염료 기반 화학 및 액적 디지털 PCR 기술을 사용한 cell-free microRNA 정량화를 위한 민감하고 정확한 방법에 대해 설명합니다.
Access restricted. Please log in or start a trial to view this content.
Access restricted. Please log in or start a trial to view this content.
Access restricted. Please log in or start a trial to view this content.
Access restricted. Please log in or start a trial to view this content.
Access restricted. Please log in or start a trial to view this content.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| miRNeasy Mini Kit | Qiagen | 217004 | Columns는 miRNA를 포함한 총 RNA, 혈청/플라즈마에서 추출, |
| 100 nmole RNA oligo Cel-miR-39-3p | Integrated DNA Technologies | 맞춤형 | 시퀀스: UCACCGGGUGUAAAUCAGCUUG |
| Universal cDNA 합성 키트 II, 8-64 rxns | Exiqon | 203301 | 키트, microRNA 역전사 |
| MicroRNA LNA PCR 프라이머 세트 | Exiqon | 204000-206xxx 및 2100000-21xxxxx | miRNA 증폭용 프라이머 |
| QX200 액적 발생기 | BioRad | 186-4002 | 액적 판독에 사용되는 기기 |
| QX200 액적 판독기 | BioRad | 186-4003 | 액적 생성에 사용되는 기기 |
| QuantaSoft 소프트웨어 | BioRad | 186-3007 | 데이터 수집 및 분석 |
| PX1 PCR 플레이트 씰러 | BioRad | 181-4000 | 플레이트 씰러 |
| DG8 액적 발생기 카트리지 및 개스킷 | BioRad | 186-4008 | 샘플과 오일을 혼합하여 액적을 생성하는 데 사용되는 카트리지 |
| QX200 ddPCR EvaGreen 슈퍼믹스 | BioRad | 186-4033/36 | PCR 슈퍼믹스 |
| QX200 액적 발생기 오일 EvaGreen 염료 | BioRad | 186-4005 | 액적 생성용 오일 |
Access restricted. Please log in or start a trial to view this content.
Request permission to reuse the text or figures of this JoVE article
Request Permission