We constructed destination plasmids compatible with the Golden GateTALEN assembly published by Cermak et al.13 that allow expression of TALENs in mammalian cells as well as in vitro mRNA synthesis from the T7 phage promoter (Figure 1C). These plasmids carry heterodimeric FokI domains (ELD or KKR mutations) that have been shown to reduce off-target effects relative to FokI homodimers and to enhance cleavage activity as compared to first generation FokI heterodimers25,29. Golden gate assembly reactions #1 and #2 are usually very efficient and every white colony, when analyzed by colony PCR, shows the expected pattern for the particular number of RVDs cloned (Figures 1B and 1D).
Gel analysis of in vitro synthesized mRNA (Figure 2) should reveal a single distinguishable band with little or no smear for every sample analyzed. There should be a clear size shift between samples L1/R1 and L2/R2, L3/R3, which indicates successful polyadenylation.
Founder animals can be screened for NHEJ-induced mutated alleles using genotyping PCR followed by either T7 endonuclease digestion (Figure 3) or a restriction digest using an enzyme that cleaves the wild type sequence within the spacer region of the nuclease pair (Figure 4). The T7 endonuclease assay is applicable to any kind of mutation irrespective of the specific genomic sequence within the spacer region of the nuclease pair injected; however, it detects only mismatches between DNA strands in heteroduplex PCR products. Thus, in the rare event that a founder carries two identically mutated alleles, PCR products would not show any T7 digestion pattern. Such distinction is, however, always possible when a specific restriction site is located within the nuclease spacer region that will be eliminated by NHEJ-induced insertions/deletions (Figure 5). Here, undigested bands indicate the presence of mutations, and the absence of any digested products strongly suggests a founder carrying mutations in both alleles of the targeted gene (marked with asterisks in Figure 4b).

Figure 1. Golden Gate cloning of TALEN RVDs into heterodimeric pCAG-T7-Destination vectors. A) Assembly of RVD arrays into pFUS vectors. Here an example is shown for a TALEN pair with individual TALE arrays comprising 15 RVDs and 17 RVDs, respectively (for TALE arrays longer than 21 RVDs, three pFUS-RVDs assemblies are required, not shown). Arrows indicate primers for pFUS-specific colony PCR reactions. B) PCR products amplified from correct pFUS assemblies typically show a band corresponding to the combined length of all RVDs cloned (e.g. around 1.1 kb for 10 RVDs) and a "ladder" of smaller less prominent bands due to the repetitive nature of RVD arrays. C) Final assembly of pFUS-RVD arrays and a plasmid containing the last repeat (pLR) into heterodimeric TALEN expression vectors with FokIELD and FokIKKR variants, respectively. The TALEN backbone (annotated as N and C) resembles the architecture published by Miller et al.23 The CAG (CMV early enhancer element/ chicken beta-actin) promoter ensures high expression levels in transfected mammalian cells, while the T7 phage promoter allows in vitro mRNA synthesis (use SacI for linearization of the vector downstream of the nuclease STOP codon). D) Colony PCR using primers indicated by arrows in C) allows identification of correctly assembled TALENs. Full-length PCR products are often less prominent while the "ladder effect" represents a robust indicator of successful assembly. Click here to view larger image.

Figure 2. Quality control of nuclease mRNA in vitro synthesis using agarose gel electrophoresis. ZFN mRNAs are shown as an example (L, left ZFN; R, right ZFN). Samples L1/R1 show mRNA prior to polyadenylation, samples L2/R2 show polyadenylated mRNA and L3/R3 show purified polyadenylated mRNA. Click here to view larger image.

Figure 3. Example of a T7 endonuclease assay used for identification of founder animals carrying nuclease-induced mutations of the target locus. A) A TALEN pair was designed to cleave within the coding region of the mouse prion protein gene (Prnp, TALEN target sequence can be provided upon request). A PCR product is generated using a forward primer (F) located 110 bp upstream and a reverse primer (R) 250 bp downstream of the TALEN cleavage site. B) The PCR product is subsequently subjected to heteroduplex formation and T7 endonuclease digestion. C) TALEN-induced mutagenesis within the targeted genomic region of single founders is revealed by the presence of a full-length PCR product with digestion products of 250 and 110 bps. Click here to view larger image.

Figure 4. Example of a restriction digest of PCR products used for identification of founder animals carrying nuclease-induced mutations of the target locus. ZFN specific for the mouse Rosa26 locus29 target a XbaI restriction site within intron 1. A) Founders were screened by genotyping PCR using a forward primer (F) located 500 bp upstream and a reverse primer (R) 250 bp downstream of the cleavage site. B) Digestion of PCR products with XbaI reveals digestion patterns indicating mice with bi-allelic mutations (marked with asterisks), mono-allelic mutations (digested and undigested bands, e.g. animal 2) and wt mice (complete digestion, e.g. animal 21). C) Sequencing of mice with potential bi-allelic modifications shows up to 3 (animal 24) distinct insertions/deletions. Click here to view larger image.
| Name of Primer | Sequence 5’ to 3’ |
| pCR8_F1 | ttgatgcctggcagttccct |
| pCR8_R1 | cgaaccgaacaggcttatgt |
| TAL_F1 | ttggcgtcggcaaacagtgg |
| TAL_R2 | ggcgacgaggtggtcgttgg |
| TAL_Seq_5-1 | catcgcgcaatgcactgac |
Table 1. Sequences of primers used for colony PCRs and sequencing within the Golden Gate TALEN assembly protocol.
| Plasmid/Collection | Contributor | Addgene ID | Comments |
| Golden Gate TALEN and TAL Effector Kit 2.0 | Voytas lab | 1000000024 | Contains all plasmids necessary for Golden Gate TALEN assembly |
| pCAG-T7-TALEN -KKR/ELD destination vectors | Pelczar lab | 40131, 40132 | Add-on plasmids for TALEN expression in mammalian cells and in vitro mRNA synthesis |
Table 2. Plasmids and plasmid collections required for Golden Gate TALEN assembly can be obtained from Addgene (www.addgene.org).
| Online Resource | Comments |
| http://tale-nt.cac.cornell.edu | Design of TALEN; TALEN off-target prediction |
| http://zifit.partners.org/ZiFiT/ | Design of TALEN, OPEN ZFN, CoDA ZFN, CRISPR/Cas9 |
| http://www.genome-engineering.org | Design of TALEN, CRISPR/Cas9; CRISPR/Cas9 off-target prediction |
| http://baolab.bme.gatech.edu/Research/BioinformaticTools/assembleTALSequences.html | Assembly of TALEN sequences for confirmation of sequencing results |
| http://pgfe.umassmed.edu/ZFPmo dularsearchV2.html | Design of modular assembly ZFN |
| www.genomecenter.ucdavis.edu/s egallab/segallabsoftware | Design of modular assembly ZFN |
Table 3. Online resources for designing ZFN, TALEN, and CRISPR/Cas9.