurstof Supermix 10
LNA primer set variable (0,5-1) *
Nuclease-vrij water veranderlijk
Verdund cDNA template 8
Totale volume 20
* Een eerste ddPCR reactie moeten uitvoeren met weinig monsters naar de best werkende hoeveelheid primer vast

Tabel 2 - ddPCR reagens Mix Components

Fietsen Step Temperatuur Tijd ramping Rate Cycles
enzymactivering 95 ° C 5 minuten ~ 2 ° C / sec 1
Denaturation 95 ° C 30 sec 40
Annealing / uitbreiding 60 ° C 1 minuut
signaalstabilisatie 4 ° C 5 minuten 1
90 ° C 5 minuten 1
Hold (optioneel) 4 ° C eindeloos 1
Gebruik een verwarmd deksel ingesteld op 105 ° C ingesteld en het monster volume op 40 pl.

Tabel 3 - Thermische Fietsen Voorwaarden voor Droplet Digital PCR

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Circulerende miRNAs aanwezig zijn in bloed bij extreem lage concentraties en de hoeveelheid RNA die kunnen worden geëxtraheerd uit plasma en serum monsters is laag. Daarom zijn ze moeilijk te kwantificeren met andere technieken zoals microarray en RNA sequentie. Bovendien is er een algemeen gebrek aan overeenstemming over gegevensnormalisatie en de aanwezigheid van endogeen "referentie" miRNAs in het bloed. In dit verband is een gevoelige techniek zoals druppeltje digitale PCR, staat het tellen van het aantal miRNA kopieën per ml serum of plasma, zelfs als zeer laag is zeer aantrekkelijk. We gepaarde deze technologie met een universele cDNA systeem dat omgekeerde transcribeert alle circulerende miRNAs in één reactie dus bespaart tijd en, het belangrijkste, RNA materiaal. In onze aanpak de specificiteit inherent aan het gebruik van LNA primers, die zeer goed uitgevoerd miRNA kwantificering vergelijking met andere oplossingen 16.

Druppeldigitale PCR is een eindpunt assay dat de berekening van doelgenen absolute concentratie mogelijk maakt. In tegenstelling tot kwantitatieve PCR, hebben onvoldoende amplificatie efficiënties geen invloed op de uiteindelijke ddPCR kwantificering. Daarom gelet op het aantal PCR remmers aanwezig bijvoorbeeld in bloedmonsters, ddPCR over een handig hulpmiddel voor circulerende nucleïnezuren beoordeling.

Door zijn hoge gevoeligheid, de techniek een adequate kwantificering ook de minder overvloedig miRNAs, zelfs met een beperkte hoeveelheid uitgangsmateriaal. Bovendien, in de veronderstelling dat elke miRNA-molecuul reverse wordt getranscribeerd in een cDNA-molecuul, kunnen wij de absolute exemplaren in 1 pl plasma / serum vermenigvuldigen van de verkregen concentratie in ddPCR reactie waarde voor een verdunningsfactor (145,83) te berekenen.

De gepresenteerde workflow kan gemakkelijk worden uitgevoerd op 8-96 monsters tegelijk, waardoor een betrouwbare en tijdbesparende instrument microRNA kwantificering in clinical monsters. Druppeltje digitale PCR heeft de potentie om uitgegroeid tot een essentieel instrument voor nucleïnezuren biomarkers assessment in een diagnostische setting, waardoor vloeistof biopsie te brengen van de bank aan het bed.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgements

Ondersteund door de financiering van de Italiaanse Association for Cancer Research (AIRC) naar MF (MFAG 11.676) en MN (Special Program Molecular Clinical Oncology -. 5 per mille n 9980, 2010/15) en van het Italiaanse ministerie van instructie, universiteit en onderzoek FIRB 2011 MN (Project RBAPIIBYNP).

Materials

Name Company Catalog Number Comments
miRNeasy Mini Kit Qiagen 217004 Columns for total RNA, including miRNA, extraction from serum/plasma
100 nmole RNA oligo Cel-miR-39-3p Integrated DNA Technologies Custom Sequence: UCACCGGGUGUAAAUCAGCUUG
Universal cDNA synthesis kit II, 8-64 rxns Exiqon 203301 Kit for microRNA reverse transcription
MicroRNA LNA PCR primer set  Exiqon 204000-206xxx and 2100000-21xxxxx Primers for miRNA amplification inside droplets
QX200 droplet generator BioRad 186-4002 Instrument used for droplet reading
QX200 droplet reader BioRad 186-4003 Instrument used for droplet generation
QuantaSoft software BioRad 186-3007 Software for data collection and analysis
PX1 PCR plate sealer BioRad 181-4000 Plate sealer
DG8 droplet generator cartridges and gaskets BioRad 186-4008 Cartridges used to mix sample and oil to generate droplets
QX200 ddPCR EvaGreen supermix BioRad 186-4033/36 PCR supermix
QX200 droplet generator oil for EvaGreen dye BioRad 186-4005 Oil for droplet generation

DOWNLOAD MATERIALS LIST

References

  1. Arroyo, J. D., et al. Argonaute2 complexes carry a population of circulating microRNAs independent of vesicles in human plasma. Proc Natl Acad Sci U S A. 108, 5003-5008 (2011).
  2. Skog, J., et al. Glioblastoma microvesicles transport RNA and proteins that promote tumour growth and provide diagnostic biomarkers. Nat Cell Biol. 10, 1470-1476 (2008).
  3. Vickers, K. C., Palmisano, B. T., Shoucri, B. M., Shamburek, R. D., Remaley, A. T. MicroRNAs are transported in plasma and delivered to recipient cells by high-density lipoproteins. Nat Cell Biol. 13, 423-433 (2011).
  4. Braicu, C., et al. Exosomes as divine messengers: are they the Hermes of modern molecular oncology. Cell Death Differ. 22, 34-45 (2015).
  5. Creemers, E. E., Tijsen, A. J., Pinto, Y. M. Circulating microRNAs: novel biomarkers and extracellular communicators in cardiovascular disease. Circ Res. 110, 483-495 (2012).
  6. Guay, C., Regazzi, R. Circulating microRNAs as novel biomarkers for diabetes mellitus. Nat Rev Endocrinol. 9, 513-521 (2013).
  7. Schwarzenbach, H., Nishida, N., Calin, G. A., Pantel, K. Clinical relevance of circulating cell-free microRNAs in cancer. Nat Rev Clin Oncol. 11, 145-156 (2014).
  8. Moldovan, L., et al. Methodological challenges in utilizing miRNAs as circulating biomarkers. J Cell Mol Med. 18, 371-390 (2014).
  9. Tiberio, P., Callari, M., Angeloni, V., Daidone, M. G., Appierto, V. Challenges in Using Circulating miRNAs as Cancer Biomarkers. Biomed Res Int. 2015, 731479 (2015).
  10. Jarry, J., Schadendorf, D., Greenwood, C., Spatz, A., van Kempen, L. C. The validity of circulating microRNAs in oncology: five years of challenges and contradictions. Mol Oncol. 8, 819-829 (2014).
  11. Witwer, K. W. Circulating MicroRNA Biomarker Studies: Pitfalls and Potential Solutions. Clin Chem. 61, 56-63 (2015).
  12. Miotto, E., et al. Quantification of Circulating miRNAs by Droplet Digital PCR: Comparison of EvaGreen- and TaqMan-Based Chemistries. Cancer Epidemiol Biomarkers Prev. 23, 2638-2642 (2014).
  13. Ferracin, M., et al. Absolute quantification of cell-free microRNAs in cancer patients. Oncotarget. (2015).
  14. Mangolini, A., et al. Diagnostic and prognostic microRNAs in the serum of breast cancer patients measured by droplet digital PCR. Biomarker Research. (2015).
  15. Hindson, C. M., et al. Absolute quantification by droplet digital PCR versus analog real-time PCR. Nat Methods. 10, 1003-1005 (2013).
  16. Mestdagh, P., et al. Evaluation of quantitative miRNA expression platforms in the microRNA quality control (miRQC) study. Nat Methods. 11, 809-815 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics