Ketoconazole binds to and antagonizes Pregnane X Receptor (PXR) activation. Yeast high throughput screens of PXR mutants define a unique region for ketoconazole binding. This yeast-based genetic method discovers novel nuclear receptor interactions with ligands that associate with surface binding sites.
As a critical regulator of drug metabolism and inflammation, Pregnane X Receptor (PXR), plays an important role in disease pathophysiology linking metabolism and inflammation (e.g. hepatic steatosis)1,2. There has been much progress in the identification of agonist ligands for PXR, however, there are limited descriptions of drug-like antagonists and their binding sites on PXR3,4,5. A critical barrier has been the inability to efficiently purify full-length protein for structural studies with antagonists despite the fact that PXR was cloned and characterized in 1998. Our laboratory developed a novel high throughput yeast based two-hybrid assay to define an antagonist, ketoconazole's, binding residues on PXR6. Our method involves creating mutational libraries that would rescue the effect of single mutations on the AF-2 surface of PXR expected to interact with ketoconazole. Rescue or "gain-of-function" second mutations can be made such that conclusions regarding the genetic interaction of ketoconazole and the surface residue(s) on PXR are feasible. Thus, we developed a high throughput two-hybrid yeast screen of PXR mutants interacting with its coactivator, SRC-1. Using this approach, in which the yeast was modified to accommodate the study of the antifungal drug, ketoconazole, we could demonstrate specific mutations on PXR enriched in clones unable to bind to ketoconazole. By reverse logic, we conclude that the original residues are direct interaction residues with ketoconazole. This assay represents a novel, tractable genetic assay to screen for antagonist binding sites on nuclear receptor surfaces. This assay could be applied to any drug regardless of its cytotoxic potential to yeast as well as to cellular protein(s) that cannot be studied using standard structural biology or proteomic based methods. Potential pitfalls include interpretation of data (complementary methods useful), reliance on single Y2H method, expertise in handling yeast or performing yeast two-hybrid assays, and assay optimization.
The yeast two-hybrid (Y2H) assay is widely used to discover protein-protein interactions and more recently for discovery of novel small molecules that disrupt protein-protein interaction complexes 7, 8, 9, 10, 11. However, the conventional approaches of this assay, used for drug discovery or "hits", do not allow for detection of allosteric interaction residues of chemicals compounds within protein-protein surfaces, that when altered still interact and allow for interrogation of the altered residues11. Indeed, such a method(s), if feasible to develop, would enable a tractable yeast system for high throughput assessment of allosteric interaction residues critical for protein-protein interaction disruption. In the context of drug discovery, the most direct way to establish interaction of compounds with proteins would involve structural determination (e.g. crystalization of protein-inhibitor complex). These methods are cumbersome, use elaborate resources and it is not technically feasible to perform structural studies on every protein.
Tractable genetic drug screening systems have been established in bacteria1, 2 and other model systems like mammalian two-hybrid. However, these systems need optimization and alternative systems like Y2H are still the most tested in drug discovery. There are limitations that include poor sensitivity and reliability of interactions using singular methods13 , however, a single Y2H assay can be modified to answer specific questions regarding interaction residues. In the field of nuclear receptor research, Y2H has been used to define interacting proteins14, however, these protein interactions have rarely been used to define the nature in which ligands/antagonists interact with nuclear receptor-protein complexes. Thus, our laboratory focused efforts on defining a method, especially for receptor proteins that are not readily amenable to proteomic based methods, that would unearth novel ligand/antagonist interacting residues using a reverse Y2H based discovery platform.
Based on our previous finding that ketoconazole disrupts PXR and its activator SRC-1, we developed a novel reverse Y2H system that enable us to define and interrogate ketoconazole interacting residues on PXR6. Our method is based on the properties of the yeast GAL4 protein that consists of separable domains responsible for DNA-binding and transcriptional activation. The PXR LBD protein is expressed as a fusion to the LexA DNA-binding domain (DNA-BD), while the full length co-activators SRC-1 (steroid receptor coactivator 1) proteins are expressed as fusions to the GAL4 activation domain (AD). Interaction between PXR and SRC-1 fusion proteins leads to the transcriptional activation of GAL4-binding sites containing reporter gene β-LacZ that is integrated into the yeast genome. Ketoconazole, a PXR antagonist, disrupts PXR and SRC-1 interaction 15, 16, 17 and we can detect the interaction of PXR and SRC-1 in the presence or absence of ketoconazole after staining colonies on filters for X-gal activity. The principle of Y2H is illustrated in Figure 1 and the experimental procedure is summarized in Figure 2.
In our modified Y2H assay, we have identified important residues for ketoconazole interactions on PXR6. Since SRC-1 is a coactivator (and was cloned into the pGADNot vector), we also tested whether SRC-1 could activate lacZ expression when cloned into the pSH vector system and whether this would change the activation profile and/or affect the leakiness of the yeast two-hybrid assay. Using our redesigned plasmids we performed two-hybrid assays in erg3Δ/erg11Δ yeast. As before, we sho…
The authors have nothing to disclose.
This work was supported by National Institutes of Health (NIH) Grants CA127231 and The Damon Runyon Foundation Clinical Investigator Award (CI 1502) (to S.M). We would like to thank Professor Zdenek Dvorak from Palacky University Olomouc, Czech Republic for his helpful insights into discussing portability of this technique to their institution and standardization of protocol.
Name | Company | Catalog Number | Comments |
Yeast Strain CTY10-5d erg3Δ/erg11Δ | Our lab | CTY10-5d yeast was double knocked out ERG3 and ERG11 (erg3Δ/erg11Δ) genes6 . | |
YPD Growth Medium | BD Biosciences | 630409 | |
Difco Yeast Nitrogen Base (YNB) w/o Amino Acids and Ammonium Sulfate | BD Biosciences | 233520 | |
Bacto Agar | BD Biosciences | 214010 | |
CSM-His/-Leu Complete Supplement Mixture | MP Biomedicals | 4250-412 | |
ONPG (o-Nitrophenyl Β-D- Galactopyranoside). | Sigma-Aldrich | N1127 | |
2-Mercaptoethanol | Sigma-Aldrich | M6250 | |
Luria Broth (LB) | Sigma-Aldrich | L3022 | |
X-Gal | Fisher | BP-1615 | |
Sonicated Salmon Sperm DNA boiled (10 mg/ml) | Life Technology | 156-017 | |
Ampicillin | Acros Organics | 61177 | |
Ketoconazole | Sigma-Aldrich | K1003 | |
N,N-Dimethylformamide | Acros Organics | 326871000 | |
Lithium Acetate | Sigma-Aldrich | L4158 | |
50% PEG-3350 solution, filter-sterilized | Sigma-Aldrich | P-3640 | |
Nitrocellulose Membrane | Whatman | 10402091 | |
10 cm Petri Dish | Fisher | 875712 | |
5'-ACCGGATCCCGATGAAGA AGGAGATGATCATGTCC-3' | our lab | PXR LBD forward primer for pSH2-1 | |
5'-AGAGTCGACTCAGCTA CCTGTGATGCC -3' | our lab | PXR LBD reverse primer for pSH2-1 | |
5'-TATAGC GGCCGCATGAGTG GCCTCGGGGACAGTTCATCC -3' | our lab | SRC-1 forward primer for pGADNOT | |
5'-GCGGTCGACTTATTCAGTCA GTAGCTG -3' | our lab | SRC-1 reverse primer for pGADNOT | |
Platinum PCR Supermix | Invitrogen | 11306-016 | |
BamHI | our lab | R0136 | |
SalI | our lab | R0138 | |
NotI | our lab | R0189 |