A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions

13.9K views

⸱

DOI:

10.3791/4072

⸱

December 15th, 2012

In This Article

Summary

The Green Monster method enables the rapid assembly of multiple deletions marked with a reporter gene encoding green fluorescent protein. This method is based on driving yeast strains through repeated cycles of sexual assortment of deletions and fluorescence-based enrichment of cells carrying more deletions.

Abstract

Phenotypes for a gene deletion are often revealed only when the mutation is tested in a particular genetic background or environmental condition1,2. There are examples where many genes need to be deleted to unmask hidden gene functions3,4. Despite the potential for important discoveries, genetic interactions involving three or more genes are largely unexplored. Exhaustive searches of multi-mutant interactions would be impractical due to the sheer number of possible combinations of deletions. However, studies of selected sets of genes, such as sets of paralogs with a greater a priori chance of sharing a common function, would be informative.

In the yeast Saccharomyces cerevisiae, gene knockout is accomplished by replacing a gene with a selectable marker via homologous recombination. Because the number of markers is limited, methods have been developed for removing and reusing the same marker5,6,7,8,9,10. However, sequentially engineering multiple mutations using these methods is time-consuming because the time required scales linearly with the number of deletions to be generated.

Here we describe the Green Monster method for routinely engineering multiple deletions in yeast11. In this method, a green fluorescent protein (GFP) reporter integrated into deletions is used to quantitatively label strains according to the number of deletions contained in each strain (Figure 1). Repeated rounds of assortment of GFP-marked deletions via yeast mating and meiosis coupled with flow-cytometric enrichment of strains carrying more of these deletions lead to the accumulation of deletions in strains (Figure 2). Performing multiple processes in parallel, with each process incorporating one or more deletions per round, reduces the time required for strain construction.

The first step is to prepare haploid single-mutants termed 'ProMonsters,' each of which carries a GFP reporter in a deleted locus and one of the 'toolkit' loci—either Green Monster GMToolkit-a or GMToolkit-α at the can1Δ locus (Figure 3). Using strains from the yeast deletion collection12, GFP-marked deletions can be conveniently generated by replacing the common KanMX4 cassette existing in these strains with a universal GFP-URA3 fragment. Each GMToolkit contains: either the a- or α-mating-type-specific haploid selection marker1 and exactly one of the two markers that, when both GMToolkits are present, collectively allow for selection of diploids.

The second step is to carry out the sexual cycling through which deletion loci can be combined within a single cell by the random assortment and/or meiotic recombination that accompanies each cycle of mating and sporulation.

Protocol

1. Generation of ProMonsters

  1. Prepare the universal GFP replacement cassette by amplifying a tetO2-GFP marker and the URA3 marker from the plasmid pYOGM012 (ampicillin resistance) using primers with sequences:
    GGATCCCCGGGTTAATTAAGGCGCGCCAGATCTGTTTAGCTTGCCCAAGCTCCTCGAGTAATTCG and GGCGTTAGTATCGAATCGACAGCAGTATAGCGACCAGCATTCACGTACCGGGTAATAACTGATATAAT (bolded regions provide homology to the flanking regions of the KanMX4 cassette allowing targeted replacement). The PCR reaction should be carried out with Phusion polymerase, HF buffer, and 3% dimethyl sulfoxide (New England BioLabs) st....

Access restricted. Please log in or start a trial to view this content.

Results

When an a-haploid strain carrying four GFP-marked deletions (ycl033cΔ yer042wΔ ykl069wΔ yol118cΔ) was crossed with an α-haploid strain carrying four deletions (ycl033cΔ ydl242wΔ ydl227cΔ yer042wΔ), with two deletions (ycl033cΔ yer042wΔ) shared by two strains, a representative result was obtained. The mating mixture was cultured in YPDA medium containing G418 and Nat to select diploids. The resulting diploids were cultured in the sporulation medium. The spores were dispersed by .......

Access restricted. Please log in or start a trial to view this content.

Discussion

As we developed the Green Monster approach, we were concerned with the possibility of recombination between different GFP replacement cassettes, leading to genome rearrangement. Mitigating against this possibility is our selection for cells that have successfully undergone multiple rounds of mating and meiosis. Cells bearing rearranged genomes are expected to be less fit after mating to cells without an identical rearrangement. Indeed, we did not observe any genome instability resulting from recombination betwe.......

Access restricted. Please log in or start a trial to view this content.

Disclosures

No conflicts of interest declared.

Acknowledgements

This work was supported by the US Defense Advanced Research Projects Agency contract N66001-12-C-4039 to Y.S., a grant from the Alfred P. Sloan Foundation to R.S.L., and US National Institutes of Health grants R01 HG003224 and R21 CA130266 to F.P.R. F.P.R. was also supported by a fellowship from the Canadian Institute for Advanced Research and by the Canada Excellence Research Chairs program.

....

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
G418Sigma-AldrichA1720Dissolve in water and filter-sterilize (0.2-μm filter). Stock concentration: 200 mg/ml. Store at 4 °C.
ClonNAT (nourseothricin)WERNER BioAgents5001000Dissolve in water and filter-sterilize (0.2-μm filter). Stock concentration: 100 mg/ml. Store at 4 °C.
DoxycyclineSigma-AldrichD9891Dissolve in 50% ethanol and filter-sterilize (0.2-μm filter). Stock concentration: 10 mg/ml. Make fresh every four weeks. Shield from light using aluminum foil and store at 4 °C.
ZymolyaseZymoResearchE1005
Difco yeast nitrogen base w/o amino acidsBD291940
Revolver (rotator for tubes)LabnetH5600
Enduro Gel XL electrophoresis unitLabnetE0160
Sonifier 450 Branson101-063-198
Microtip for Sonifier 450Branson101-148-062
FACSAria cell sorterBD
MoFlo cell sorterBeckman-Coulter
Biomek FX or equivalent robot Beckman CoulterOptional. For setting up genotyping PCRs.

References

  1. Tong, A. H., et al. Systematic genetic analysis with ordered arrays of yeast deletion mutants. Science's STKE. 294, 2364-23 (2001).
  2. Hillenmeyer, M. E., et al. The chemical genomic portrait of yeast: uncovering a phenotype for all genes. Scie....

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Green Monster MethodYeast Strain EngineeringGene DeletionFlow CytometryYeast MatingMeiotic RecombinationGFP ReporterHaploid SelectionDiploid SelectionStrain Construction