Synthesis and Characterization of an Aspirin-fumarate Prodrug that Inhibits NFκB Activity and Breast Cancer Stem Cells

Summary

This procedure will demonstrate how we synthesized and characterized the anti-NFκB and anti-cancer stem cell activity of an aspirin-fumarate prodrug.

Abstract

Inflammation is a cancer hallmark that underlies cancer incidence and promotion, and eventually progression to metastasis. Therefore, adding an anti-inflammatory drug to standard cancer regiments may improve patient outcome. One such drug, aspirin (acetylsalicylic acid, ASA), has been explored for cancer chemoprevention and anti-tumor activity. Besides inhibiting the cyclooxygenase 2-prostaglandin axis, ASA's anti-cancer activities have also been attributed to nuclear factor ĸB (NFĸB) inhibition. Because prolonged ASA use may cause gastrointestinal toxicity, a prodrug strategy has been implemented successfully. In this prodrug design the carboxylic acid of ASA is masked and additional pharmacophores are incorporated.

This protocol describes how we synthesized an aspirin-fumarate prodrug, GTCpFE, and characterized its inhibition of the NFĸB pathway in breast cancer cells and attenuation of the cancer stem-like properties, an important NFĸB-dependent phenotype. GTCpFE effectively inhibits the NFĸB pathway in breast cancer cell lines whereas ASA lacks any inhibitory activity, indicating that adding fumarate to ASA structure significantly contributes to its activity. In addition, GTCpFE shows significant anti-cancer stem cell activity by blocking mammosphere formation and attenuating the cancer stem cell associated CD44⁺CD24^- immunophenotype. These results establish a viable strategy to develop improved anti-inflammatory drugs for chemoprevention and cancer therapy.

Introduction

Inflammation is a hallmark that underlies multiple aspects of tumorigenesis, such as incidence and promotion, and eventually progression to metastasis¹. In breast cancer, this is further supported by epidemiological observations showing that regular use of the classical non-steroidal anti-inflammatory drug aspirin (acetyl salicylic acid, ASA) is associated with a reduction in both breast cancer incidence, and risk of metastasis and recurrence^2,3. ASA acts primarily by inhibiting cyclooxygenase-2 activity, which is often upregulated in breast cancer^4,5. However, the anti-cancer effects of ASA may also be mediated by suppressing aberrant....

Protocol

1. Synthesis of Aspirin-fumarate Prodrug GTCpFE

1. Using a plastic plunger syringe, measure 0.81 ml (20 mmol) of methanol and mix it in water (10 ml) in a round bottom flask. Cool the resulting mixture to 0 °C by placing the flask in an ice-water bath. Add 4-hydroxybenzyl alcohol (2.48 mg, 20 mmol) and stir the reaction mixture until the solution is clear.
2. Prepare a solution of O-acetylsalicyloyl chloride (3.77 mg, 19 mmol) in anhydrous toluene (10 ml) by weighing the desired amount of O-acetylsalicyloyl chloride and dissolving it in the solvent in a separate flask. Using a plastic plunger syringe, add this solution to the mix....

Results

In Figure 1, the chemical structure of aspirin-fumarate prodrug, GTCpFE, and its inhibitory activity on cytokine induced NFĸB pathway in breast cancer cells are indicated. GTCpFE inhibits both NFĸB endpoints, NFĸB-RE luciferase activity (Figure 1B) and expression of NFĸB target genes, such as Intercellular Adhesion Molecule 1 (ICAM1), Chemokine C-C Motif Ligand 2 (CCL2), and Tumor Necrosis Factor (TNF) (Figure 1C) in MCF-7 breast cancer c.......

Discussion

In this protocol, we demonstrated the synthesis of an ASA prodrug, GTCpFE, where the fumarate pharmacophore was incorporated to improve the anti-NFĸB activity in breast cancer cells. GTCpFE is an effective NFĸB inhibitor, whereas ASA itself is not, even at much higher concentrations. The fumarate moiety has anti-inflammatory properties as shown by its ability to inhibit NFĸB signaling in a variety of cell lines and tissues^14,25-29. The prodrug strategy described herein, is amendable to other mal.......

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
RPMI 1640 Red Medium	Life Technologies	11875-093	Warm up to 37 °C before use
IMEM	Corning	10-024-CV	Warm up to 37 °C before use
DMEM / F12 Medium	ThermoFisher	21041-025	Warm up to 37 °C before use
MEM NEAA 10 mM 100x	Life Technologies	11140
Penicillin Streptomycin	Life Technologies	15140-122
L-Glutamine 100x	Life Technologies	25030-081
Insulin	Sigma-Aldrich	I-1882
Fetal Bovine Serum	Atlanta Biologicals	S11150
Trypsin 2.5% 10x	Invitrogen	15090046
Methyl Cellulose	Sigma	M0262
B27 Supplement 50x	Gibco	17504-044
EGF	Gibco	PHG0311L
NFκB-RE Luciferase Construct	Clontech	pGL4.32
Renilla Luciferase Construct	Promega	pGL4.70
Lipofectamine 2000	ThermoFisher	11668-019
Dual-Luciferase Reporter Assay	Promega	120000032
NanoDrop Spectrophotometer	ThermoFisher
Eppendorf Mastercycler	Eppendorf
StepOne Real Time PCR System	Thermo Scientific
Eclipse Microscope	Nikon
CyAn ADP Analyzer	Beckman Coulter
QCapture Software	QImaging
Summit Software	Beckman Coulter
GraphPad Software	Prism
TRIzol	ThermoFisher	15596-018
M-MLV Reverse Transcriptase	Invitrogen	28025-013
100 mM dNTP Set	Invitrogen	10297-018
Random Hexamers	Invitrogen	48190-011
Fast SYBR Green Master Mix	ThermoFisher	4385612
Costar 96W, ultra low attachment	Corning	3474
HBSS, 1x	ThermoFisher	14025134
CD44-APC conjugated antibody	BD Pharmingen	560990	Store at 4 °C, protect from light
CD24-PE antibody	BD Pharmingen	560991	Store at 4 °C, protect from light
Recombinant Human TNFα	Fisher	210TA100
CCL2 Primer Forward Sequence			AGAATCACCAGCAGCAAGTGTCC
CCL2 Primer Reverse Sequence			TCCTGAACCCACTTCTGCTTGG
ICAM1 Primer Reverse Sequence			TGACGAAGCCAGAGGTCTCAG
ICAM1 Primer Forward Sequence			AGCGTCACCTTGGCTCTAGG
TNF Primer Forward Sequence			AAGGGTGACCGACTCAGCG
TNF Primer Reverse Sequence			ATCCCAAAGTAGACCTGCCCA
36B4 Primer Forward Sequence			GTGTTCGACAATGGCAGCAT
36B4 Primer Reverse Sequence			GACACCCTCCAGGAAGCGA
Sodium Hydroxide	Sigma-Aldrich	S5881-500G
4-Hydroxybenzyl Alcohol	Sigma-Aldrich	20806-10G
O-Acetylsalicyloyl Chloride	Sigma-Aldrich	165190-5G
Phosphorous Pentoxide	Sigma-Aldrich	79610-100G
Ethyl Fumaroyl Chloride	Sigma-Aldrich	669695-1G
Sodium Sulfate	Sigma-Aldrich	246980-500G
4-Dimethylaminopyridine	Sigma-Aldrich	714844-100ML	0.5 M in tetrahydrofuran
Triethylamine	Sigma-Aldrich	T0886-100ML
Toluene	Sigma-Aldrich	244511-100ML
Ethyl Acetate	Sigma-Aldrich	270989-100ML
Tetrahydrofuran	Sigma-Aldrich	401757-2L
400 MHz FT NMR spectrometer			See Bruker’s Avance User’s Manual, version 000822 for details