Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo

Summary

Here, real-time monitoring of tumor cell metabolism, combined with an in vivo chicken embryo chorio-allantoic membrane (CAM) model of metastasis, are used to evaluate novel anti-cancer targets/agents for their ability to sensitize tumor cells to DNA damaging chemotherapeutics.

Abstract

Due to the high level of heterogeneity and mutations inherent in human cancers, single agent therapies, or combination regimens which target the same pathway, are likely to fail. Emphasis must be placed upon the inhibition of pathways that are responsible for intrinsic and/or adaptive resistance to therapy. An active field of investigation is the development and testing of DNA repair inhibitors that promote the action of, and prevent resistance to, commonly used chemotherapy and radiotherapy. We used a novel protocol to evaluate the effectiveness of BRCA2 inhibition as a means to sensitize tumor cells to the DNA damaging drug cisplatin. Tumor cell metabolism (acidification and respiration) was monitored in real-time for a period of 72 hr to delineate treatment effectiveness on a minute by minute basis. In combination, we performed an assessment of metastatic frequency using a chicken embryo chorioallantoic membrane (CAM) model of extravasation and invasion. This protocol addresses some of the weaknesses of commonly used in vitro and in vivo methods to evaluate novel cancer therapy regimens. It can be used in addition to common methods such as cell proliferation assays, cell death assays, and in vivo murine xenograft studies, to more closely discriminate amongst candidate targets and agents, and select only the most promising candidates for further development.

Introduction

Acquired resistance to targeted and/or cytotoxic cancer treatment is an important clinical problem that can lead to treatment failure, relapse, and increased patient mortality¹. Given the high level of heterogeneity in most tumors, it is a mathematical certainty that a tumor of sufficiently high cell number will contain a subset of cells resistant to single or combined therapies targeting molecular pathways on which those cells depend for survival^2,3. Such tumor cells can be positively selected for during treatment, leading to disease recurrence. Development of novel therapies that simultaneously target different cancer cell survival mechanisms, ....

Protocol

NOTE: The following protocol was designed for use with adherent cells. Modifications are required to apply the method to non-adherent cells grown in suspension. The CAM experiments described in the protocol are designed for use with cells that express a fluorescent marker (e.g., GFP, RFP, etc.). Nine day old chicken embryos are required on day 2 of the experimental protocol for the CAM experiments.

1. Preparation and Transfection of Tumor Cells with Antisense Oligonucleotides (ASOs)

1. Aspirate medium from T75 flask(s) containing cells of interest, wash with 1XPBS, and add 2 ml of 0.25% trypsin/EDTA. Add 10 ml of ....

Results

Results and figures adapted with permission from published work²².

BRCA2 inhibition induces a decrease in respiration in cisplatin treated tumor cells

Human A549 lung cancer cells treated with BRCA2-targeting ASO and cisplatin exhibited an early and irreversible decrease in respiration, compared to cells which received control ASO and cisplatin alone; after 24 hr of cisplatin treatment the difference in respiration between BRCA2 ASO and control A.......

Discussion

Due to the inherent cost and risk associated with clinical trials, there is a need to develop better and more rigorous pre-clinical testing methodology to adequately evaluate novel anti-cancer treatment regimens. Current commonly-used techniques all exhibit weaknesses that may limit their capacity to discriminate between potentially promising therapeutic targets/agents, and those that may be less effective. We devised a protocol to evaluate new anti-cancer approaches that addresses many of the shortcomings of traditional.......

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
A549 cells	ATCC	CCL-185	http://www.atcc.org/products/all/CCL-185.aspx
AeraSeal film	Carl Roth GmbH
AMEM	Wisent Bioproducts	210-011-QK
Antisense oligodeoxynucleotides	Avecia		BRCA2 target sequence: 5' - UAAGGAACGUCAAGAGAUAC - 3' (bases 7241-7259 )
Axio Zoom V16 Microscope	Carl Zeiss		http://www.zeiss.ca/microscopy/en_ca/products/stereo-zoom-microscopes/axio-zoom-v16.html
Bionas Biosensor Chips	Bionas GmbH and Micronas GmbH	BIS8001D
Bionas Discovery 2500 System	Bionas GmbH		http://www.bionas-discovery.com/prodservices/instruments/system2500/
Cisplatin	Sigma Aldrich	479306
Fertilized chicken eggs	Sourced locally
Fetal bovine serum	Gibco - Life Technologies
Lipofectamine 2000	Invitrogen - Life Technologies	12566014	http://www.lifetechnologies.com/ca/en/home/life-science/protein-expression-and-analysis/transfection-selection/lipofectamine-2000.html
PBS	Wisent Bioproducts	311-010-CL
Trypsin (0.25%)/EDTA	Wisent Bioproducts	325-043-CL