Generación de Integración libres de células madre pluripotentes inducidas a partir de células mononucleares de sangre periférica humana Utilizando vectores episomales

JoVE Journal
Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Wen, W., Zhang, J. P., Chen, W., Arakaki, C., Li, X., Baylink, D., Botimer, G. D., Xu, J., Yuan, W., Cheng, T., Zhang, X. B. Generation of Integration-free Induced Pluripotent Stem Cells from Human Peripheral Blood Mononuclear Cells Using Episomal Vectors. J. Vis. Exp. (119), e55091, doi:10.3791/55091 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Células madre pluripotentes inducidas (iPSCs) son una gran promesa para el modelado de la enfermedad y las terapias regenerativas. Hemos informado anteriormente el uso de vectores episomales (EV) para generar células iPS sin integración a partir de células mononucleares de sangre periférica (PB CMN). Los vectores episomales utilizados son plásmidos de ADN incorporados con elementos oriP y EBNA1 del virus Epstein-Barr (EB), que permiten la replicación y largo plazo Contención de plásmidos en células de mamífero, respectivamente. Con una optimización adicional, miles de colonias IPSC se pueden obtener a partir de 1 ml de sangre periférica. Dos factores críticos para lograr altas eficiencias de reprogramación son: 1) el uso de un 2A "auto-división" péptido para enlazar Oct4 y Sox2, logrando de esta manera la expresión equimolar de los dos factores; 2) el uso de dos vectores para expresar MYC y KLF4 individualmente. Aquí se describe un protocolo paso a paso para la generación libre de integración de IPSC a partir de muestras de sangre periférica de adultos. Las células iPS generadas están libres de integración como plásmidos episomales residuales son indetectables después de cinco pasajes. Aunque la eficiencia de reprogramación es comparable a la de Virus Sendai vectores (SV), plásmidos EV son considerablemente más económico que los vectores SV disponibles comercialmente. Este sistema EV reprogramación asequible tiene potencial para aplicaciones clínicas en medicina regenerativa y ofrece un enfoque para la reprogramación directa de las multinacionales del PP a las células libres de integración madre mesenquimales, células madre neurales, etc.

Introduction

Después de la expresión forzada de varios factores de transcripción (Es decir, Oct4, Sox2, MYC y KLF4), las células somáticas pueden ser reprogramadas para células madre pluripotentes inducidas (iPSCs), los cuales son muy prometedores para aplicaciones en la medicina regenerativa y la terapia de reemplazo celular 1-3. Hasta la fecha, diversos métodos han sido desarrollados para aumentar la tasa de éxito de la reprogramación de 4-7. Los vectores virales reprogramación inducida es ampliamente utilizado para la generación eficiente de células iPS, debido a la integración viral conduce a un alto nivel, la expresión estable de los factores de reprogramación. Sin embargo, la integración permanente del vector de ADN en el genoma de la célula puede inducir la mutagénesis de inserción 5. Además, la falta de inactivación de los factores de reprogramación puede perturbar la diferenciación iPSCs 8. Como tal, el uso de iPSCs sin la integración de factores de reprogramación es imprescindible, especialmente para uso en aplicaciones de terapia celular.

9. El elemento oriP promueve la replicación del plásmido en células de mamífero, mientras que el elemento EBNA1 ata el plásmido de ADN que contiene oriP-al ADN cromosómico que permite la compartimentación del episoma durante la división de la célula huésped. En comparación con otros enfoques libre de integración, incluyendo el virus Sendai (SV) y el ARN de la transfección, los vehículos eléctricos poseen múltiples ventajas 5,6,10. Como ADN plásmido, los vehículos eléctricos se pueden producir fácilmente y modificados en la casa, que les hace extremadamente asequible. Además, la reprogramación con EV es un proceso menos laborioso ya que una única transfección con los vehículos eléctricos es suficiente para la generación de IPSC, mientras que varios transfecciones de ARN son necesarias para la reprogramación éxito.

refibroblastos ermal se han utilizado en muchos estudios de reprogramación. Sin embargo, la biopsia de piel no sólo es un proceso invasivo y doloroso, pero también consume mucho tiempo para la expansión de las células a cantidades suficientes para la reprogramación. De mayor preocupación, células de la piel de donantes adultos a menudo han sido expuestos a la radiación de luz UV a largo plazo, lo que puede dar lugar a mutaciones asociadas a tumores, lo que limita las solicitudes de células iPS derivadas de fibroblastos de la piel 11,12. Recientemente, se ha informado de que las células de la piel humana normal se acumulan mutaciones somáticas y múltiples genes del cáncer, incluyendo la mayor parte de los principales impulsores de los carcinomas de células escamosas cutáneas, están bajo fuerte selección positiva 13.

En contraste con los fibroblastos de piel, células de la sangre periférica (PB) son una fuente preferida de células para la reprogramación porque 1) células sanguíneas se pueden obtener fácilmente a través de un proceso mínimamente invasivo, 2) células de sangre periférica son la progenie de las células madre hematopoyéticasque residen en la médula ósea, por lo tanto protegido de la radiación dañina. Las células mononucleares de sangre periférica (PB CMN) se pueden recoger en una hora de la capa leucocitaria tras un simple centrifugación en gradiente de Ficoll-Hypaque (1,077 g / ml). Las MNCs PB obtenidos se componen de linfocitos, monocitos y unas pocas células progenitoras hematopoyéticas (HPC) 14. Aunque los linfocitos T humanos son uno de los principales tipos de células en PB, células T maduras contienen reordenamientos del receptor de células T (TCR) genes y carecen de un genoma intacto que limita su potencial para aplicaciones 15,16. Sin embargo, el rejuvenecimiento de las células T a través de la generación de IPSC puede tener aplicaciones potenciales en quimérico Receptor de Antígeno (CAR), la terapia de células T 17-19. En comparación, HPC tiene un genoma intacto y son fácilmente reprogramables. Aunque sólo 0,01-0,1% de células en la circulación periférica son HPCs, estas células se pueden expandir ex vivo en un medio de eritroides que favorece la proliferación de erythrcélulas progenitoras oid 14.

En nuestro estudio anterior, se utilizó el factor de BCL-XL además de los factores Yamanaka (Oct4, Sox2, MYC y KLF4), lo que resultó en un aumento de 10 veces en PB eficiencia de reprogramación 20. BCL-XL, también conocido como Bcl2l1, es un potente inhibidor de la muerte celular, inhibiendo la activación de las caspasas 21,22. Pero, BCL-XL también puede desempeñar un papel importante en el mantenimiento de la pluripotencia 21,22. Recientemente, hemos optimizado nuestro sistema EV reprogramación expresando separado MYC y KLF4 con dos vectores, lo que conduce a un aumento de aproximadamente 100 veces en la eficiencia de reprogramación 23. Usando este método, la eficiencia de reprogramación, definido por el número de colonias a partir dividido por el número de células en la transfección, es desde 0,2 hasta 0,5% de donantes sanos. En la siguiente manera, se describe el procedimiento experimental detallado para la generación de células iPS sin integración de PB.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Todas las muestras de PB humanos se obtuvieron de donantes adultos anónimos que no tienen información de identificación disponible de Tianjin Centro de Sangre con la aprobación del comité local de ética de investigación.

1. Endo-libre plásmido Preparación

  1. Utilizar un kit de purificación de plásmidos Maxi comercial para extraer vectores episomales de E. coli según el protocolo del fabricante. Para la etapa final, tampón TE sustituto con agua estéril libre de endotoxina para disolver el sedimento de ADN.
  2. Medir la concentración de ADN utilizando un espectrofotómetro comercial UV / Vis. La concentración es por lo general mayor que 1 g / l, con A260 / A280 y los ratios A260 / A230 de más de 1,8 y 2,0, respectivamente.

2. Medios de Cultivo

  1. Preparar medio eritroide: madre hematopoyéticas expansión celular medio suplementado con 100 ng / mL Stem Cell Factor humano (SCF), 10 ng / ml de interleucina-3 (IL3), 2 U / ml de eritropoyetina (EFactor-1 PO), 20 ng / ml de insulina Crecimiento (IGF1), 1 mM de dexametasona y 0,2 mM 1-tioglicerol. Filtro de esterilizar con un filtro de jeringa de 0,22 micras. medio eritroide se puede almacenar a 4 ° C durante un máximo de un mes.
  2. Preparar medio IPSC: medio DMEM / F12 (medio Eagle modificado / Mezcla Nutriente de Dulbecco F-12) suplementado con 1x L-glutamina, 1x penicilina / estreptomicina, 1 x solución no esenciales aminoácidos, 50 ng / mL factor de crecimiento fibroblástico 2 (FGF2 ), 1x suplemento de insulina-transferrina-selenita (ITS), y ácido ascórbico 50 mg / ml. Filtro de esterilizar con un filtro de jeringa de 0,22 micras. medio IPSC se puede almacenar a 4 ° C durante un máximo de un mes.
  3. Preparar medio MEF: de Eagle modificado por Dulbecco (DMEM; alto de glucosa) suplementado con 1x penicilina / estreptomicina y 10% suero bovino fetal (FBS). Filtro de esterilizar con un filtro de jeringa de 0,22 micras. medio MEF se puede almacenar a 4 ° C hasta por un mes o recién añadir 1x L-glutamina antes de su uso.
  4. PAGmedio repare IPSC crioconservación (2x): Se disuelven 5 g de D-trehalosa en 30 ml de agua estéril en un baño de agua C 37 °. Llevar la temperatura de 4 ° C y luego agregar 10 ml de FBS y 10 ml de dimetilsulfóxido (DMSO). Filtro de esterilizar con un filtro de jeringa de 0,22 micras. Almacenar a 4 ° C durante un máximo de 3 meses 24.

3. Aislamiento de células mononucleares de sangre periférica (PB MNC)

  1. Combinar 10 ml de muestra PB fresco y 10 ml de tampón PBS en un tubo de 50 ml y mezclar bien. Llevar PBS a RT o 37 ° C antes de su uso.
    NOTA: aproximadamente 1 - 3 x 10 6 MNCs (frescos o crioconservados) se puede obtener a partir de 1 ml de PB. Después de 6 días de cultivo, esperar a tener 0,5 - 1 x 10 6 células totales debido a la muerte de las células maduras durante el cultivo. Aproximadamente 1 x 10 7 células se pueden obtener a partir de 10 ml de PB fresco.
  2. Añadir 10 ml de Ficoll a la parte inferior del tubo con una jeringa de 10 ml unida a una aguja larga. este proproceso debe hacerse lentamente para asegurar que la capa de Ficoll no se mezcla con el PB.
  3. Centrifugar a 400 xg durante 30 min a una velocidad de aceleración y deceleración baja. Después de la centrifugación, las MNCs PB están en la capa blanca (capa leucocitaria) situado entre el plasma PB y el Ficoll.
  4. Lentamente aspirado de ~ 10 ml de plasma PB sin perturbar la capa leucocitaria. Con cuidado, la cosecha de la capa blanca con una punta de pipeta de 1 ml a un nuevo tubo de 50 ml. El volumen total de las células recogidas de la capa blanca será de entre 3 - 6 ml.
  5. Añadir PBS para llevar el volumen total a 30 ml y se mezcla bien con una pipeta de 10 ml. Centrifugar a 400 xg durante 10 min.
  6. Retire el sedimento celular sobrenadante y resuspender en 20 ml de medio de cultivo (es decir, de Iscove modificado de Dulbecco Medium, IMDM) y mezclar bien. Centrifugar a 400 xg durante 10 min para eliminar la mayoría de las plaquetas.
  7. Eliminar el sobrenadante y resuspender el sedimento celular en 1 - 2 ml de IMDM. Las células se pueden usar fo la cultura inmediata, o congelado hacia abajo para su uso posterior. Para la criopreservación, añadir una cantidad igual de medio de criopreservación. células de alícuotas en crioviales (0,5 - 1 ml por vial) y crioviales de transferencia a un -80 ° C congelador inmediatamente. MNCs PB pueden ser almacenados en -80 ° C congelador durante varias semanas o transferirse a un tanque de nitrógeno líquido para almacenamiento a largo plazo.
    NOTA: Al descongelar las células congeladas, aunque nuestro medio de criopreservación puede sostener la viabilidad celular, el número de células puede disminuir debido a la muerte celular durante el proceso de descongelación. Se recomienda que 1 - 10 x 10 7 células se congelarán en cada vial.

4. La expansión de las multinacionales del PP en Eritroides Medio

  1. Preparar 5 ml de medio IMDM en un tubo de 15 ml. descongelar rápidamente las multinacionales PB congeladas en un baño de agua a 37 ° y luego transferirlos al tubo con el medio IMDM.
    NOTA: La longitud de tiempo en el baño de agua depende del volumen de las células criopreservadas y el u criovialSED. Por lo general, la célula congelada se descongele dentro de 1 min.
  2. Centrifugar a 400 xg durante 5 - 10 minutos a. Eliminar el sobrenadante y resuspender el sedimento celular en medio eritroide. Añadir 10 l solución de azul de tripano a la suspensión celular 10 l y mezclar bien. Tripán azul tiñe las células muertas de un radio de 1 - 3 minutos. Contar las células bajo el microscopio utilizando un hemocitómetro.
  3. MNC Cultura del PP en una cultura no-tejido (no-TC) tratados placa de 6 pocillos con 2 ml de medio por pocillo, a una densidad celular de ~ 5 x 10 6 células / ml, a 37 ° C en un 5% de CO 2 incubador humidificado.
  4. Añadir 1 ml de medio fresco eritroide directamente a cada pocillo sin cambiar el medio a D 3 y 5.
  5. En D 6, cosechar las multinacionales PB para nucleofection.

5. PB MNC Nucleofection y reprogramación

  1. Un día antes de nucleofection, pre-capa TC-tratada placas de 6 pocillos con gelatina al 0,1% a 37 ° C durante 20 minutos. Descongelar inactivada murino embrionarias Fibroexplosión (MEF) células alimentadoras en un baño de agua a 37 ° y de inmediato a transferir a un tubo de 15 ml que contenía 5 ml de medio de MEF.
  2. Centrifugar a 400 xg durante 5 min y separar el sobrenadante. Retire la gelatina de la placa de 6 pocillos, volver a suspender el sedimento celular en medio MEF, y transferirlos a la gelatina previamente tratados con placa de 6 pocillos. En cada pocillo, semillas 2 - 4 x 10 5 células MEF inactivadas suspendieron en 2 ml de medio MEF.
  3. Cultivar las células alimentadoras MEF a 37 ° C en un 5% de CO2 humidificada.
  4. En el día de nucleofection, aspirar el medio MEF y reemplazarlo con 1 ml de medio eritroide. Pre-equilibrar la placa de cultivo durante 10 - 30 minutos a 37 ° C en un 5% de CO2 humidificada.
  5. Añadir 2 g PEV-OCT4-2A-Sox2, 1 mg PEV-MYC, 1 mg PEV-KLF4, y 0,5 g PEV-BCL-XL en un tubo Eppendorf de 1,5 ml estéril. Calentar el tubo a 50 ° C durante 5 min para evitar la contaminación, y se enfrían hasta la temperatura ambiente. Añadir57 l nucleofection tampón y 13 l suplemento.
  6. Cosecha 2 x 10 6 MNCs PB cultivadas a un tubo de 5 ml por centrifugación a 200 xg durante 7 min. Eliminar el sobrenadante y añadir el plásmido y nucleofection mezcla tampón al sedimento celular. Mezclar bien con un movimiento rápido del tubo con el dedo.
    NOTA: Por sólo 2 x 10 5 células puede ser utilizado para nucleofection, pero una eficiencia de reprogramación más baja se debe esperar también.
  7. Transferir el ADN y la suspensión de células a la cubeta proporcionada en el kit y la tapa de la cubeta. Seleccione el programa U-008 en el dispositivo nucleofection. Insertar la cubeta en el soporte y presione OK para aplicar el programa U-008.
  8. Tome la cubeta del soporte, se anaden 0,5 - 1 ml de pre-calentado medio eritroide en cada cubeta, y las células de transferencia a la placa MEF pre-equilibrada inmediatamente. Debido a la alta eficiencia de reprogramación y la variación de los donantes, la siembra de diferente número de células que van de 1-10 x 10 5 células per así es muy aconsejable.
  9. La transferencia de la placa a una cámara de hipoxia, y lavar la cámara con un gas mixto compuesto de 92% N 2, 5% de CO 2 y 3% O 2, por 1 - 2 min a una velocidad de 20 L / min. Después de sellar la cámara, cultivar las células a 37 ° C.
  10. En D2 post-nucleofection, agregar 2 ml de medio de IPSC directamente a cada pocillo.
  11. En D 4 después de la nucleofection, retire 3 ml de medio y agregar 2 ml de medio fresco de IPSC. En D 4 después de la nucleofection, la mayoría de las células vivas se han unido a la capa de alimentación.
  12. Después de D-6 después nucleofection, cambiar el medio cada 2 d dejando 500 l pasó medio y añadir 2 ml de medio fresco suplementado E8 con 0,25 mM butirato sódico hasta D 14 - 18.
    NOTA: las células de alimentación adicional se pueden añadir en los pocillos de cultivo cada vez que la observación de que las células alimentadoras se hayan separado. Después de la descongelación MEFs (ver 5.1 y 5.2), resuspender el sedimento celular en un volumen pequeño de medio de E8 (es decir, ~ 0.2 ml de un pocillo de una placa de 6 pocillos) y después se añaden MEFs en los pocillos de cultivo. Aproximadamente el 2% de FBS se puede añadir para aumentar la unión celular. Alternativamente, el medio acondicionado-MEF también se puede utilizar, pero es más laborioso.

6. La expansión de células iPS

NOTA: En la mayoría de los casos, un gran número de colonias IPSC aparecen en D de 8 - 10 nucleofection posterior. Después de 14 D, grandes colonias IPSC son generalmente listo para su recolección.

  1. Antes de recoger colonias, añadir 500 l de medio E8 complementado con inhibidor de ROCK, Y27632 (10 M), en un pocillo de un alimentador o Matrigel recubierto de placas de 24 pocillos. Utilizar una pipeta l 10 o 20 para rascar y recoger colonias bajo el microscopio. La transferencia de las piezas de cada colonia a los pocillos que contienen el medio de cultivo.
    NOTA: La concentración de Matrigel difiere de un lote a otro. Por lo general, se utiliza una dilución 1: 100 de Matrigel.
    1. Con el fin de evitar la contaminación cruzada, recogercolonias que son grandes y bien separados de los demás. IPSCs de cultivo a 37 ° C en un 5% de CO 2 incubadora humidificada.
      NOTA: Debe ser en cuenta que la población de IPSC puede ser policlonal debido a la migración celular cuando hay decenas o cientos de colonias en cada pocillo de una placa de 6 pocillos.
  2. No cambie medio para la primera 2 d. Inhibidor de la roca puede promover la supervivencia de las pequeñas colonias 25.
  3. De D 2 en adelante, cambio de medio cada día mediante la eliminación de medio gastado y añadiendo medio fresco E8 500 l en cada pocillo.
  4. Aproximadamente 1 semana más tarde, cuando las colonias son lo suficientemente grandes, se elimina el medio y el tratamiento de las células con 300 solución de desprendimiento celular l (EDTA 0,5 mM en PBS) a 37 ° C durante 1-3 min. Eliminar la solución de desprendimiento de las células y se añade medio de E8 que contiene inhibidor de roca (10 mM) de suspender iPSCs. No romper las colonias en células individuales, que pueden conducir a la muerte celular excesiva. Los grupos de células con 5 a 50 célulass son adecuados para el paso de IPSC.
  5. Transferencia de 50 - 100% de la suspensión celular a cada pocillo de una placa de 6 pocillos de 12 o que ha sido pre-revestido con alimentadores o Matrigel.
  6. Para el cultivo a largo plazo en placas recubiertas con Matrigel (ver nota en 6.1), cambiar el medio cada día. Cuando la confluencia celular alcanza 40 - 60%, el tratamiento de las células con 1 ml solución de desprendimiento de las células (EDTA 0,5 mM en PBS) a 37 ° C durante ~ 3 min. Cuando las colonias empiezan a enroscarse, eliminar la solución de desprendimiento de las células y añadir E8 medio que contiene inhibidor de roca (10 mM) de suspender las células iPS. células de paso con un factor de división de 4 - 8. inhibidor ROCA debe añadirse cuando pases las células para aumentar la supervivencia, y se retiran de 1 d tarde para evitar la diferenciación.
  7. Para congelar abajo CMPI, el tratamiento de las células con solución de desprendimiento de las células a 37 ° C durante 3 - 5 min de acuerdo con el protocolo del fabricante. Cuando las colonias IPSC comienzan a enroscarse, aspirar el tampón y se anaden 0,5 - 1 mediana ml E8.
  8. <li> Añadir un volumen igual de medio de criopreservación a la suspensión celular y se mezcla bien. Frozen iPSCs se puede almacenar en un congelador C -80 ° durante varias semanas o en nitrógeno líquido para almacenamiento a largo plazo.

7. La selección de células iPS sin residual episomal plásmidos

  1. Después del paso 5, iPSCs cosecha y extraer el ADN genómico.
    NOTA: Por lo general, después de 5 pasajes de la cultura, los plásmidos episomales residuales son indetectables. Por lo tanto, casi todas las colonias IPSC en pasajes anteriores 5 (es decir, el paso 10) son insuficientes, plásmidos episomales residuales.
  2. Utilice el ADN genómico de MNCs PB no transfectadas como control negativo. Añadir 1,6 pg plásmido PEV-OCT4-2A-Sox2 en el ADN control negativo 1 mg para imitar las células con una copia de pEV plásmido por célula.
  3. Añadir 9 l de agua de calidad para PCR incluyendo 100 ng de ADN genómico y 1 mu L cebadores específicos (10 mM cada uno de los cebadores directo e inverso) en 10 l de alta fidelidad PCR Master Mix. Normalizar la mañanaporte de ADN por GAPDH. Utilice los siguientes cebadores para la PCR: EBNA1-F TTTAATACGATTGAGGGCGTCT, EBNA1-R GGTTTTGAAGGATGCGATTAAG, WPRE-F GGTTTAAACGCGTCGACAAT, WPRE-R GTTGCGTCAGCAAACACAGT, GAPDH-F GAGTCCACTGGCGTCTTC, GAPDH-R GACTGTGGTCATGAGTCCTTC.
  4. Incubar la mezcla de reacción a 98 ° C durante 60 s; seguido de 98 ° C durante 10 s, 60 ° C durante 30 s, y 72 ° C durante 30 s. Después de 30 ciclos; extender la reacción a 72 ° C durante 5 min.
  5. Cargar 5 productos l de PCR en cada pocillo de un gel de agarosa al 1%. Dejar correr el gel de 20 - 30 minutos a 100 V. Elija los clones IPSC con bandas indetectables para EBNA1 y WPRE para el posterior cultivo y análisis de aguas abajo.

8. Citometría de Flujo

  1. Cosecha iPSCs tratándolos con Accutase a 37 ° C durante 3-5 min para obtener una suspensión de células individuales. Añadir 1 l PE-conjugado anti-TRA-1-60 o eFluor 570-conjugado anti-SSEA4 o anticuerpo isotípico 100 l de suspensión de células (1 - 5 x 10 5 células) En tubos de 5 ml. Incubar los tubos en un lugar oscuro a temperatura ambiente durante 20 min.
  2. Después de la tinción durante 20 min a RT, añadir 2 ml de PBS y centrifugar a 400 xg durante 5 min. Resuspender las células en 300 l de PBS para el análisis de células activadas por fluorescencia (FACS) utilizando un analizador de células citometría de flujo. 23,26

9. Imagen confocal

  1. iPSCs de semillas en la cámara de diapositivas Matrigel recubiertos.
  2. Después de 3 - 4 d de la cultura, se elimina el medio de crecimiento y fijar con paraformaldehído al 4% (PFA) a TA durante 30 min. Lavar las células dos veces con PBS.
    Nota: PFA es tóxico y dañino.
  3. Se tratan las células con 0,1% Triton X-100 en PBS (PBS-T) a TA durante 30 min. Lavar las células dos veces con PBS.
  4. Bloquear las células con tampón de bloqueo (suero de cabra al 5% en PBS, V: V) a TA durante 1 h.
  5. Durante la etapa de bloqueo, se diluye el anticuerpo primario (100x) en tampón de bloqueo.
    NOTA: La información anticuerpos aparece en la Tabla de Materiales / Equipos.
  6. Se incuban las células con anticuerpo diluido a 4 ° CO / N.
  7. Lavar dos veces con PBS-T durante 15 min, seguido por dos veces con PBS durante 15 min.
  8. Se incuban las células con un anticuerpo secundario fluoróforo conjugado diluido a TA durante 2 h.
  9. Lavar las células dos veces con PBS-T durante 15 min, seguido por dos veces con PBS durante 15 min.
  10. Teñir el núcleo con DAPI (1 mg / ml) en PBS a temperatura ambiente durante 10 min.
  11. Lavar las células dos veces con PBS durante 15 min.
  12. Captura de imágenes con un microscopio confocal. 23,27

10. El teratoma Ensayo

Cosecha 1 x 10 6 iPSCs con solución de desprendimiento de las células (EDTA 0,5 mM en PBS) y volver a suspender las células en 200 l DMEM / F12 diluido (1: 1) de Matrigel.

  1. Por vía subcutánea inyectar las células en el anca trasera de ratones inmunodeficientes NOD / SCID.
  2. A las 8 - 12 semana después de la inyección de IPSC, diseccionar y fijar los teratomas en formalina al 10%. 28
  3. Después microsectioning ytinción con hematoxilina y eosina (H & E), analizar las muestras. 29

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

El uso de este protocolo, podemos obtener cientos de colonias de 1 x 10 5 nucleofected PB MNC (Figuras 1A y 1B). La eficiencia de reprogramación es de aproximadamente 0,2 a 0,5% y las colonias expresan marcadores de pluripotencia (Figuras 1C y 1D). iPSCs generadas utilizando el protocolo descrito están libres de integración y tienen la capacidad de formar teratoma componer las 3 capas germinales (Figuras 1E y 1F).

Figura 1
Figura 1: Generación de células iPS sin integración a partir de células mononucleares de sangre periférica. (A): A esquemática del protocolo para la reprogramación de células de sangre periférica. (B): tinción de AP a granel (izquierda) y una colonia típica ESC-como IPSC (derecha)60; 14 d después de la PB MNC nucleofection. Barra de escala: 100 micras. (C): FACS representativos diagramas de iPSCs en el paso 5 que expresa TRA-1-60 o SSEA4. (D): confocal de imágenes representativas de las colonias IPSC que expresan NANOG y Oct4. Barra de escala: 100 micras. (E): imagen representativa de la imagen total y tinción H & E del teratoma que comprende las tres capas germinales. Barra de escala: 100 micras. (F): número de copias de plásmidos EV residuales en iPSCs después de cinco pasajes. cebadores específicos para EBNA1 y WPRE se utilizaron para amplificar los vectores episomales. GAPDH se utilizó como control de carga de ADN. UD, indetectable. El carril positivo indica un control con una sola copia. Haga clic aquí para ver una versión más grande de esta figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

La adquisición de las muestras de sangre de donantes sanos o pacientes es conveniente y no invasivo, lo que es una fuente de células atractiva para la investigación básica y clínica de terapia celular. Aquí hemos descrito un protocolo para la generación altamente eficiente de iPSCs libre de integración a partir de muestras de sangre periférica. Este enfoque reproducible y asequible debería beneficiar al campo de IPSC.

Hemos informado que hay dos factores críticos responsables de la reprogramación PB altamente eficiente 30. Una de ellas es la expresión equimolar de Oct4 y Sox2 mediante el uso de un enlazador 2A 31. Para lograr esto, PEV-OCT4-2A-Sox2 se utiliza en este protocolo. El otro es el uso de dos plásmidos pEV-myc y pEV-KLF4 expresar MYC y KLF4 en lugar de pEV-MYC-2A-KLF4 que previamente hemos utilizado 30. El cambio aparentemente simple conduce a un aumento de aproximadamente 100 veces en la eficiencia de reprogramación del PP, que se debe en gran parte a un aumento gradual y mayor en el MYC: KLrelación F4 durante el curso del proceso.

Varios puntos deben ser considerados para lograr alta eficiencia en la generación de IPSC de PB. MNCs PB se cultivan durante ~ 1 semana en medio eritroide, que promueve la proliferación y expansión de las células progenitoras eritroides y por lo tanto aumenta la eficiencia de reprogramación 20. Sin embargo, para algunas muestras, especialmente para células de sangre de los pacientes de leucemia, las células sobreviven mal cuando se cultivan en un medio de eritroide. En este caso, sería útil para disminuir el tiempo de cultivo. También se recomienda utilizar 1-2 g pmaxGFP vector para verificar la eficiencia nucleofection, que debe ser mayor que 50%. Además, la calidad plásmido es importante. Se recomienda el uso de plásmidos sin contaminación de endotoxina (es decir, utilizando Endo-libre Kit Maxi de plásmido para extraer los plásmidos). La mala calidad del plásmido puede conducir a la muerte celular significativa y por lo tanto reducir la eficiencia de reprogramación. Nosotros y otros han demostrado que la hipoxia promoit generación de IPSC 14,32. Nos ras de la cámara de hipoxia con un gas mixto compuesto de 92% de N2, CO2 al 5% y el 3% de O2. Si se utiliza en lugar normoxia, se puede observar una reducción de hasta el 80% en la eficiencia de reprogramación. Una vez que la reprogramación haya terminado, iPSCs se pueden cultivar en un habitual humidificado 5% de CO2. Cuando el cambio de medio, es útil dejar una pequeña cantidad de medio gastado (es decir, 500 l por pocillo en una placa de 6 pocillos), y luego añadir medio fresco. Cambio de medio cada dos días durante la reprogramación, como el cambio medio demasiado frecuente puede reducir la generación de células iPS 33.

El nuevo protocolo hemos desarrollado ha logrado una reprogramación PB de alto nivel que es comparable al sistema de SV reprogramación. El sistema EV tiene varias ventajas obvias. Por un lado, EV es más asequible que el SV. El sistema EV también puede ser modificado adicionalmente mediante la inclusión de factores adicionales o diferentes Combinalas de múltiples factores, mientras que los vectores SVS son un producto comercial que no puede ser modificada por los investigadores. Nuestro protocolo actual incluye el uso de células de alimentación MEF y productos derivados de animales, lo que puede limitar las aplicaciones clínicas, pero puede ser eliminado fácilmente por el desarrollo más protocolo 34,35.

iPSCs generados con este sistema se pueden utilizar no sólo para el modelado de la enfermedad y de detección de drogas, sino también para la terapia clínica, porque plásmidos GMP-nivel EV se pueden generar con facilidad y no hay iPSCs con considerable integración EV se ha identificado. En aplicaciones clínicas, las células del paciente generalmente albergan un gen inductor de la enfermedad, que necesita ser corregido en las iPSCs antes de la diferenciación en células funcionales para la terapia. Un informe reciente mostró que el sistema EV reprogramación puede ser fácilmente integrado con el sistema / Cas9 CRISPR para lograr la reprogramación y editar simultáneamente genoma después de una sencilla nucleofection 36. Esto es untro de ventaja sobre el sistema EV SV. Nuestros datos no publicados han demostrado que hasta un genoma edición de la eficiencia del 20% se puede lograr cuando lleva a cuestas a la edición del genoma en EV reprogramación. Tenemos la esperanza de que la integración de la reprogramación PB con CRISP / Cas9R genoma de edición puede tener aplicaciones potenciales en el tratamiento de múltiples enfermedades que de otro modo son incurables en las próximas décadas.

En resumen, nuestro protocolo de reprogramación celular de la sangre periférica mejorada debería ser útil para una amplia gama de investigadores en la investigación básica y aplicaciones clínicas. Este sistema EV reprogramación eficiente también se puede emplear, después de modificaciones, para generar células libres de integración madre mesenquimales (MSC) 37, o las células madre neurales (NSC) 38, directamente a partir de células de sangre periférica de adultos, sin pasar por una etapa de IPSC.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Hematopoietic Stem Cell Expansion Medium Sigma S0192 Store at 4 °C
Human Stem Cell Factor (SCF) Peprotech 300-07 Store at -20 or -80 °C
Interleukin-3 (IL-3) Peprotech AF-200-03 Store at -20 or -80 °C
Erythropoietin (EPO) Peprotech 100-64 Store at -20 or -80 °C
Insulin Growth Factor-1 (IGF-1) Peprotech 100-11 Store at -20 or -80 °C
Dexamethasone Sigma D4902 Store at -20 or -80 °C
1-thioglycerol (MTG) Sigma M6145 Store at -20 or -80 °C
DMEM/F12 medium Gibco 112660-012 Store at 4 °C
L-glutamine (100x) Gibco 25030-081 Store at -20 °C
Penicillin/Streptomycin (100x) Gibco 15140-122 Store at -20 °C
Non-essential Amino Acids solution (100x) Gibco 11140-050 Store at 4 °C
Fibroblast Growth Factor 2 (FGF2) Peprotech 100-18B Store at -20 or -80 °C
Insulin-Transferrin-Selenium (ITS, 100x) Gibco 41400-045 Store at 4 °C
Ascorbic acid Sigma 49752 Store at -20 °C
DMEM (high glucose) medium Thermo SH30243.01B Store at 4 °C
Fetal Bovine Serum (FBS) Hyclone SV30087.01 Store at -20 °C
Ficoll GE Healthcare, SIGMA 17-5442-02 Store at RT
Trehalose Sigma T9531 Store at 4 °C
Dimethylsulfoxide (DMSO) Sigma D2650 Store at RT, protect from light
Endofree Plasmid Maxi Kit (10) Qiagen 12362 Store at RT
IMDM Gibco 21056-023 Store at 4 °C
Human CD34+ Cell Nucleofection Kit Lonza VPA-1003 Store at RT, nucleofection buffer and supplement should be stored at 4 °C
Sodium Butyrate Sigma B5887 Store at -20 or -80 °C
ROCK inhibitor - Y27632 STEMGENT 04-0012-10 Store at -20 °C
Essential 8 basal medium (E8) Gibco A15169-01 Store at 4 °C, the supplement should be stored at -20 or -80 °C
Matrigel BD 354277 Store at -20 or -80 °C
2x EasyTaq PCR SuperMix (+dye) TransGen Biotech AS111 Store at -20 °C
Cell detachment solution STEMGENT 01-0006 Store at -20 °C, Accutase as a cell detachment solution to obtain a single-cell suspension
DAPI Sigma D9542-1MG Store at 4 or -20 °C
Anti-Nanog AF488 BD 560791 Store at 4 °C, primary antibody used for Immunofluorescence, dilute 1/100 when used
Anti-OCT4 abcam ab19857 Store at 4 °C, primary antibody used for Immunofluorescence, dilute 1/100 when used
AF488 donkey anti-mouse IgG Invitrogen A21202 Store at 4 °C, secondary antibody used for Immunofluorescence,  dilute 1/500 when used
PE anti-human TRA-1-60-R antibody Biolegend 330610 Store at 4 °C, antibody used for flow cytometry
eFluor 570-conjugated anti-SSEA4 eBioscience 41-8843 Store at 4 °C, antibody used for flow cytometry
Isotype antibody eBioscience 11-4011 Store at 4 °C, antibody used for flow cytometry
Alkaline Phosphatase Detection Kit SiDanSai 1102-100 Store at 4 °C
Genomic DNA Extraction Kit TIANGEN DP304-02 Store at RT
Trypan Blue solution Sigma T8154 Store at RT
Flow cytometry cell analyzer BD LSRII
Spinning Disk Confocal microscope (SDC) PerkinElmer UltraVIEW VOX for confocal imaging
Nucleofection device Lonza Nucleofector 2b for the nucleofection of PB MNC
ImageQuant LAS-4010 GE to take photos of AP staining in bulk

DOWNLOAD MATERIALS LIST

References

  1. Takahashi, K., Yamanaka, S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell. 126, 663-676 (2006).
  2. Takahashi, K., et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell. 131, 861-872 (2007).
  3. Trounson, A., McDonald, C. Stem Cell Therapies in Clinical Trials: Progress and Challenges. Cell Stem Cell. 17, 11-22 (2015).
  4. Hayes, M., Zavazava, N. Strategies to generate induced pluripotent stem cells. Methods Mol Biol. 1029, 77-92 (2013).
  5. Zhang, X. B. Cellular reprogramming of human peripheral blood cells. Genomics Proteomics Bioinformatics. 11, 264-274 (2013).
  6. Schlaeger, T. M., et al. A comparison of non-integrating reprogramming methods. Nat Biotechnol. 33, 58-63 (2015).
  7. Okita, K., et al. An efficient nonviral method to generate integration-free human-induced pluripotent stem cells from cord blood and peripheral blood cells. Stem Cells. 31, 458-466 (2013).
  8. Carey, B. W., et al. Reprogramming factor stoichiometry influences the epigenetic state and biological properties of induced pluripotent stem cells. Cell Stem Cell. 9, 588-598 (2011).
  9. Dorigo, O., et al. Development of a novel helper-dependent adenovirus-Epstein-Barr virus hybrid system for the stable transformation of mammalian cells. J Virol. 78, 6556-6566 (2004).
  10. Dowey, S. N., Huang, X., Chou, B. K., Ye, Z., Cheng, L. Generation of integration-free human induced pluripotent stem cells from postnatal blood mononuclear cells by plasmid vector expression. Nat Protoc. 7, 2013-2021 (2012).
  11. Harms, P. W., et al. Next generation sequencing of Cytokeratin 20-negative Merkel cell carcinoma reveals ultraviolet-signature mutations and recurrent TP53 and RB1 inactivation. Mod Pathol. 29, 240-248 (2016).
  12. Abyzov, A., et al. Somatic copy number mosaicism in human skin revealed by induced pluripotent stem cells. Nature. 492, 438-442 (2012).
  13. Martincorena, I., et al. Tumor evolution. High burden and pervasive positive selection of somatic mutations in normal human skin. Science. 348, 880-886 (2015).
  14. Su, R. J., Neises, A., Zhang, X. B. Generation of iPS Cells from Human Peripheral Blood Mononuclear Cells Using Episomal Vectors. Methods Mol Biol. 1357, 57-69 (2016).
  15. Seki, T., et al. Generation of induced pluripotent stem cells from human terminally differentiated circulating T cells. Cell Stem Cell. 7, 11-14 (2010).
  16. Loh, Y. H., et al. Reprogramming of T cells from human peripheral blood. Cell Stem Cell. 7, 15-19 (2010).
  17. Kishino, Y., Seki, T., Yuasa, S., Fujita, J., Fukuda, K. Generation of Induced Pluripotent Stem Cells from Human Peripheral T Cells Using Sendai Virus in Feeder-free Conditions. J Vis Exp. (2015).
  18. Seki, T., Yuasa, S., Fukuda, K. Generation of induced pluripotent stem cells from a small amount of human peripheral blood using a combination of activated T cells and Sendai virus. Nat Protoc. 7, 718-728 (2012).
  19. Gill, S., June, C. H. Going viral: chimeric antigen receptor T-cell therapy for hematological malignancies. Immunological reviews. 263, 68-89 (2015).
  20. Su, R. J., et al. Efficient generation of integration-free ips cells from human adult peripheral blood using BCL-XL together with Yamanaka factors. PLoS One. 8, e64496 (2013).
  21. Li, Y., et al. The p53-PUMA axis suppresses iPSC generation. Nat Commun. 4, 2174 (2013).
  22. Hardwick, J. M., Youle, R. J. SnapShot: BCL-2 proteins. Cell. 138, 404 (2009).
  23. Wen, W., et al. Enhanced Generation of Integration-free iPSCs from Human Adult Peripheral Blood Mononuclear Cells with an Optimal Combination of Episomal Vectors. Stem Cell Reports. 6, 873-884 (2016).
  24. Zhang, X. B., et al. Trehalose ameliorates the cryopreservation of cord blood in a preclinical system and increases the recovery of CFUs, long-term culture-initiating cells, and nonobese diabetic-SCID repopulating cells. Transfusion. 43, 265-272 (2003).
  25. Watanabe, K., et al. A ROCK inhibitor permits survival of dissociated human embryonic stem cells. Nat Biotechnol. 25, 681-686 (2007).
  26. Basu, S., Campbell, H. M., Dittel, B. N., Ray, A. Purification of specific cell population by fluorescence activated cell sorting (FACS). J Vis Exp. (2010).
  27. Castiel, A., et al. Cell death associated with abnormal mitosis observed by confocal imaging in live cancer cells. J Vis Exp. e50568 (2013).
  28. Peterson, S. E., et al. Teratoma generation in the testis capsule. J Vis Exp. e3177 (2011).
  29. Ritner, C., Bernstein, H. S. Fate mapping of human embryonic stem cells by teratoma formation. J Vis Exp. (2010).
  30. Wen, W., et al. Enhanced Generation of Integration-free iPSCs from Human Adult Peripheral Blood Mononuclear Cells with an Optimal Combination of Episomal Vectors. Stem Cell Reports. (2016).
  31. Lo, C. A., et al. Quantification of Protein Levels in Single Living Cells. Cell Rep. 13, 2634-2644 (2015).
  32. Liu, S. P., et al. An improved method for generating integration-free human induced pluripotent stem cells. Zhongguo Shi Yan Xue Ye Xue Za Zhi. 22, 580-587 (2014).
  33. Luni, C., et al. High-efficiency cellular reprogramming with microfluidics. Nat Methods. 13, 446-452 (2016).
  34. Chou, B. K., et al. A facile method to establish human induced pluripotent stem cells from adult blood cells under feeder-free and xeno-free culture conditions: a clinically compliant approach. Stem Cells Transl Med. 4, 320-332 (2015).
  35. Nakagawa, M., et al. A novel efficient feeder-free culture system for the derivation of human induced pluripotent stem cells. Sci Rep. 4, 3594 (2014).
  36. Howden, S. E., et al. Simultaneous Reprogramming and Gene Correction of Patient Fibroblasts. Stem Cell Reports. 5, 1109-1118 (2015).
  37. Meng, X., et al. Rapid and efficient reprogramming of human fetal and adult blood CD34+ cells into mesenchymal stem cells with a single factor. Cell research. 23, 658-672 (2013).
  38. Liao, W., et al. Direct Conversion of Cord Blood CD34+ Cells Into Neural Stem Cells by OCT4. Stem cells translational medicine. 4, 755-763 (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics