| agar | Carl Roth GmbH + Co. KG, Karlsruhe, Germany | 5210.4 | |
| agarose | Carl Roth GmbH + Co. KG, Karlsruhe, Germany | 6352.4 | |
| D-mannitol | Carl Roth GmbH + Co. KG, Karlsruhe, Germany | 4175.1 | |
| glucose | Carl Roth GmbH + Co. KG, Karlsruhe, Germany | 6780.1 | |
| LB | Carl Roth GmbH + Co. KG, Karlsruhe, Germany | X964.3 | |
| malt extract | Carl Roth GmbH + Co. KG, Karlsruhe, Germany | X976.2 | |
| MgCl2 | Carl Roth GmbH + Co. KG, Karlsruhe, Germany | 2189.1 | |
| Peptone | Carl Roth GmbH + Co. KG, Karlsruhe, Germany | | |
| soy flour | W.Schoenemberger GmbH, Magstadt, Germany | | Hensec-Vollsoja |
| tryptic soy broth | Carl Roth GmbH + Co. KG, Karlsruhe, Germany | X938.3 | Caso-Bouillon |
| yeast extract | Carl Roth GmbH + Co. KG, Karlsruhe, Germany | 2363.2 | |
| Solvents | | | |
| Acetic acid | Carl Roth GmbH + Co. KG, Karlsruhe, Germany | 3738.5 | |
| Acetone | Carl Roth GmbH + Co. KG, Karlsruhe, Germany | 9372.2 | |
| Acetonitrile | Avantor Performance Materials B.V., Deventer, The Netherlands | JT-9012-03 | |
| Dichlorofrom | Fisher Scientific GmbH, Schwerte, Germany | 1530754 | |
| DMSO (Dimethyl sulfoxide) | Carl Roth GmbH + Co. KG, Karlsruhe, Germany | 4720.1 | |
| DMSO-d6 (Dimethyl sulfoxide-d6) 99.9 atom% D | ARMAR Chemicals, Döttingen, Switzerland | 15200.204 | |
| Ethyl acetate | Carl Roth GmbH + Co. KG, Karlsruhe, Germany | 6784.4 | |
| Hydrochloric acid | Carl Roth GmbH + Co. KG, Karlsruhe, Germany | 6331.4 | |
| Methanol | Carl Roth GmbH + Co. KG, Karlsruhe, Germany | 7342.1 | |
| Enzymes | | | |
| restriction enzymes | New England Biolabs GmbH, Frankfurt am Main, Germany | | |
| polymerase | New England Biolabs GmbH, Frankfurt am Main, Germany | | |
| DNA Polymerase I Large (Klenow) Fragment | Promega GmbH, Mannheim, Germany | | |
| Antibiotics | | | |
| apramycin | AppliChem GmbH, Darmstadt, Germany | A7682.0005 | |
| fosfomycin | Sigma-Aldrich Chemie GmbH, Taufkirchen, Germany | P5396-50G | |
| kanamycin | Carl Roth GmbH + Co. KG, Karlsruhe, Germany | T832.2 | |
| Plasmid/Vectors | | | |
| pKC1132 | Bierman et al. 1992 | | |
| Primer | | | |
| pokPI_for | TGATGGTGCCGCTGGCCATGG | Primer om fragment met pokPI gen te versterken | |
| pokPI_rev | AGCGTTCACTGTTCCGCCCGAC | | |
| Bacteriastammen | | | |
| Bacillus subtilis COHN ATCC6051 | | Gram-positieve test stam | |
| Escherichia coli ET12567 pUZ8002 | MacNeil et al. 1992 | stam voor conjugatie | |
| Escherichia coli XL1 Blue | Agilient Technologies, Santa Clara, USA | Gram-negatieve test stam + kloneringsgastheer | |
| Streptomyces diastatochromogenes Tü6028 | Paululat et al., 1999 | Polyketomycine producent | |
| Online diensten | | | |
| antismash (Antibiotics and Secondary Metabolite Analysis Shell) | http://antismash.secondarymetabolites.org/ | Detectie van secundair metaboliet gen cluster | |
| BLAST (Basic Local Alignment Search Tool) | http://blast.ncbi.nlm.nih.gov/Blast.cgi | vindt regio's van overeenkomst tussen biologische sequenties | |
| GenDB | https://www.uni-giessen.de/fbz/fb08/Inst/bioinformatik/software/gendb | Annotatie van ORFs | |
| MiBIG (Minimum Information about a Biosynthetic Gene cluster) | http://mibig.secondarymetabolites.org/ | Database van biosynthetische gen clusters | |
| NaPDoS | http://napdos.ucsd.edu/ | Detectie van secundair metaboliet gen cluster | |
| NCBI Prokaryotic Genome Annotation Pipeline | http://www.ncbi.nlm.nih.gov/genome/annotation_prok/ | Annotatie van ORFs | |
| NRPSpredictor | http://nrps.informatik.uni-tuebingen.de/ | Detectie van NRPS domeinen | |
| Prokka (rapid prokaryotic genome annotation) | http://www.vicbioinformatics.com/software.prokka.shtml | Annotatie van ORFs | |
| RAST (rapid annotation using subsystems technology) | http://rast.nmpdr.org/ | Annotatie van ORFs | |
| Andere programma's | | | |
| Chem Station Rev. A.09.03 | Agilent Technologies, Waldbronn, Germany | Behandelingsprogramma voor HPLC | |
| Clone Manager Suite 7 | Scientific and Educational Software, Cary, USA | Ontwerpen van klonering experiment | |
| Newbler v2.8 | Roche Diagnostics | Uitlijning van sequencing reads | |
| Machines | | | |
| Centrifuge Avanti J-6000, Rotor JA-10 | Beckman Coulter GmbH, Krefeld, Germany | | |
| HPLC/MS | Agilent Technologies, Waldbronn, Germany | | |
| _Autosampler: G1313A | Agilent Technologies, Waldbronn, Germany | | |
| _Pre-column: XBridge C18 (20 mm x 4.6 mm; deeltjesgrootte: 3.5 µm) | Agilent Technologies, Waldbronn, Germany | | |
| _Column: |