Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Medicine

Die Beurteilung Teratogene Änderungen in einem Zebrafisch-Modell der Fetal Alcohol Exposure

doi: 10.3791/3704 Published: March 20, 2012

Summary

Um die molekularen Mechanismen des Ethanol-induzierte Entwicklungsstörungen verstehen, haben wir einen Zebrafisch-Modell von Ethanol Exposition entwickelt und erforschen die physikalischen, zellulären und genetischen Veränderungen, die nach der Exposition auftreten Ethanol

Abstract

Fetale Alkoholsyndrom (FAS) ist eine schwere Manifestation der embryonalen Exposition gegenüber Ethanol. Es stellt sich mit charakteristischen Defekten im Gesicht und Organe, einschließlich mentaler Retardierung aufgrund ungeordneter und beschädigten die Entwicklung des Gehirns. Fetale Alkohol-Spektrum-Störung (FASD) ist ein Begriff verwendet, um ein Kontinuum von Geburtsschäden, die aufgrund mütterlichen Alkoholkonsum auftreten zu decken, und tritt bei etwa 4% der Kinder in den Vereinigten Staaten geboren. Mit 50% der gebärfähigen Alter Frauen berichten Konsum von Alkohol, und die Hälfte aller Schwangerschaften ungeplant sein, ist ein anhaltender unbeabsichtigten Exposition Ausgabe 2. Um am besten verstehen, den Schaden durch Ethanol produziert, plus ein Modell zu produzieren, mit denen potenzielle Interventionen zu testen, entwickelten wir ein Modell der Entwicklungspsychologie Ethanolexposition Verwendung der Zebrafisch-Embryos. Zebrafische sind ideal für diese Art von Studie Teratogen 3-8. Jedes Paar legt Hunderte von Eiern, die dann ohne Schädigung der Erwachsenen gesammelt werden könnenFisch. Die Zebrafisch ist transparent und kann leicht mit einer beliebigen Anzahl von Flecken abgebildet werden. Die Analyse dieser Embryonen nach Exposition mit Ethanol in verschiedenen Dosierungen und Zeiten der Dauer und der Anwendung zeigt, dass die grobe Entwicklungsstörungen durch Ethanol produziert im Einklang mit der menschlichen Geburtsfehler sind. Hier beschrieben werden die grundlegenden Techniken verwendet, um zu studieren und manipulieren das Zebrafisch-FAS-Modell.

Protocol

1. Ethanol Behandlung der Embryonen

  1. Zebrafisch-Embryonen aus Wildtyp-Paarungen abgeleitet wurden bei 28 ° C erhöht, in 5 ml Wasser Embryo. (Milli-Q Wasser mit 60 mg / L Instant Ocean). Verschiedene Stämme von Wildtyp-Embryonen haben leicht unterschiedliche Toleranzen, um die Exposition 9 Ethanol.
  2. Die Exposition gegenüber Ethanol wurde bei Kuppel Stufe (~ 4,3 Stunden nach der Befruchtung, HPF) für die gewünschte Zeitdauer eingeleitet, bis zu 24 h Puls. Diese Startphase ist etwa vergleichbar mit der Implantation der Bühne von Säugetier-Embryonen, kurz vor der Gastrulation. Ethanol verwendeten Konzentrationen reichen von 0,2% -2,5%, Volumen / Volumen. Tests haben gezeigt, dass 25-50% der Lösung in dem Wasser am Ende in den sich entwickelnden Embryo 10, 11. Die Embryonen werden bei 28 ° C für die gewünschte Zeitdauer gehalten. Nach der gewünschten Länge von Ethanolexposition wird das Ethanol-Wasser-Lösung entfernt und mit drei Wäschen mit regelmäßigen Zebrafisch Wasser ersetzt und gehalten for die gewünschte Länge der Zeit. Die Spezifität des Mangels hängt von der Zeit des Beginns, der Dosis und der Länge des Pulses von Ethanol.

2. Sammlung von Embryonen für die RNA in situ Hybridisierung, Antikörper und Knorpel Färbung

  1. Um mRNA für die qPCR sammeln, sind gleichaltrigen Embryonen in Eppendorf-Röhrchen gesammelt. Nach dem Entfernen des Zebrafisch Wasser, Lysepuffer mit TCEP zugegeben. Eine motorisierte pulverisiert wird verwendet, um physisch distanzieren die Embryonen in der Lyse-Lösung. Dieses wird dann durch eine Preclear Spalte, die keine große Stücke entfernt undissoziierten geleitet. Die resultierende Lösung enthält alle Makromoleküle durch die Lyse freigesetzt. RNA wird dann, indem Sie diese Lösung auf einer Säule, gefolgt von Waschungen und DNAse-Behandlung extrahiert. Die Elution wird dann unter Verwendung von entweder Wasser oder einer Elutionslösung vom Hersteller (5'-Prime) vorgesehen ist. Die RNA kann, um cDNA umgewandelt werden unter Verwendung von Standardtechniken für die qPCR oder Mikroorganismen eingesetztArray-Analyse.
  2. Für die in situ Hybridisierung und Antikörper-Färbung, Embryonen 6-24 hpf wurden in 4% Paraformaldehyd über Nacht bei 4 ° C fixiert Dies wird mit 3 Waschschritten in PBS + 0,1% Tween (PBT), Embryonen aus aneinander haften gefolgt. Die Embryonen werden dann durch eine Reihe von 3 Methanol übertragen: PBT wäscht in 100% Methanol, an welcher Stelle sie bei -20 ° C gelagert werden können Diese Embryonen können in situ-Hybridisierung oder Antikörper-Färbung verwendet werden. Einige Antikörper funktionieren nicht nach Methanol-Behandlung, so dass diese Einschränkung zu berücksichtigen und Ihre spezifischen Antikörper getestet, um festzustellen, ob es nach der Behandlung mit Methanol wird funktionieren muss.
  3. Für Knorpel-Färbung, müssen Embryonen Anspruch 5 oder 6 Tagen nach der Befruchtung (dpf) angehoben werden. Sie werden dann in 4% Paraformaldehyd über Nacht bei 4 ° C, gefolgt von 3 Waschschritten in PBT.

3. Die Beurteilung Ethanol-induzierte Veränderungen der Genexpression und Entwicklungsfolgen

    in situ Hybridisierung untersucht. qPCR wird erreicht unter Verwendung von Primern mit Integrated DNA Technologies (IDT)-Software, dann validiert mit 3 separaten biologischen Proben entwickelt. Sobald Primer validiert wurden, wird auf qPCR cDNA aus RNA-Proben gesammelt erstellt durchgeführt. Jede Probe wird in dreifacher Ausfertigung durchgeführt. PCR-Reaktionen werden Platinum SYBR Green qPCR Super Mix (Invitrogen) auf einer Chroma-4 PCR-Maschine (BioRad) oder ähnliche PCR-Maschine mit einer Multicolor Detection System laufen. Zusätzlich zu den Genen verhört, ist es entscheidend, dass eine Steuerung der Primer festgelegt wird verwendet, um kleine Unterschiede in der cDNA oder RNA-Präparation auszugleichen. Für unsere Zebrafischembryonen verwenden wir GAPDH: 5'GAAGGTGGGAAACTGGTCAT3 'und 5'TTGCACCACCCTTAATGTGA3'. Gene, die analysiert werden dann an ein GAPDH normalisiert die relative Quantifizierung der Genexpression berechnet sich nach Pfaffl Methode Variante 2 Wildtyp-12. Die normalen Berechnung nimmt an, dass alle Gene Duplizieren der DNA zweimal für jeden Zyklus, und drückt somit die Daten als Verhältnis der Änderung im experimentellen Gens über die Änderung der Bezugs-Gen, ausgedrückt als Leistungsberechnungen über die ganze Zahl "2", welches die Effizienz der Verdoppelung der DNA pro Zyklus in einer perfekten PCR-Reaktion zu sehen. Der Pfaffl Methode ersetzt den generischen "2" mit dem Experimentator erzeugt echte Effizienz für die PCR-Primer gewählt. Er berücksichtigt genaueres Bild der Differenz in den PCR-Reaktionen. Die vollständige Formel lautet:
    (Wirksamkeit der experimentellen Gen) (CT Kontrolle Probe-Ct von behandelten Probe)
    -------------------------------------------------- -----------------------------------
    (Effizienz des Referenz-Gen) (CT vonKontrollprobe - Ct von behandelten Probe)
  1. Für die in situ Hybridisierung, Digoxigenin (DIG)-markierte Ribosonden aus Plasmiden, die Abschnitte des Gens von Interesse ausgebildet ist. Alter zusammenpassende Embryonen auf Ribosonden unter Verwendung von Standardbedingungen 13 ausgesetzt und unter Verwendung von Anti-DIG-Antikörper gekoppelt ist, um alkalische Phosphatase, die den Standort der markierte Ribosonden Verwendung einer Farbreaktion (NBT / BCIP) ermöglicht. Die Embryonen werden dann visualisiert mit einem Leica Binokular (Abbildung 1B-G).
  2. Um morphogenetische Entwicklung zu beurteilen, werden Embryonen zur gewünschten Zeit gesammelt und unter dem Binokular. Für Somiten Form, sind Live-Embryonen 14 abgebildet. Für Inter Augenabstand und Körperlänge, sind Embryonen in PFA fixiert. In allen Fällen werden die Bilder des gewünschten Bereichs auf einem Präpariermikroskop mit einer festen Vergrößerung und Messungen mit Adobe Photoshop softwar erfasste 10,14.
  3. Um die Auswirkungen der Behandlung auf die Entwicklung von Knorpel-Strukturen im Larvenstadium Zebrafisch zu untersuchen, benutzen wir Alcianblaufärbung. 20% Eisessig (Säure-Alkohol) für mehrere Stunden oder über Nacht: Fixed Zebrafischlarven sind mit Alcianblau-Lösung in 80% Ethanol gelöst behandelt. Die Larven werden in mehreren Waschungen mit Säure-Alkohol bevor sie in eine 1% KOH übertragen entfärbt: 3% Wasserstoffperoxid-Lösung für weitere Abwicklung von Pigmentzellen. Zebrafisch müssen mindestens 4 Tage alt, um Knorpel-Strukturen zeigen sein, und diese werden besser in den Fischen, die 5 oder 6 Tage alt sind definiert.
  4. Der Zelltod in lebenden Embryonen wird anhand Acridinorange (AO). AO ist zellpermeablen, lebende Zellen, und bindet an DNA in Zellen mit eingeschränkter Membranen, einschließlich der Apoptose und Nekrose. Leben Embryonen werden mit 5 mg / ml AO in PBS für 1 Stunde inkubiert, gefolgt von 3 Waschschritten in PBS. Die Embryonen werden dann bebildert mit dem konfokalen Mikroskop. Digitale Z-Sern Bilder werden kombiniert, um Verbundwerkstoffe zu schaffen.

4. Manipulation des Zebrafisch-Embryos

  1. Nach der Identifizierung von Genen, die durch Ethanolexposition verringert werden, ist es möglich, zu versuchen, sie zu ersetzen durch Injektion von mRNA konstruiert, um die fehlende Gen zu ersetzen. Capped mRNA von linearisierten DNA-Plasmide unter Verwendung von RNA-Polymerase in vitro-Transkription-Kits transkribiert, nach den Anweisungen des Herstellers (mMessage Maschine, Applied Biosystems). Zwischen 25 bis 200 pg / nl von RNA in 1-2 Zell-Stadium Zebrabärblingeier injiziert, in einer Lösung von 0,1 M KCl. Die Embryonen werden dann absetzen gelassen, mit Ethanol behandelt, wie oben (5) beschrieben erholen.
  2. Für alle, die durch Gen-Transkripte Ethanolexposition erhöht werden, können sie reduziert werden, oder "Knocked Down" mit einem Antisense-Morpholino-Technologie. Antisense Morpholinos (AMO) werden von der Firma Gene-Tools entwickelt, und blockieren die Translation von RNA in Protein oder block die Reifung und Spleißen von RNA, je nach Notwendigkeit experimentellen. Diese Aktion von Morpholinos beschränken die Menge an aktivem Protein für das Gen gezielt, ein Defizit, gemessen mit anitibodies werden können, wenn sie verfügbar sind. Die Effizienz der RNA-Spleißen Morpholinos gemessen mittels RT-PCR, die relativen Mengen der gespleißten und ungespleißten Transkripten zu detektieren. Titrieren der Morpholino kann in dosisabhängige Aktivität 15 zur Folge haben. Amos sind auf die Zusammenarbeit Konzentrationen (pg bis ng titriert Konzentration) in Danieau Lösung (58 mM NaCl, 0,7 mM KCl, 0,4 mM MgSO 4, 0,6 mM Ca (NO 3) 2, 5 mM HEPES, pH 7,6) verdünnt. Die Einspritzung erfolgt an der 1-2-Zellen-Stadium, dann werden die Embryonen erlaubt, bevor sie einer Wärmebehandlung wie oben Ethanol zu entwickeln.

5. Repräsentative Ergebnisse

Zebrafisch-Embryo Exposition gegenüber Ethanol führt zu einer Reihe von Entwicklungs-und genetischen Defekten, die verwandt sinddie Phänotypen in anderen Wirbeltieren gefunden. Wir haben eine abnorme Entwicklung der axialen Gewebe dokumentiert, einschließlich der Chorda (Daten nicht gezeigt 14). Die Entwicklungsverzögerung durch Ethanol führt anscheinend zu einer Störung der ordnungsgemäßen Chorda Dehnung, was zu einer verkürzten und gelegentlich gestört Chorda (Daten nicht gezeigt 14). Diese frühe Verzögerung und Chorda Defekt führt wahrscheinlich zum Teil auf den späteren Auffälligkeiten in den Somiten (Abb. 2), die ihre starke Form Chevron verloren haben, als in den unbehandelten Kontrollen gesehen und sind näher an den U-förmigen Somiten Merkmal der Phänotypen gesehen, wenn Sonic-Signalisierung wird 14 reduziert. Der Winkel der Somiten kann unter Verwendung von Standard-Software, und die Winkel erhöht sich von 92,1 ± 4,6 ° in den unbehandelten Kontrollen auf 122,6 ± 6,6 ° in den Ethanol-behandelten Embryonen (p <0,001) werden.

Eine weitere Folge von Ethanolexposition die downstrea sein könntenm frühen Entwicklungsverzögerung und später Chorda Mängel ist eine verkürzte Länge des Embryos (Abbildung 3). Wobei auch der Embryonen zu berücksichtigen die Krümmung durch Ethanolexposition hergestellt führt Ethanolexposition zu einer verkürzten Stamm, der abhängig von der Dosis der Embryo Ethanol ausgesetzt war ist (3E 14). Dieses Ergebnis ist vergleichbar mit der Persistenz der Vorpubertät Kleinwuchs bei Kindern, die Ethanol ausgesetzt während der Entwicklung 16, 17 gefunden, was darauf hindeutet, dass das Zebrafisch-Modell relevant für das Verständnis des menschlichen Geburtsfehler ist.

Eines der klassischen Merkmale des FAS ist ein klassisches Fazies, einschließlich einer reduzierten Kiefer, kleine Augen öffnen, und eine glatte Philtrum. Ein Großteil dieser Funktionen werden zu einer Reduktion in der Mittellinie Gewebe. Es wurde in Tiermodellen gezeigt worden, dass schwere Ethanolexposition noch stärker Phänotypen, einschließlich synopthalmia und Zyklopie führt. Wenn exposingen Zebrafischembryonen höhere Dosen von Ethanol sinkt der intraokularen Abstand (IOD) in einer dosisabhängigen Art und Weise (Abbildung 4) im Einklang mit der Natur des menschlichen Geburtsfehler. Cyclopia nur bei sehr hohen Dosen vor, aber niedriger Dosis muss eine signifikante Reduktion in der IOD (4) zu erzeugen, was darauf hindeutet, dass dieses Tiermodell einen ähnlichen Defekt in der Mitte, Gesichtsentwicklung 10 aufweist.

Um den zugrunde liegenden Mechanismus der Mängel sowohl in der Körper und das Gesicht von Ethanol produziert Exposition zu verstehen, haben wir versucht, Veränderungen der Genexpression, die früh in der Entwicklung auftreten und dass aller Voraussicht nach zu später Entwicklungsstörungen beitragen werden, zu etablieren. Wir tun dies in zweierlei Hinsicht, ermöglicht die Extraktion von mRNA, die aus Embryonen für eine quantitative Auswertung der Ebenen der Genexpression in Ethanol behandelt Embryonen im Vergleich zur Kontrollgruppe (Abbildung 1A). Darüber hinaus können wir in situ durchführenHybridisierung an das Muster von Genen zu suchen, unabhängig davon, ob das Signal verringert wird (1B-G 18). In diesem Beispiel sind zwei Gene, deren Expression nach Exposition gegenüber Ethanol verringert gezeigt, Gli1 und six3b. Wenn wir die in-situ-Muster für six3b untersucht Versuch es eine Verringerung der räumlichen Ausdehnung der Expression dieses Gens (1 Zum Beispiel) in Embryonen, die Ethanol ausgesetzt. Eine ähnliche Reduktion wurde in der GSC-Gen (Abb. BD) gefunden. Sowohl six3b und GSC sind in Geweben bestimmt, zu kraniofazialen Mittellinie Geweben beitragen ausgedrückt. So Reduktion dieser Gene bei 8 hpf steht im Einklang mit der Verringerung der IOD weiter hinten, wie in 4 gezeigt.

Wenn Gene, die durch Ethanol beeinflusst identifiziert sind, gibt es Mechanismen, durch den die Expression von ihnen erhöht oder verringert werden kann. In diesem speziellen example, haben wir zwei Gene, die sind zurückgegangen (Gli1 und six3b) durch qPCR gezeigt. Wir entschieden uns, mRNA zu injizieren, um festzustellen, ob die Umkehr dieser Genveränderungen Ergebnisse verbessern können. Für dieses Experiment statt Injektion Gli1, entschieden wir uns zu sch, ein Ligand, der Gli1 Ebenen erhöht injizieren. Für six3b, konnten wir six3b selbst zu injizieren. Wir fanden keine Veränderungen, wenn wir six3b (Daten nicht gezeigt) injiziert, sondern konnten sich retten, die grundsätzlich grobe Mängel in Zebrafisch-Embryos mit zusätzlichen Injektionen shh (Abbildung 5).

1
Abbildung 1. Ethanolexposition ändert die frühen Muster und Genexpression von ausgewählten Entwicklungs-Genen. A) qPCR-Ergebnisse für Embryonen im 8hpf. Die Ergebnisse für zwei Gene werden angezeigt: six3b und Gli1. Ergebnisse als Mittelwert von drei getrennten Experimenten gezeigt,und die Dosis von Ethanol dargestellt beträgt 2,5%. Beide Gene sind in einer Weise, die signifikante Steuerung (t-Test, p <0,05) reduziert ist. BG) In situ Hybridisierung von 8 hpf Zebrabärblinge. Sowohl GSC und six3b Muster werden zu diesem Zeitpunkt im Vergleich zur Kontrollgruppe verändert. (Modifiziert mit Erlaubnis von Loucks et al. 2007).

2
Abbildung 2. Somitenentwicklung wird in den behandelten Embryonen verändert. Somiten Struktur und Winkel bei 48 HPF untersucht. In der Kontrollgruppe Embryonen (A) haben Somiten eine Chevron-Form und einen spitzen Winkel. Ethanol ausgesetzt Zebrafisch haben mehr I-oder U-förmigen Somiten, und weniger scharfen Winkeln. (Modifiziert mit Erlaubnis von Loucks und Ahlgren 2009).

Abbildung 3
Abbildung 3. Ethanol Behandlung signifikant abnimmt Körperlänge im Zebrafisch.Die Länge der unbehandelten und Ethanol-exponierten Embryonen wurden nach 5 Tagen der Befruchtung gemessen. Eine signifikante Reduktion in der Länge wurde bei allen behandelten Embryonen gesehen (ANOVA, p <0,001). BD. Es gab eine geringe, aber signifikante Verringerung der Gesamtlänge von Embryonen mit 1,0% und 1,5% Ethanol behandelt, während eine größere Verringerung der Embryonen mit 2,0% und 2,5% Ethanol dosiert zu sehen war. E. Zur Größenunterschiede in jeder Kupplung zu steuern, wurden die Embryonen Steuerelement für jedes Experiment auf 100 normiert, und Geschwister-behandelten Embryonen als Prozentsatz von 100 ausgedrückt. (Modifiziert mit Erlaubnis von Loucks und Ahlgren 2009).

Abbildung 4
Abbildung 4. Ethanolexposition führt zu einer Verringerung des intraokularen Abstand (IOD) in Zebrafisch-Embryos. A) Frontalansichten von Embryonen zeigen normalen und fusionierten Auge Phänotypen. B) Unterschiedliche Dosierungen von Ethanol für 3 Stunden während der Gastrulation res verabreichtultate in IOD verringert, wenn der Fisch 24 Stunden später untersucht werden. Fused Augen und Zyklopie sind nur bei der höchsten getesteten Dosis (2,4%) gesehen. * Kennzeichnet eine signifikante Reduktion der IOD im Vergleich zur Kontrollgruppe. (Modifiziert mit Erlaubnis von Ahlgren, 2004).

Abbildung 5
Abbildung 5. Shh-N-mRNA-Injektion rettet die grobe Mängel, die durch Ethanol Exposition von Zebrabärbling produziert. Eins-zwei Embryonen wurden mit 100 pg / nl Shh-N-mRNA und die Hälfte der injizierten Embryonen wurden zu den Standard-Ethanol-Dosen von 4,3 bis 24 HPF ausgesetzt injiziert. Die Embryonen wurden bei 5 dpf analysiert. Embryonen mit 2,0% Ethanol behandelt aufweisen dorsal kürzere Schwänze, I-förmigen Somiten, und Augen-Defekte einschließlich Zyklopie gekrümmt. Rettung dieser Phänotypen ist in 71/76 der injizierten Embryonen (93%) gesehen. In diesen Embryonen, wird der Körper gerade, sind die Chevron-förmige Somiten, und die Augen sind vollständig getrennt.

Discussion

Die hier beschriebenen Methoden und die Ergebnisse gezeigt, zeigen nur die Spitze des Zebrafisch-how lassen sich Entwicklungsstörungen verhören werden. Aufgrund der Zugänglichkeit des Embryos, der hohen Anzahl von Eiern für jede Kupplung, und eine hohe Reproduzierbarkeit der Ergebnisse gelegt, sind diese ideal für Wirbeltiere Teratogenität durchgeführt. Fische können auch manipuliert werden, um fluoreszierende Moleküle enthalten, die als visuelle Reportergen für ein bestimmtes Gen oder ein Weg von Interesse 19 verwenden werden. In den Ethanol-Studien erscheinen die verwendeten Dosen recht hoch im Vergleich zu Säugetieren Blutalkoholspiegel. Jedoch, während die einzelnen Stufen das in dem Wasser, und nicht alle der Ethanol auf den Embryo geliefert.

Insgesamt deuten die beschriebenen Methoden und oben erläuterten, dass Zebrafischembryonen sehr nützlich bei der Modellierung menschlichen Missbildungen im Zusammenhang mit Ethanolexposition sind. Darüber hinaus haben die Veränderungen der Genexpression im Zebrafisch vor von anderen bestätigtin den Säugetier-Modellsystemen 20, was darauf hindeutet, dass die entwicklungspolitischen Effekte von Ethanol auf Wirbeltiere werden beibehalten. Viele der Techniken demonstriert oben kann mit anderen Umwelt-oder pharmazeutischen Beleidigungen verwendet werden, um schnell und einfach erkennen potenzielle Teratogene und bestimmen die zugrunde liegenden Mechanismen, die zur Teratogenität eines bestimmten Stoffes beitragen.

Disclosures

Wir haben nichts zu offenbaren.

Acknowledgments

Wir möchten Monte Westerfield, Makoto Kobayashi und Jacek Topczewski für die Gaben der Plasmide danken für in-situ-Hybridisierung und mRNA Mikroinjektion. Wir bedanken uns bei Steph Erhard für seinen Einsatz in dem Video. Wir möchten auch die Hilfe von William Goossens mit der konfokalen Mikroskopie in dem Video gezeigt anerkennen. Tyler Schwend bereitgestellten Bilder in dem Video verwendet wird, und Rodney Dale mit Vorbereitung auf das Video unterstützt. Wir erkennen auch die CMRC Tierpfleger für die Zucht Arbeit mit dem Zebrafisch. Diese Arbeit wurde vom NIH R21 AA13596 zu SCA finanziert.

Materials

Name Company Catalog Number Comments
Tissue RNA kit: 5-Prime PerfectPure Fisher Scientific FP2302410
Platinum SYBR green qPCR SuperMix-UDG Invitrogen 11733038
mMessage mMachine high yield capped RNA transcription kit Applied Biosystems Depends on the RNA polymerase in your plasmid

DOWNLOAD MATERIALS LIST

References

  1. Streissguth, A. P. Fetal alcohol syndrome in adolescents and adults. Jama. 265, (15), 1961-1967 (1991).
  2. Floyd, R. L. Observations from the CDC. Preventing alcohol-exposed pregnancies among women of childbearing age: the necessity of a preconceptional approach. J. Womens Health Gend. Based Med. 8, (6), 733-736 (1999).
  3. Ali, S. Large-scale analysis of acute ethanol exposure in zebrafish development: a critical time window and resilience. PLoS One. 6, (5), e20037-e20037 (2011).
  4. Dlugos, C. A., Rabin, R. A. Structural and functional effects of developmental exposure to ethanol on the zebrafish heart. Alcohol Clin. Exp. Res. 34, (6), 1013-1021 (2010).
  5. Fernandes, Y., Gerlai, R. Long-term behavioral changes in response to early developmental exposure to ethanol in zebrafish. Alcohol Clin. Exp. Res. 33, (4), 601-609 (2009).
  6. Bilotta, J. Effects of embryonic exposure to ethanol on zebrafish visual function. Neurotoxicol. Teratol. 24, (6), 759-766 (2002).
  7. Tanguay, R. L., Reimers, M. J. Analysis of ethanol developmental toxicity in zebrafish. Methods Mol. Biol. 447, 63-74 (2008).
  8. Blader, P., Strahle, U. Ethanol impairs migration of the prechordal plate in the zebrafish embryo. Dev. Biol. 201, (2), 185-201 (1998).
  9. Loucks, E., Carvan, M. J. 3rd, Strain-dependent effects of developmental ethanol exposure in zebrafish. Neurotoxicol. Teratol. 26, (6), 745-755 (2004).
  10. Ahlgren, S. C. Molecular Mechanisms of Fetal Alcohol Syndrome: Shh-signaling. Comprehensive Handbook of Alcohol Related Pathology. Preedy, V. (2004).
  11. Reimers, M. J., Flockton, A. R., Tanguay, R. L. Ethanol- and acetaldehyde-mediated developmental toxicity in zebrafish. Neurotoxicol. Teratol. 26, (6), 769-781 (2004).
  12. Pfaffl, M. W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29, (9), 45-45 (2001).
  13. Jowett, T. Tissue in situ hybridization: methods in animal development. John Wiley & Sons. New York. 128-128 (1997).
  14. Loucks, E. J., Ahlgren, S. C. Deciphering the role of Shh signaling in axial defects produced by ethanol exposure. Birth Defects Res. A. Clin. Mol. Teratol. 86, 556-567 (2009).
  15. Schwend, T. Requirement of Npc1 and availability of cholesterol for early embryonic cell movements in zebrafish. J. Lipid Res. 52, (7), 1328-1344 (2011).
  16. Spohr, H. L., Willms, J., Steinhausen, H. C. Fetal alcohol spectrum disorders in young adulthood. J. Pediatr. 150, (2), 175-179 (2007).
  17. Strauss, R. S. Effects of the intrauterine environment on childhood growth. Br. Med. Bull. 53, (1), 81-95 (1997).
  18. Loucks, E. J., Schwend, T., Ahlgren, S. C. Molecular changes associated with teratogen-induced cyclopia. Birth Defects Res. A. Clin. Mol. Teratol. 79, (9), 642-651 (2007).
  19. Schwend, T., Loucks, E. J., Ahlgren, S. C. Visualization of Gli activity in craniofacial tissues of hedgehog-pathway reporter transgenic zebrafish. PLoS One. 5, (9), 14396-14396 (2011).
  20. Chrisman, K. Gestational ethanol exposure disrupts the expression of FGF8 and Sonic hedgehog during limb patterning. Birth Defects Res. A. Clin. Mol. Teratol. 70, (4), 163-171 (2004).
Die Beurteilung Teratogene Änderungen in einem Zebrafisch-Modell der Fetal Alcohol Exposure
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Loucks, E., Ahlgren, S. Assessing Teratogenic Changes in a Zebrafish Model of Fetal Alcohol Exposure. J. Vis. Exp. (61), e3704, doi:10.3791/3704 (2012).More

Loucks, E., Ahlgren, S. Assessing Teratogenic Changes in a Zebrafish Model of Fetal Alcohol Exposure. J. Vis. Exp. (61), e3704, doi:10.3791/3704 (2012).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter