Method Article

Gene Editing of Primary Rhesus Macaque B Cells

DOI:

10.3791/64858

February 10th, 2023

In This Article

Summary

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

We present a method for culturing and gene editing primary rhesus macaque B cells using CRISPR/Cas9 and recombinant adeno-associated virus serotype 6 for the study of B cell therapies.

Abstract

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

B cells and their progeny are the sources of highly expressed antibodies. Their high protein expression capabilities together with their abundance, easy accessibility via peripheral blood, and amenability to simple adoptive transfers have made them an attractive target for gene editing approaches to express recombinant antibodies or other therapeutic proteins. The gene editing of mouse and human primary B cells is efficient, and mouse models for in vivo studies have shown promise, but feasibility and scalability for larger animal models have so far not been demonstrated. We, therefore, developed a protocol to edit rhesus macaque primary B cells in vitro to enable such studies. We report conditions for in vitro culture and gene-editing of primary rhesus macaque B cells from peripheral blood mononuclear cells or splenocytes using CRISPR/Cas9. To achieve the targeted integration of large (<4.5 kb) cassettes, a fast and efficient protocol was included for preparing recombinant adeno-associated virus serotype 6 as a homology-directed repair template using a tetracycline-enabled self-silencing adenoviral helper vector. These protocols enable the study of prospective B cell therapeutics in rhesus macaques.

Introduction

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

B cells are the foundation of humoral immunity. Upon activation by cognate antigen and secondary signals, naïve B cells give rise to germinal center B cells, memory B cells, and plasma cells1. The latter is the source of the secreted antibodies that mediate the protective functions of most currently available vaccines2. Plasma cells have been described as antibody factories as they secrete vast amounts of antibodies into the serum-about 2 ng/day/cell3, amounting to 7-16 g/L serum, making antibodies one of the three most abundant proteins in serum4. B cells are abundant in blood and can, thus, be easily obtained and infused back into an individual.

These traits have made B cells a target of cell therapy efforts to gene-edit the B cell receptor (BCR) and express broadly neutralizing antibodies (bNAbs) to the human immunodeficiency virus (HIV)5,6,7,8,9,10,11,12,13,14,15 and other proteins16,17,18,19,20,21. Such approaches have shown potential in numerous mouse studies in vivo7,8,10,11,16,22. However, several hurdles still must be overcome for clinical translation9,15,23, among them safety, duration, and magnitude of the therapeutic efficacy, as well as scaling to larger animals such as non-human primates (NHPs). Indeed, NHPs, and in particular rhesus macaques, which have a long history in antibody and HIV research24,25, are the most suitable model to test these parameters.

Here, we developed protocols that enable these issues to be addressed. To date, few studies have attempted to culture rhesus macaque B cells ex vivo, and only positive selection using CD20 has been reported for the purification of rhesus macaque B cells26,27,28. We have established a protocol for the isolation of untouched rhesus macaque B cells by the negative depletion of other cell types. Furthermore, culturing conditions are defined for the targeted gene editing of rhesus macaque B cells. This protocol outlines the use of CRISPR/Cas9 ribonucleoproteins (RNPs) and recombinant adeno-associated virus serotype 6 (rAAV6) as homology-directed repair template (HDRT) to gene edit cultured rhesus macaque B cells. Using this protocol, editing efficiencies up to 40% with large (~1.5 kb) inserts were achieved. We also present a fast and cost-effective method to produce rAAV6 using a tetracycline-enabled, self-silencing adenoviral helper29 to enable the fast testing of HDRTs in this format. Combined, these protocols describe an efficient workflow for the gene editing of rhesus macaque B cells (Figure 1), enabling the evaluation of B cell therapies in an NHP model.

To start the experiments, donor material can be ordered from commercial sources or obtained by phlebotomies or splenectomy. In this study, the phlebotomies and blood collections were performed as previously described30 using the anticoagulant EDTA. To obtain splenic, primary rhesus macaque B cells, partial (25%-50%) or total splenectomies were performed using techniques reported earlier31. The animals were fasted overnight before the surgery. Briefly, during the surgery, the abdomen was clipped and prepared with alternating scrubs of chlorhexidine and 70% isopropyl alcohol three times. An incision (5-10 cm) was made in the abdomen to identify and isolate the spleen. The vasculature of the spleen was ligated with either sutures or vascular clamps. The incision was closed in two layers with 4-0 PDS polydioxanone sutures. Splenectomy was performed a single time for an individual animal. Single-cell suspensions were prepared from macaque spleens by maceration through cell strainers. Mononuclear cells from blood and splenic cell suspensions were prepared using density gradient centrifugation and stored in liquid nitrogen.

Protocol

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

All animal procedures and experiments were performed according to protocols approved by the Institutional Animal Care and Use Committee of the National Institute of Allergy and Infectious Diseases, National Institutes of Health. A summary of the following protocols is presented in Figure 1. Male and female rhesus macaques (Macaca mulatta) of Indian genetic origin aged 2-8 years old were housed and cared for in accordance with the guidelines of the Committee on the Care and Use of Laboratory Animals in a biosafety level 2 facility.

CAUTION: All experiments were performed in compliance with the universal precautions for bloodborne pathogens, with sterile/aseptic techniques and proper biosafety level 2 equipment in laminar flow hoods.

1. rAAV6 production

  1. Prepare the reagents for rAAV6 production.
    1. Design and clone the homology-directed repair template in between the inverted terminal repeats (ITRs) of AAV2 in the vector pAAV using standard techniques. Ensure the homology arms are of at least ~250 bp on either side, but as little as 60 bp may suffice, although longer homology arms are preferred if the construct design allows for it. If target sequences of any of the used sgRNAs are present in the HDRT, remove them using silent mutations, which are most effective in the protospacer adjacent motif or seed region of the target site.
      NOTE: Gene synthesis combined with Gibson assembly for efficient cloning32 can be performed. Prepare a Maxiprep of a correct clone for transfection. For sgRNA design, CHOPCHOP33 is recommended, and a list of more tools can be found at https://zlab.bio/guide-design-resources. The maximum packaging capacity for AAV including ITRs is ~4.7 kb. AAV6 is the most commonly used serotype for editing hematopoietic cells, particularly B cells9. Other serotypes of AAV for the gene editing of rhesus macaque B cells have not been tested, but AAV28 and AAV-DJ10,11 have been used in mouse studies.
    2. Prepare 293AAV culture medium and production medium according to Table 1 and Table 2. Sterile-filter through a 0.2 µm polyethersulfone (PES) membrane filter unit. Store at 4 °C.
    3. Prepare 1x polyethylenimine (PEI) solution (1 mg/mL, 100 mL).
    4. In a 250 mL glass beaker, heat ~ 70 mL of H2O in a microwave for ~30 s, and then add 100 mg of PEI. Add a magnetic stirrer, and stir until the PEI is mostly dissolved.
    5. Adjust the pH to 7 with 1 M HCl, then top up to 100 mL with H2O, wait 10 min, check the pH again, and adjust if necessary.
    6. Sterile-filter the PEI solution through a 0.2 µm PES membrane filter unit, aliquot, and store −20 °C. After thawing, the solution can be stored at 4 °C for up to 2 months.
    7. Prepare 5x polyethylene glycol (PEG)/NaCl solution.
    8. Weigh out 400 g of PEG 8,000 and 24 g of NaCl.
    9. Add a magnetic stirrer to a 2 L glass beaker, add the weighed out PEG 8,000 and NaCl, and rinse with ~ 550 mL of deionized water.
    10. Stir with heating, and bring to a boil or 80-90 °C until fully dissolved.
    11. Adjust the pH to ~7.4 with 1 M NaOH, then adjust the volume to 1 L using a measuring cylinder, and transfer it into a 2 L glass bottle with the magnetic stirrer.
    12. Autoclave the bottle, magnetic stirrer, and solution in a water bath for 30 min at 121 °C.
    13. After autoclaving, cool the solution in a cold room while stirring using the magnetic stirrer to prevent separation into different phases. Aliquot if necessary, and store at 4 °C.
    14. Prepare the formulation buffer.
    15. Mix 500 mL of DPBS with 50 µL of 10% Pluronic F-68. Sterile-filter through a 0.2 µm PES membrane filter unit, and store at room temperature (RT).
  2. Cell culture, transfection, and transduction for rAAV6 production
    1. Thaw, culture, and freeze 293AAV cells as described by the manufacturer using the above 293AAV culture medium and Trypsin-EDTA for splitting. It is recommended to freeze some early passages and use the cells for AAV production before they reach passage 40.
    2. For rAAV6 production, seed four 15 cm cell culture dishes with 5 x 106 cells in 30 mL each. The cells are ready for transfection usually 1-2 days after seeding when they reach 80%-90% confluence.
    3. Thaw a Maxiprep of pAAV plasmid containing the HDRT to be packaged into AAV6. Resuspend 85.6 µg of the pAAV plasmid in 3 mL of pure DMEM medium.
    4. Dissolve 342 µL of 1 mg/mL PEI solution in 3 mL of pure DMEM medium. Incubate both solutions for 10 min at RT.
    5. Mix both 3 mL tubes into one tube of ~6.4 mL of transfection mix, and incubate for 20 min at RT.
    6. Meanwhile, thaw the tetracycline-enabled, self-silencing helper vector RepCap6 from the −80 °C freezer in a 37 °C water bath. To transduce the 293AAV cells, add the helper vector at a multiplicity of infection (MOI) of 25 using the median tissue culture infectious dose (TCID50) and assuming 1.15 x 107 cells/dish; typically, 2-10 µL is used per 15 cm dish. Rock and swirl the dishes gently to distribute.
    7. After the incubation of the transfection mix, add 1.6 mL of it dropwise across each of the four 15 cm dishes. Incubate at 37 °C and 5% CO2 overnight.
      NOTE: Alternatively, if the rAAV6 vectors of interest are already available, these vectors can be used to provide the viral genome to be packaged, which negates the need for any plasmids with this system and yields comparable rAAV6 titers. For this approach, the 293AAV cells are co-transduced with the desired rAAV6 at an MOI of 50 (based on rAAV6 genome copies [GC]/mL) along with the helper vector.
    8. The next day, carefully aspirate and discard the culture medium, and replace with 30 mL of prewarmed production medium. Incubate for another 96 h before harvesting. No further medium change is recommended to maximize the yields.
  3. Harvest and purification of the recombinant AAV6 from the medium
    1. Without dislodging cells from the dish, collect all the cell supernatant into a filter unit with a 0.2 µm PES membrane at least 50% bigger than the volume of medium to be filtered. Then, filter the supernatant.
      NOTE: If higher yields of rAAV6 are desired, the cells can be harvested and the rAAV extracted from the cell pellet using commercial kits or established protocols34,35. Since AAV6 is mostly secreted into the medium36, only supernatant was used, reducing labor, cost, and time.
    2. Add 5x PEG/NaCl solution to the filtered supernatant at 25% of the collected volume; this is typically 30 mL if four 15 cm dishes of 30 mL are used.
    3. Mix well by inverting, and then incubate overnight at 4 °C to precipitate the viral particles.
      NOTE: AAV particles are stable for up to 2 days in this solution.
    4. Precool a swing bucket centrifuge with 250 mL of tube inserts to 4 °C. Prepare a 4 mL centrifugal filter unit with a 100 kDa cutoff and a 0.22 µm hydrophilic PES syringe filter by pretreating each membrane with 2 mL of 10% Pluronic F-68 for at least 1 h at RT.
    5. Transfer the AAV-PEG/NaCl mixture into a 250 mL tube, centrifuge at 2,500 x g for 1 h at 4 °C, and then carefully remove the entire supernatant by aspiration.
    6. Resuspend the beige to white viral pellet by vortexing in 4 mL of 1 M HEPES until fully resuspended. If necessary, let it stand for 5 min, and vortex again. Resuspend using a 5 mL serological pipette, and transfer the total volume into a 15 mL tube.
    7. In a fume hood, add an equal volume of chloroform to the virus suspension-typically 4 mL.
    8. Vigorously vortex for 2 min, and then centrifuge at 1,000 x g for 5 min at RT.
    9. Collect the top layer (AAV-containing supernatant) in a new 50 mL tube, and discard the bottom layer (chloroform).
      CAUTION: Chloroform-containing solutions are hazardous waste. Follow institutional guidelines for its disposal.
    10. Place the AAV-containing supernatant under a fume hood, and let the remaining chloroform evaporate for 30 min.
    11. Meanwhile, wash the pretreated centrifugal filter unit and syringe filter.
    12. Add 1.5 mL of formulation buffer to the pretreated centrifugal filter unit. Centrifuge at 3,500 x g for 10 min at 15 °C in a swinging bucket rotor. Repeat this step with 4 mL of formulation buffer to wash the membrane.
    13. Rinse the syringe filter twice with 5 mL of formulation buffer using a 5 mL syringe.
    14. Load the ~4 mL of AAV-containing supernatant from the chloroform extraction into a 5 mL syringe, attach the washed syringe filter, and filter directly into the centrifugal filter unit.
    15. Centrifuge at 3,500 x g for 25 min at 15 °C, and then confirm that the AAV solution in the filter is around between 50-100 µL. If the volume of the solution is >100 µL, continue to centrifuge.
    16. After removing the filtrate, add 4 mL of formulation buffer inside the cup of the centrifugal filter unit, and mix the solution uniformly by pipetting. Centrifuge at 3,500 x g for 25 min at 15 °C, and then confirm that the AAV solution in the filter is between 50-100 µL. If the volume of the solution is >100 µL, continue to centrifuge. Repeat this step for another wash.
    17. After the final centrifugation, confirm the volume of the solution is 50-70 µL; if not, continue to centrifuge. Transfer the preparation to a 1.5 mL tube. Aliquot if desired, and store at −80 °C.
  4. Recombinant AAV6 titer determination by qPCR
    NOTE: The qPCR primers anneal in the ITR region and should, thus, be suitable for all constructs cloned into pAAV.
    1. Thaw an aliquot of the rAAV6 to be titered and an aliquot of the AAV6 reference material. The AAV6 reference material should be close to 4 x 1011 GC/mL; otherwise, adjust the dilutions accordingly.
    2. Perform a DNase I digest to remove any remaining free plasmid DNA in the rAAV6 preparation by combining 2.0 µL of the sample or AAV6 reference material with 15.6 µL of nuclease-free H2O, 2.0 µL of 10x DNase I buffer, and 0.4 µL of DNase I.
    3. Gently mix and incubate for 30 min at 37 °C, and then transfer to ice. This is dilution 1 (see Table 3).
    4. Prepare fivefold serial dilutions of all the samples and the AAV6 reference material as in Table 3 below with water.
    5. Prepare a SYBR Green qPCR master mix. Per well, mix 4.7 µL of nuclease-free water with 10 µL of SYBR Green master mix, 0.15 µL of ITR primer forward at 100 µM, and 0.15 µL of ITR primer reverse at 100 µM.
      NOTE: Each sample is measured in duplicate, with 16 wells for the reference standard, 8 wells per sample, and 2 wells for a no-template control. Prepare 10% more master mix to account for pipetting error.
    6. In an optical 96-well or 384-well reaction plate, load 15 µL/well of the SYBR Green qPCR master mix.
    7. Next, load 5 µL of samples and AAV6 reference material or nuclease-free water for the no-template control. For the AAV6 reference standard, load dilution 2 to dilution 9. For samples, load dilution 5 to dilution 8. Measure each dilution in duplicate. Avoid bubbles.
    8. Seal the loaded plate with optical transparent film, centrifuge at 800 x g for 1 min at RT, and load the plate into the qPCR instrument with the appropriate 96-well or 384-well setup.
    9. Set up and run the qPCR instrument using SYBR detection with the following cycling conditions: 98 °C for 3 min, then 40 cycles of 98 °C for 15 s and 58 °C for 30 s, followed by a melting curve.
    10. Analyze the data with the instrument's software using the AAV6 reference material's concentration in genome copies per millimeter (GC/mL) as the standard curve (see Table 3). Calculate the sample's final concentration by multiplying by the dilution factor.
    11. Ensure the standard curve R2 is close to 1.0, the PCR efficiency is 90%-110%, the baseline has been removed, the melting curve shows a single peak, the Ct values change in accordance with the dilutions, and the duplicates are within 0.5 Ct; otherwise, exclude outliers. Expect yields as in Figure 2.

2. Preparing B cell media and stimuli

  1. Prepare thawing medium: Combine RPMI-1640 with 20% FCS. Sterile-filter through a 0.2 µm PES membrane filter unit. Store at 4 °C.
  2. Prepare B cell culture medium: Combine the reagents in Table 4, and then sterile-filter through a 0.2 µm PES membrane filter unit. Store at 4 °C.
  3. Resuspend each of the B cell stimulants in Table 5 at stock concentrations in B cell culture medium, except CpG ODN which should be resuspended in nuclease-free water. Store at −80 °C.
  4. If performing non-B cell negative depletion (optional step 4), prepare DPBS (no calcium, no magnesium) with 2% FCS (DPBS 2% FCS). Sterile-filter through a 0.2 µm PES membrane filter unit. Store at 4 °C.

3. Preparation and culture of rhesus macaque B cells

NOTE: Cryopreserved rhesus macaque PBMCs or splenocytes are used to set up the cell culture30,31.

  1. Prewarm thawing medium and B cell culture media in a 37 °C water bath. Thaw the B cell stimulants from Table 5 on ice.
  2. Prepare an appropriately sized tube containing prewarmed thawing medium. This should ideally be more than 10-fold the volume of the thawed cells.
  3. Thaw one to two cryovials of PBMCs or splenocytes at a time in a 37 °C water bath, and decant into the prepared tube with prewarmed medium. Rinse the cryotubes to collect all the cells.
  4. Centrifuge the cells at 200 x g for 10 min at RT.
    NOTE: These centrifugation settings reduce the platelet contamination while preserving the PBMC yields. Higher speeds such as 350 x g for 5 min may be used.
  5. Resuspend the cells in 10 mL thawing medium for washing.
  6. Repeat step 3.4 and step 3.5 for a total of three centrifugations to remove the freezing medium. After the last centrifugation, resuspend the cells at an estimated ~5 x 106 cells/mL in B cell culture medium.
    NOTE: The above protocol cultures whole PBMC or splenocyte preparations with contamination by other cells. If purer B cell cultures are required, albeit at significantly reduced total B cell yields, continue with step 4. No differences have been observed in editing efficiencies between the two methods.
  7. Dilute an aliquot of 10 µL of cells as necessary with B cell culture medium for counting. Count using a hemocytometer and trypan blue staining, combining equal volumes of resuspended cells and trypan blue 0.4% solution.
  8. Adjust the cell concentration to 3 x 106 cells/ mL with B cell culture medium according to the cell count. Then, add the B cell stimulants to their final concentrations according to Table 5, and mix.
  9. Transfer the cells to an appropriate cell culture dish. Overall, 0.6 x 106-0.7 x 106 cells/cm2 is recommended. Incubate the cells at 37 °C with 5% CO2 for 48 h ± 2 h.

4. Optional negative depletion of non-B cells

NOTE: Yield and purity depend on the input percentage of B cells among the PBMCs, which can differ drastically among individual rhesus macaques27. Expect 80%-95% purity, 60% efficiency, and 1 x 106-1.5 x 106 cells from 1 x 107 PBMCs.

  1. After the last wash (step 3.6), resuspend the cells at 1 x 108 cells/mL in DPBS 2% FCS and human Fc-block diluted 1:200. The cell counts are based on the number of thawed cells.
  2. Incubate for 15 min on ice to block the Fc receptors, and then add the biotinylated antibodies in Table 6. Incubate for another 20 min on ice.
  3. Top up the tube with DPBS 2% FCS, and spin at 200 x g for 10 min at 4 °C.
  4. Resuspend the cells in DPBS 2% FCS at 80% of the volume from step 4.1 (i.e., 80 µL per 1 x 107 cells).
  5. Add magnetic streptavidin beads to the cell suspension at 20% of the volume from step 4.1 (i.e., 20 µL of beads per 1 x 107 cells).
  6. Incubate the cells for 15 min on ice, and agitate occasionally.
  7. Meanwhile, per 1 x 108 cells, prepare a magnetic separator with a large magnetic depletion column and a pre-separation filter. Rinse the pre-separation filter and column with 2 mL of DPBS 2% FCS by gravity flow, and discard the flow-through. Install a 15 mL collection tube.
    NOTE: The use of other columns such as positive selection columns or other magnetic bead purification systems may drastically reduce the purity.
  8. After incubation, top up the cells to 0.5 mL with DPBS 2% FCS if the volume is <0.5 mL. If the volume is ≥0.5 mL, simply proceed.
  9. Load the cell suspension into the pre-separation filter on the prepared column, and collect the flow-through into the 15 mL tube.
  10. Elute the unbound enriched B cells twice by adding 1 mL of DPBS 2% FCS into the pre-separation filter. Collect the unbound cells into the same tube by gravity flow.
    NOTE: Additional elution may marginally increase the yield. The purity and efficiency may be evaluated by the flow cytometry of the input cells, enriched cells, and cells retained on the column. To obtain the cells retained on the column, remove the column from the magnet, and flush with 3 mL of DPBS 2% FCS using the provided plunger. If desired, evaluate the purity by flow cytometry as in Figure 3 using the reagents in Table 7.
  11. Centrifuge the enriched B cells at 200 x g for 10 min at 4 °C.
  12. Resuspend the cells at an estimated ~5 x 106 cells/ mL in B cell culture medium, and continue at step 3.7.

5. Primary rhesus macaque B cell gene editing

  1. After activating the rhesus macaque B cells for 48 h ± 2 h, prepare the reagents for electroporation and transduction.
    1. Prewarm DMSO, nuclease-free duplex buffer, buffer T, and buffer E (10 µL electroporation kit) or E2 (100 µL electroporation kit) from the electroporation kit to RT.
    2. Thaw the rAAV6 HDRT and B cell stimulants from Table 5 on ice.
  2. Resuspend the CRISPR-Cas9 sgRNAs at 100 µM in duplex buffer. Reconstitute for 10 min at RT, and mix by vortexing and flicking. Keep the reconstituted sgRNAs on ice until use. Store at −80 °C.
    NOTE: CRISPR-Cas9 sgRNAs can be designed with various online tools (see 1.1.1) and can vary drastically in their cutting efficiency. Empirical testing of the cutting efficiency is recommended using assays such as TIDE37 or ICE38.
  3. Per 10 µL electroporation, prepare 550 µL of B cell culture medium with all the stimulants from Table 5, and add 1% DMSO. Scale the volumes 10-fold for 100 µL electroporations. Optionally, 10% of this medium can be prepared without antibiotic-antimycotic, which slightly increases the cell viability after transfection.
  4. Per 10 µL electroporation, prepare a well of a 48-well cell culture plate with 50 µL of the B cell culture medium with stimulants and without antibiotic-antimycotic, if using it. For 100 µL electroporations, pipette 500 µL into the wells of a 6-well plate.
  5. Add rAAV6 HDRT to the medium in the wells, up to 20% of the volume in the well. Aim for MOIs ranging from 1 x 105-1 x 106 based on the number of cells per transfection (10 µL electroporation: 5 x 105 cells; 100 µL electroporation: 5 x 106 cells) and the GC in the rAAV6 preparation. High rAAV6 stock concentrations of 5 x 1013 GC/mL to 5 x 1014 GC/mL are recommended to achieve high MOIs with low volumes.
    NOTE: Lower MOIs may lead to reduced editing efficiency, and MOIs of 5 x 105 are generally close to the maximum editing efficiencies we have seen. An influence of varying MOIs on B cell viability has not been observed. It is recommended to include controls without rAAV6 HDRT, without RNP transfection, and without both.
  6. Prewarm the prepared dishes and the remaining medium by transferring them into an incubator at 37 °C with 5% CO2.
  7. Per 10 µL electroporation, prepare 1.15 µL of ribonucleoprotein (RNP): Mix 0.4 µL of 61 µM Cas9 with 0.75 µL of 100 µM sgRNA in duplex buffer. Prepare extra (30% more for a single electroporation is recommended) due to pipetting error and to avoid bubbles when loading the electroporation tips. Scale 10-fold for 100 µL tips.
  8. Incubate the RNP for at least 15 min at RT before mixing with the cells. After incubation, multiple RNPs can be combined if more than one locus is to be targeted simultaneously. No significant differences in efficiency have been observed with up to three loci at the same time.
  9. Meanwhile, prepare the cells for electroporation. Keep the cells at RT at all times to avoid temperature shocks. Harvest the cells after 48 h ± 2 h of culture into an appropriate vessel. Rinse the dishes with DPBS to collect the maximum number of cells.
  10. Centrifuge the cells at 200 x g for 10 min at RT. Discard the supernatant, and resuspend the cells in DPBS at ~2 x 106 cells/mL.
  11. Combine 10 µL of trypan blue 0.4% solution with 10 µL of the cell suspension, and count using a hemocytometer.
    NOTE: At this point, due to loss during harvesting and washing, expect about 60% of the cells that were put in culture 48 h ± 2h earlier.
  12. Meanwhile, centrifuge the cells at 200 x g for 10 min at RT. Discard the supernatant, making sure to minimize any remaining DPBS. Resuspend the cells in prewarmed (RT) buffer T at 5.55 x 107 cells/mL based on the above cell count.
  13. Set up the transfection system by turning the machine on and setting it to 1,350 V, 15 ms, and 1 pulse. Place the pipette station inside the laminar flow hood
  14. For each set of 10 electroporations, prepare a transfection tube with 3 mL of buffer E (for 10 µL transfections) or E2 (for 100 µL transfections). Insert the tube into the pipette station.
  15. Per 10 µL electroporation, combine 1.15 µL of RNP with 9 µL of cells. Make sure to have a sufficient volume (+ 30%) to avoid aspirating air into the electroporation tip. Incubate at RT for 1-2 min before electroporation.
  16. Aspirate 10 µL or 100 µL of RNP and cell mixture into the appropriately sized electroporation tip on an electroporation pipette, insert the loaded pipette into the pipette station, and start the electroporation. Make sure the tips are completely free of air bubbles to prevent arcing. Watch during electroporation to verify that arcing does not occur.
  17. Immediately eject the electroporated cells into the prepared, prewarmed, small volume of medium with or without rAAV6 inside the 48-well (10 µL transfections) or 6-well plate (100 µL transfections). Repeat steps 5.15-5.17 with the remaining samples. Add control samples without transfection to the culture wells.
  18. Incubate the cells at 37 °C with 5% CO2 for 4 h ± 2 h, and then add the prepared, prewarmed B cell culture medium containing stimulants, DMSO, and antibiotic/antimycotic: 450 µL for 10 µL transfections or 4.5 mL for 100 µL transfections.
  19. Continue the incubation at 37 °C with 5% CO2 for 12-24 h. Then, change the medium to B cell culture medium containing stimulants and antibiotic/antimycotic without DMSO if extended culturing is desired. Analysis of the genomic DNA can be done after 24 h. Digital droplet PCR using a primer outside the homology arm and a primer inside the insert can be used to quantify the editing efficiency39. Perform PCRs to amplify the insertion site and Sanger sequencing to verify correct editing.
  20. For analysis of the protein levels, culture the cells for 40-48 h after electroporation to allow protein expression changes, and perform an analysis by flow cytometry using the reagents in Table 7.

Results

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The production of rAAV6 with the use of the tetracycline-enabled, self-silencing adenoviral helper resulted in the production of 4 x 1010 GC/mL of cell culture medium on average, thus outperforming the production using a standard, helper-free triple transfection by 30-40-fold (Figure 2).

The optional purification of rhesus macaque B cells resulted in the elimination of the vast majority of the CD3+ T cells and CD14+ and/or CD16+ myeloid cells, with purities of 80%-95% CD20+ B cells being routinely obtained (Figure 3). Based on our previous designs in murine B cells7, we developed a method to edit the B cell receptor specificity of rhesus macaque B cells while simultaneously maintaining allelic exclusion in the vast majority of B cells by deleting endogenous antibody light chains through the disruption of their constant region. We constructed a promoter-less HDRT to be inserted into the IGH locus in between the last IGHJ gene and the Eµ enhancer of rhesus macaque B cells (Figure 4). This construct utilizes the endogenous VH promoter of the naturally rearranged upstream VDJ region in mature B cells and is, thus, not expressed by episomal AAV genomes. Moreover, this construct requires splicing into downstream antibody heavy chain constant regions to be expressed on the cell surface. Therefore, specific antigen binding on the cell surface shown by flow cytometry indicates correct target locus integration and that the inserted sequence is functional.

We packaged such a construct encoding antibody Ab1485, a rhesus macaque-derived anti-HIV bNAb40, into rAAV6 and used it to edit activated primary rhesus macaque splenocyte or PBMC cultures, as described above (Figure 5A). The protocol maintained high cell viability (~90%) while simultaneously deleting the light chain expression in ~80% of B cells. The majority of the B cells still expressed the isotype IgM (Figure 5B). The addition of the rAAV6 encoding the Ab1485 HDRT resulted in gene editing and Ab1485 surface expression in 16%-21% of the B cells (Figure 5A), albeit at a lower fluorescence intensity for antibody chains than on unedited B cells (Figure 5A right panel, Figure 5C). This may be the result of epitope competition between the antigen stain and the monoclonals used to detect the surface BCR in flow cytometry, as well as actual reduced protein expression due to the polycistronic nature of the HDRT and less efficient splicing. The addition of 1% DMSO and extended, concentrated incubations with the rAAV6 HDRT generally increased the editing efficiency (Figure 6A-C). Using this specific method, typically 5%-20%, and up to 40%, editing efficiency is achieved depending on the individual rhesus macaque (Figure 5A, Figure 6A-E) and the quality of the rAAV6 HDRT batch (Figure 6E). Overall, we present protocols for efficient rAAV6 production as well as the culture, purification, and geneediting of rhesus macaque B cells.

ReagentsVolumeStockFinal concentration
DMEM, High Glucose500 mL1 x~ 88.5%
FCS, heat-inactivated50 mL1 x~ 8.85%
Antibiotic/Antimycotic5 mL100 x1 x
Glutamine5 mL200 mM2 mM
Sodium Pyruvate5 mL100 mM1 mM

Table 1: The 293AAV cell culture medium.

ReagentsVolumeStockFinal concentration
DMEM, High Glucose500 mL1 x~ 95.2%
FCS, heat-inactivated10 mL1 x~ 1.9%
Antibiotic/Antimycotic5 mL100 x1 x
Glutamine5 mL200 mM2 mM
Sodium Pyruvate5 mL100 mM1 mM

Table 2: The 293AAV cell production medium.

Dilution SeriesVolume of sample (µL)Diluent and volumeDilution factorTotal dilutionReference AAV6
GC/mL
Dilution 12 µL sample or AAV reference standard at 4.1 x 1011 GC/mL18 µL DNAseI buffer and enzyme10 x10 x4.1 x 1010
Dilution 215 µL Dil. 160 µL H2O5 x50 x8.2 x 109
Dilution 320 µL Dil. 280 µL H2O5 x250 x1.6 x 109
Dilution 420 µL Dil. 380 µL H2O5 x1250 x3.3 x 108
Dilution 520 µL Dil. 480 µL H2O5 x6250x6.6 x 107
Dilution 620 µL Dil. 580 µL H2O5 x31250 x1.3 x 107
Dilution 720 µL Dil. 680 µL H2O5 x156250 x2.6 x 106
Dilution 820 µL Dil. 680 µL H2O5 x781250 x5.24 x 105
Dilution 920 µL Dil. 780 µL H2O5 x3906250 x1.05 x 105

Table 3: qPCR dilution table.

ReagentVolumeStockFinal concentration
RPMI-1640420 mL1 x84%
FCS, heat-inactivated50 mL1 x10%
Antibiotic/Antimycotic5 mL100 x1 x
Glutamine5 mL200 mM2 mM
Sodium Pyruvate5 mL100 mM1 mM
HEPES5 mL1 M10 mM
2-B-mercapto-ethanol550 µL55 mM55 µM
Non-essential amino acids5 mL100 x1 x
Insulin-Transferin-Selenium5 mL100 x1 x

Table 4: B cell culture medium.

ReagentDilutionStockFinal concentration
MegaCD40L1:1000100 µg/mL100 ng/mL
CpG ODN1:3001 mg/mL3.33 µg/mL
Human BAFF1:100040 µg/mL40 ng/mL
Human IL-21:100050 µg/mL50 ng/mL
Human IL-101:100050 µg/mL50 ng/mL

Table 5: B cell stimulants.

AntibodyCloneDilutionFinal Conc.
anti-human CD3FN-181:402.5 µg/mL
anti-human CD8aRPA-T81:2002.5 µg/mL
anti-human CD14M5E21:2002.5 µg/mL
anti-human CD163G81:2002.5 µg/mL
anti-human CD33AC104.3E31:501 test
anti-human CD6410.11:8000.625 µg/mL
anti-human CD66TET21:111 test
anti-human CD89A591:8000.625 µg/mL

Table 6: Antibodies for the optional depletion of non-B cells.

ReagentType/cloneworking dilution/concentration
anti-human CD14 AlexaFluor647M5E21:50
anti-human CD16 AlexaFluor7003G81:50
anti-human CD20 PECy72H71:50
anti-human CD3 PESP34-21:50
Zombie-NIR - 1:500
anti-human HLA-DR BV605L2431:200
anti-human Ig light chain lambda APCMHL-381:50
anti-human Kappa Light Chain FITCpolyclonal1:500
anti-human IgM BV421MHM-881:50
RC1 antigen, randomly biotinylated -5 µg/mL
Streptavidin-PE -1:500

Table 7: Flow cytometric reagents for analysis.

rAAV6 production diagram; gene editing process in rhesus macaque B cells; qPCR, electroporation.
Figure 1: Schematic overview of rAAV6 production and the gene editing of primary rhesus macaque B cells. The protocols are divided into rAAV6 production (step 1) and the gene editing of rhesus macaque B cells (steps 2-5), including an optional step for the depletion of non-B cells (step 4). Steps in the protocols are indicated with red circles. Please click here to view a larger version of this figure.

rAAV6 production graph; cell culture yield comparison; two experimental conditions; gene therapy research.
Figure 2: High rAAV6 yields using a self-silencing adenoviral helper. rAAV6 was produced using the methods described here (pAAV transfection [TF] + self-silencing helper RepCap6, self-silencing adenoviral helper) or typical helper-free triple transfection of pAAV, pHelper, and pRepCap6 (pRC6). rAAV6 was purified from the cell supernatant only. The methods using the self-silencing adenoviral helper vectors produced 30-40-fold more rAAV titered by qPCR, as described above. Each dot represents an individual rAAV production using various pAAV constructs from 2 to 20 independent experiments. Mean ± SEM is plotted. Please click here to view a larger version of this figure.

Flow cytometry diagram, B cell enrichment, CD markers, cell sorting, input-output comparison.
Figure 3: B cell enrichment by the negative depletion of non-B cells. Rhesus macaque B cells were enriched from PBMCs using the protocol described and enriched to 90% purity. The pre-enrichment input and output after enrichment are shown. Gated on live, singlet PBMCs. Representative of five independent experiments. Please click here to view a larger version of this figure.

CRISPR gene editing diagram; rAAV6 HDRT process; IgH, IgK, IgL loci modification illustration.
Figure 4: Targeting strategy used for editing the B cell receptor specificity of rhesus macaque B cells. rAAV6 was produced containing the HDRT depicted. The HDRT consists of a 266 bp 5' homology arm, followed by 111 bp of the rhesus macaque IGHM exon 1 splice acceptor, then a GSG-linker with a Thosea asigna virus self-cleaving 2A peptide sequence (T2A), followed by a leader sequence and the complete light chain of rhesus macaque antibody Ab1485 as rhesus macaque IGLC1. This is followed by a furin cleavage site, a GSG linker, and a porcine teschovirus self-cleaving 2A peptide sequence (Furin-P2A), followed by another leader sequence and the Ab1485 heavy chain variable, followed by 52 bp of the rhesus macaque IGHJ4 splice donor sequence, to allow splicing into downstream antibody heavy chain constant regions, and a 514 bp homology arm. This construct was targeted into the IGH locus between the last IGHJ gene and the Eµ enhancer using the sgRNA target sequence GAGATGCCAGAGCAAACCAG. Both homology arms were designed to end at the cut site of this sgRNA, thus removing the target sequence and allowing optimal integration efficiencies. Simultaneously, to maintain allelic exclusion and the expression of a single B cell receptor, we deleted endogenous light chains using sgRNAs targeting the rhesus macaque IGKC with the target sequence GGCGGGAAGATGAAGACAGA and IGLC1, IGLC2, IGLC3, IGLC6, and IGLC7S using the target sequence CTGATCAGTGACTTCTACCC. The HDRT included silent mutations preventing the cleavage of the IGLC1 sequence by this sgRNA. Please click here to view a larger version of this figure.

Flow cytometry analysis of cell viability, B cell purity, light chain deletion, target integration.
Figure 5: Gene editing of primary rhesus macaque B cells. (A) Primary splenocytes (top panel) or PBMCs (bottom panel) from the same rhesus macaque were cultured without the depletion of non-B cells and edited as described above. The targeting strategy was as shown in Figure 4. Two days after electroporation, the cells were harvested and surface-stained for flow cytometric analysis. The left column was gated on singlet cells, and the other columns were then gated, as indicated in the top row. The viability of the cells, the purity of the B cells, the deletion efficiency of the light chains, and the knock-in efficiency of Ab1485 by staining with the specific antigen RC141 are indicated in untreated, RNP transfected, or RNP transfected + rAAV6 transduced samples (MOI = 5 x 105). Representative of six independent experiments with cells from different rhesus macaques. (B) IgM expression on cultured rhesus macaque B cell controls or after editing and (C) geometric mean fluorescence intensity (gMFI) of IgM on B cells that have not lost Ig expression due to IgLC and IgKC targeting (unedited) or B cells that bind the expected antigen (edited). The red dot indicates the gMFI of cultured untransfected control B cells. **** indicates p < 0.0001 in a paired t-test. Please click here to view a larger version of this figure.

Flow cytometry and bar graph analysis of B cell editing; IgL-APC, CD20-PECy7, DMSO effects.
Figure 6: Effects of DMSO, prolonged concentrated incubation with rAAV6 HDRT, rAAV batch quality, and reproducibility among different donor NHPs on gene editing efficiency in primary rhesus macaque B cells. (A) Splenocytes were cultured and edited as described. After electroporation, 5 x 105 cells were cultured in medium with or without 1% DMSO and incubated in 50 µL of medium containing rAAV6 HDRT at an MOI of 5 x 105 for either 2 h or 5 h before the addition of another 450 µL of medium. The cells were analyzed 2 days after electroporation by flow cytometry, as in Figure 5. Representative of four independent experiments. (B) Quantification of (A) over four independent experiments. The dots indicate technical replicates with transfection settings of 1,350 V, 10-20 ms, and 1 pulse electroporation duration and DMSO concentrations ranging from 0.75%-1.25%. (C) Average fold change in editing efficiency from (B). * p > 0.05 in Mann-Whitney U test. (D) Editing efficiencies over independent experiments with different macaques using a lower-efficiency commercial rAAV6 batch. (E) Editing efficiency using two different commercial batches of rAAV6 into which the same construct was packaged in the B cells of two different NHPs in the same experiment. The dots indicate technical replicates with transfection settings of 1,350 V, 10-20 ms, and 1 pulse electroporation. Please click here to view a larger version of this figure.

Discussion

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The protocols presented here provide a fast and efficient method to generate high yields and titers of rAAV6s as HDRTs and novel methods to efficiently gene-edit primary rhesus macaque B cells in vitro.

The rAAV6 production protocol is comparatively simple and fast, allowing the production and testing of many different constructs simultaneously without excessive labor. If desired, rAAV6 can be further purified using established protocols such as iodixanol gradient ultracentrifugation34 or aqueous two phase partitioning35 before buffer exchange and concentration.

Although it reduced the overall yield, we opted to only use serum-reduced cell culture medium for the rAAV6 purification instead of purification from the cell pellet, since the majority of rAAV6 is released into the medium36, and purification from the cell pellet adds more cost and labor. The use of the self-inactivating adenoviral helper increased the yields 30-40-fold on average, allowing the testing of constructs packaged into AAV6 in a single 15 cm dish. Although our purification method is basic, using this method, we obtain relatively little batch-to-batch variation in gene editing efficiency or cell viability after transduction using various cell lines or other primary cells (data not shown).

We developed a rhesus macaque B cell purification protocol to obtain untouched primary B cells using the negative depletion of undesired populations. Although not necessary for gene editing these cells, it provides a way to obtain a relatively pure population of primary rhesus macaque B cells for this or other applications should other cell types interfere with the experimental goals. However, purity comes at the cost of reduced overall B cell yields. Notably, for both the enriched and unenriched B cell cultures, the fraction of B cells in the initial PBMC or splenocyte preparations is crucial. For PBMCs in particular, we recommend screening different macaques for individuals with a high percentage of B cells in peripheral blood to obtain high numbers of B cells for experiments, as this value can differ dramatically between individuals27. PBMCs may be obtained by regular bleeding or leukapheresis42.

The gene editing protocol leads to efficient gene editing, typically between 60%-80% of knock-out and 5%-20% of knock-in B cells, although we have achieved up to 90% BCR knock-out and 40% BCR knock-in B cells (Figure 5 and Figure 6).

The major parameters for the efficient editing of rhesus macaque B cells are the cutting efficiency of the sgRNA, the electroporation parameters, the MOI, and the quality of the rAAV6 preparation. The cutting efficiencies of candidate sgRNAs should be determined empirically to allow for optimal editing and design of the HDRT. The electroporation parameters presented here balance efficiency with viability to obtain the maximum total number of edited B cells rather than the highest percentage of edited B cells. If a higher percentage of edited cells is required, increased voltages (up to 1,750 V) or altered pulse lengths (10-30 ms) are recommended, though more cell death may be observed. We also noted slightly higher editing efficiencies in splenic B cells compared to B cells from PBMCs from the same individual (Figure 5); however, the underlying reason for this is currently unknown.

We found that the addition of 1% DMSO after electroporation significantly increased the gene editing efficiency by ~40% in rhesus macaque B cells without affecting the cell viability (Figure 6A-C), in line with reports in other cells43. However, extended culture in 1% DMSO should be avoided and may affect cell viability. DMSO may be completely omitted if desired.

The culture of the cells in a small volume after electroporation for several hours together with the rAAV6 leads to higher editing efficiencies, probably due to the better transduction of HDRT by the rAAV6 and, thus, the higher intracellular concentration of HDRT at the relevant time when Cas9 is active. We found that culturing the cells this way for up to 8 h did not affect the cell viability, but the editing efficiencies did not increase dramatically beyond 5 h (Figure 6). If only knock-out instead of knock-in is required, this step may be omitted.

In conclusion, we present comprehensive protocols for the gene editing of rhesus macaque B cells in vitro and the production of rAAV6 HDRT necessary for the efficient knock-in of desired constructs. These protocols enable the rapid, cost-effective testing of many constructs packaged as rAAV6 and enable the preclinical testing of the feasibility and scalability of B cell therapies in a more relevant non-human primate model.

Disclosures

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

No competing interests are declared.

Acknowledgements

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

We would like to thank Harry B. Gristick and Pamela Bjorkman for providing the RC1 antigen and the entire Nussenzweig and Martin laboratories for critical discussion. This work was supported by The Bill and Melinda Gates Foundation grant INV-002777 (to M.C.N.) and the Intramural Research Program of the National Institute of Allergy and Infectious Diseases, National Institutes of Health. (R.G. and M.A.M). M.C.N. is an HHMI Investigator.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
1.5 mL tube sterile, Dnase, Rnase and purogen freeStellar ScientificT17-125or similar
10 mL serological pipette, polystyrene, sterile, nonpyrogenic, DNase-/RNase-free, and Human DNA-freeCorning4488or similar
15 cm tissue culture dishFalcon353025or similar
15 mL polypropylene conical tybeFalcon352097or similar
25 mL serological pipette, polystyrene, sterile, nonpyrogenic, DNase-/RNase-free, and Human DNA-freeCorning4489or similar
250 mL polypropylene conical tybeCorning430776or similar
293AAV cell lineCell BiolabsAAV-100
2-B-mercapto-ethanol, 55mM (1000x)Gibco21985-023
48-well tissue culture plateCorning3548or similar
5 mL serological pipette, polystyrene, sterile, nonpyrogenic, DNase-/RNase-free, and Human DNA-freeCorning4487or similar
5 mL syringes with Luer-Lok TipBD309646or similar
50 mL polypropylene conical tybeFalcon352070or similar
50 mL serological pipette, polystyrene, sterile, nonpyrogenic, DNase-/RNase-free, and Human DNA-freeCorning4490or similar
6-well tissue culture plateFalcon353046or similar
AAV-6 Packaging System (plasmids)Cell BiolabsVPK-406
AAV6 Reference Materials (full capsids)Charles RiverRS-AAV6-FL
Accu-jet S Pipette ControllerBrand26350or similar pipette controller
Antibiotic/Antimycotic 100xGibco15260-062
anti-human CD14 AlexaFluor647Biolegend301812
anti-human CD14 biotinBioLegend301826
anti-human CD16 AlexaFluor700BD Biosciences557920
anti-human CD16 biotinBioLegend302004
anti-human CD20 PECy7Biolegend302312
anti-human CD3 biotinThermo FisherAPS0309
anti-human CD3 PEBD Biosciences552127
anti-human CD33 biotinMiltenyi130-113-347
anti-human CD64 biotinBioLegend305004
anti-human CD66 biotinMiltenyi130-100-143
anti-human CD89 biotinBioLegend354112
anti-human CD8a biotinBioLegend301004
anti-human HLA-DR BV605Biolegend307640
anti-human Ig light chain lambda APCBiolegend316610
anti-human IgM BV421Biolegend314516
anti-Human Kappa Light Chain FITCFisher ScientificA18854
AutoclaveSterisAmsco Lab 250or similar
Cell culture CO2 incubatorFisher Scientific51026331or similar
Centrifugal Filter Unit (Amicon Ultra - 4, 100 kDa)MilliporeUFC810024
Centrifuge 5920 REppendorfEP022628188or any other, coolable swinging bucket centrifuge with inserts for 96-well plates, 15, 50 and 250 mL size tubes
ChloroformFisher ScientificC298SK-4
Cpg ODNInvivogentlrl-2395
Dimethyl sulfoxide (DMSO)Sigma-Aldrich34869-500ML
DMEM, High GlucoseGibco11965092
DNaseI (RNase-free)New England BiolabsM0303L
DPBS, no calcium, no magnesiumGibco14190144
Electroporation kit (Neon Transfection System 10 µL)Fisher ScientificMPK1096or other sizes or 100 uL transfection kit MPK 10096
Electroporation system (Neon Transfection System)Fisher ScientificMPK5000
FCSHycloneSH30910.03*
Ficoll-PM400 (Ficoll-Paque PLUS)Cytiva17144002or similar
Fume HoodFisher ScientificFH3943810244or similar
Glutamine 200 mMGibco25030-081
Graduated Cylinder 1LCorning3022-1Lor similar
HemocytometerSigma-AldrichZ375357-1EAor similar
HEPES 1MGibco15630-080
HEPES 1MGibco15630-080
Hot Plate Magnetic StirrerFisher ScientificSP88857200or similar
Human BAFFPeprotech 310-13
Human BD Fc BlockBD564220
Human IL-10Peprotech 200-10
Human IL-2Peprotech 200-02
Hydrochloric acidFisher ScientificA144S-500
Hydrophilic Polyethersulfone Syringe Filters, (Supor membrane), Sterile - 0.2 µm, 25 mm Pall4612
Insulin-Transferin-Selenium, 100xGibco41400-045
ITR primer forward: GGAACCCCTAGTGATGGAGTTIntegrated DNA Technologiescustom
ITR primer reverse: CGGCCTCAGTGAGCGAIntegrated DNA Technologiescustom
Laminar flow biosafety cabinetThe Baker CompanySG403Aor similar
Large magnetic depletion (LD) ColumnMiltenyi Biotec130-042-901
Magentic seperator (MidiMACS separator and multistand)Miltenyi Biotec130-090-329
Magnetic stir barFisher Scientific14-512-127or similar
Magnetic streptavidin beads (Streptavidin MicroBeads)Miltenyi Biotec130-048-101
Maxiprep kitMachery-Nagel740414.5or similar
Media Bottles 2L with capCole-ParmerUX-34514-26or similar
MegaCD40LEnzoALX-522-110-C010
MicroAmp Optical 384-well Reaction PlateFisher Scientific4309849
MicroAmp Optical Adhesive FilmFisher Scientific4311971
Microcentrifuge 5424 REppendorf5404000014or any other table top centrifuge for 1.5 mL tubes
Microwave ovenPanasonicNN-SD987SAor similar
Nikon TMS Inverted Phase Contrast MicroscopeNikonTMSor any other Inverted phase-contrast microscope for cell culture
Non-essential amino acids, 100xGibco11140-050
Nuclease-free Duplex bufferIntegrated DNA Technologies11-01-03-01
Nuclease-free WaterQiagen129115
pH meterMettler Toledo30019028or similar
Pipetman Classic Starter Kit, 4 Pipette Kit, P2, P20, P200, P1000 and tipsGilsonF167380or similar set of pipettes and tips
Pluronic F-68 10 %Gibco24040-032
Polyethylene Glycol 8000Fisher ScientificBP233-1
Polyethylenimine, Linear, MW 25000, Transfection Grade (PEI 25KPolysciences23966-100
Precision BalanceMettler ToledoME4001TEor similar
Pre-Separation Filters (30 µm)Miltenyi Biotec130-041-407
Pyrex glass beaker 2 LCole-ParmerUX-34502-13or similar
Pyrex glass beaker 250 mLMillipore SigmaCLS1000250or similar
qPCR InstrumentFisher Scientific4485691or similar
RC1 antigen randomly biotinylatedBjorkman lab, CalTechin house
RPMI-1640Gibco11875-093
S.p. Cas9 NucleaseIntegrated DNA Technologies1081059
Scientific 1203 Water BathVWR24118or any water bath set to  37 °C
Sodium chlorideSigma-AldrichS7653-5KG
Sodium hydroxideSigma-AldrichS8045-500G
Sodium Pyruvate 100 mMGibco11360-070
Sterile Disposable Filter Units with PES MembranesThermo Scientific Nalgene 567-0020 
Streptavidin-PEBD Biosciences554061
SYBR Green Master Mix Fisher ScientificA25742
Tetracycline-enabled, self-silencing adenoviral vector RepCap6 OxgeneTESSA-RepCap6
Trypan Blue Solution, 0.4%Gibco15250061
Trypsin-EDTA (0.05%), phenol redGibco25300054
Water Purification SystemMillipore SigmaZEQ7000TRor similar
Zombie-NIRBiolegend423106

References

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,
  1. Germinal centers. Annual Review of Immunology. 40, 413-442 (2022).">Victora, G. D., Nussenzweig, M. C. Germinal centers. Annual Review of Immunology. 40, 413-442 (2022).
  2. Correlates of protection induced by vaccination. Clinical and Vaccine Immunology. 17 (7), 1055-1065 (2010).">Plotkin, S. A. Correlates of protection induced by vaccination. Clinical and Vaccine Immunology. 17 (7), 1055-1065 (2010).
  3. T cell-dependent differentiation of human B cells into IgM, IgG, IgA, or IgE plasma cells: High rate of antibody production by IgE plasma cells, but limited clonal expansion of IgE precursors. Cellular Immunology. 152 (2), 323-332 (1993).">Brinkmann, V., Heusser, C. H. T cell-dependent differentiation of human B cells into IgM, IgG, IgA, or IgE plasma cells: High rate of antibody production by IgE plasma cells, but limited clonal expansion of IgE precursors. Cellular Immunology. 152 (2), 323-332 (1993).
  4. Protein Electrophoresis - Serum., 6th edition. , Elsevier Saunders. St Louis, MO. 917-920 (2013).">Chernecky, C. C., Berger, B. J. Protein Electrophoresis - Serum., 6th edition. , Elsevier Saunders. St Louis, MO. 917-920 (2013).
  5. Antibody-based protection against HIV infection by vectored immunoprophylaxis. Nature. 481 (7379), 81-84 (2011).">Balazs, A. B., et al. Antibody-based protection against HIV infection by vectored immunoprophylaxis. Nature. 481 (7379), 81-84 (2011).
  6. CRISPR-mediated editing of the B cell receptor in primary human B cells. iScience. 12, 369-378 (2019).">Greiner, V., et al. CRISPR-mediated editing of the B cell receptor in primary human B cells. iScience. 12, 369-378 (2019).
  7. HIV-specific humoral immune responses by CRISPR/Cas9-edited B cells. Journal of Experimental Medicine. 216 (6), 1301-1310 (2019).">Hartweger, H., et al. HIV-specific humoral immune responses by CRISPR/Cas9-edited B cells. Journal of Experimental Medicine. 216 (6), 1301-1310 (2019).
  8. Vaccine elicitation of HIV broadly neutralizing antibodies from engineered B cells. Nature Communications. 11, 5850(2020).">Huang, D., et al. Vaccine elicitation of HIV broadly neutralizing antibodies from engineered B cells. Nature Communications. 11, 5850(2020).
  9. Vector strategies to actualize B cell-based gene therapies. Journal of Immunology. 207 (3), 755-764 (2021).">Jeske, A. M., Boucher, P., Curiel, D. T., Voss, J. E. Vector strategies to actualize B cell-based gene therapies. Journal of Immunology. 207 (3), 755-764 (2021).
  10. In vivo engineered B cells secrete high titers of broadly neutralizing anti-HIV antibodies in mice. Nature Biotechnology. 40 (8), 1241-1249 (2022).">Nahmad, A. D., et al. In vivo engineered B cells secrete high titers of broadly neutralizing anti-HIV antibodies in mice. Nature Biotechnology. 40 (8), 1241-1249 (2022).
  11. Engineered B cells expressing an anti-HIV antibody enable memory retention, isotype switching and clonal expansion. Nature Communications. 11, 5851(2020).">Nahmad, A. D., et al. Engineered B cells expressing an anti-HIV antibody enable memory retention, isotype switching and clonal expansion. Nature Communications. 11, 5851(2020).
  12. Reprogramming the antigen specificity of B cells using genome-editing technologies. eLife. 8, 42995(2019).">Voss, J. E., et al. Reprogramming the antigen specificity of B cells using genome-editing technologies. eLife. 8, 42995(2019).
  13. Molecular design, optimization, and genomic integration of chimeric B cell receptors in murine B cells. Frontiers in Immunology. 10, 2630(2019).">Pesch, T., et al. Molecular design, optimization, and genomic integration of chimeric B cell receptors in murine B cells. Frontiers in Immunology. 10, 2630(2019).
  14. Editing of mouse and human immunoglobulin genes by CRISPR-Cas9 system. Nature Communications. 7, 10934(2016).">Cheong, T. C., Compagno, M., Chiarle, R. Editing of mouse and human immunoglobulin genes by CRISPR-Cas9 system. Nature Communications. 7, 10934(2016).
  15. Genome edited B cells: A new frontier in immune cell therapies. Molecular Therapy. 29 (11), 3192-3204 (2021).">Rogers, G. L., Cannon, P. M. Genome edited B cells: A new frontier in immune cell therapies. Molecular Therapy. 29 (11), 3192-3204 (2021).
  16. Engineering protein-secreting plasma cells by homology-directed repair in primary human B cells. Molecular Therapy. 26 (2), 456-467 (2018).">Hung, K. L., et al. Engineering protein-secreting plasma cells by homology-directed repair in primary human B cells. Molecular Therapy. 26 (2), 456-467 (2018).
  17. Engineering of primary human B cells with CRISPR/Cas9 targeted nuclease. Scientific Reports. 8, 12144(2018).">Johnson, M. J., Laoharawee, K., Lahr, W. S., Webber, B. R., Moriarity, B. S. Engineering of primary human B cells with CRISPR/Cas9 targeted nuclease. Scientific Reports. 8, 12144(2018).
  18. Genetic engineering in primary human B cells with CRISPR-Cas9 ribonucleoproteins. Journal of Immunological Methods. 457, 33-40 (2018).">Wu, C. M., et al. Genetic engineering in primary human B cells with CRISPR-Cas9 ribonucleoproteins. Journal of Immunological Methods. 457, 33-40 (2018).
  19. Engineering of alpha-PD-1 antibody-expressing long-lived plasma cells by CRISPR/Cas9-mediated targeted gene integration. Cell Death and Disease. 11 (11), 973(2020).">Luo, B., et al. Engineering of alpha-PD-1 antibody-expressing long-lived plasma cells by CRISPR/Cas9-mediated targeted gene integration. Cell Death and Disease. 11 (11), 973(2020).
  20. Genome engineering of primary human B cells using CRISPR/Cas9. Journal of Visualized Experiments. (165), e61855(2020).">Laoharawee, K., et al. Genome engineering of primary human B cells using CRISPR/Cas9. Journal of Visualized Experiments. (165), e61855(2020).
  21. CRISPR/Cas9-mediated genome engineering of primary human B cells. Methods in Molecular Biology. 2115, 435-444 (2020).">Laoharawee, K., Johnson, M. J., Moriarity, B. S. CRISPR/Cas9-mediated genome engineering of primary human B cells. Methods in Molecular Biology. 2115, 435-444 (2020).
  22. B cells engineered to express pathogen-specific antibodies protect against infection. Science Immunology. 4 (35), (2019).">Moffett, H. F., et al. B cells engineered to express pathogen-specific antibodies protect against infection. Science Immunology. 4 (35), (2019).
  23. CRISPR comes a-knock-in to reprogram antibodies in vivo. Nature Biotechnology. 40 (8), 1183-1184 (2022).">Hartweger, H., Nussenzweig, M. C. CRISPR comes a-knock-in to reprogram antibodies in vivo. Nature Biotechnology. 40 (8), 1183-1184 (2022).
  24. Of mice, macaques, and men: Broadly neutralizing antibody immunotherapy for HIV-1. Cell Host & Microbe. 22 (2), 207-216 (2017).">Nishimura, Y., Martin, M. A. Of mice, macaques, and men: Broadly neutralizing antibody immunotherapy for HIV-1. Cell Host & Microbe. 22 (2), 207-216 (2017).
  25. Monkeying around with HIV vaccines: Using rhesus macaques to define 'gatekeepers' for clinical trials. Nature Reviews Immunology. 9 (10), 717-728 (2009).">Shedlock, D. J., Silvestri, G., Weiner, D. B. Monkeying around with HIV vaccines: Using rhesus macaques to define 'gatekeepers' for clinical trials. Nature Reviews Immunology. 9 (10), 717-728 (2009).
  26. Efficient methods for generation and expansion of, and gene delivery to rhesus macaque plasma B cells. bioRxiv. , (2021).">Kreuser, S., et al. Efficient methods for generation and expansion of, and gene delivery to rhesus macaque plasma B cells. bioRxiv. , (2021).
  27. Human and rhesus plasmacytoid dendritic cell and B-cell responses to Toll-like receptor stimulation. Immunology. 134 (3), 257-269 (2011).">Gujer, C., Sundling, C., Seder, R. A., Karlsson Hedestam, G. B., Lore, K. Human and rhesus plasmacytoid dendritic cell and B-cell responses to Toll-like receptor stimulation. Immunology. 134 (3), 257-269 (2011).
  28. Cell enrichment-free massive ex-vivo expansion of peripheral CD20(+) B cells via CD40-CD40L signals in non-human primates. Biochemical and Biophysical Research Communications. 473 (1), 92-98 (2016).">Kim, J. S., et al. Cell enrichment-free massive ex-vivo expansion of peripheral CD20(+) B cells via CD40-CD40L signals in non-human primates. Biochemical and Biophysical Research Communications. 473 (1), 92-98 (2016).
  29. Self-attenuating adenovirus enables production of recombinant adeno-associated virus for high manufacturing yield without contamination. Nature Communications. 13, 1182(2022).">Su, W., et al. Self-attenuating adenovirus enables production of recombinant adeno-associated virus for high manufacturing yield without contamination. Nature Communications. 13, 1182(2022).
  30. Short- and long-term clinical outcomes in rhesus monkeys inoculated with a highly pathogenic chimeric simian/human immunodeficiency virus. Journal of Virology. 74 (15), 6935-6945 (2000).">Endo, Y., et al. Short- and long-term clinical outcomes in rhesus monkeys inoculated with a highly pathogenic chimeric simian/human immunodeficiency virus. Journal of Virology. 74 (15), 6935-6945 (2000).
  31. Partial splenectomy in the era of minimally invasive surgery: The current laparoscopic and robotic experiences. Surgical Endoscopy. 29 (12), 3618-3627 (2015).">Balaphas, A., Buchs, N. C., Meyer, J., Hagen, M. E., Morel, P. Partial splenectomy in the era of minimally invasive surgery: The current laparoscopic and robotic experiences. Surgical Endoscopy. 29 (12), 3618-3627 (2015).
  32. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods. 6 (5), 343-345 (2009).">Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods. 6 (5), 343-345 (2009).
  33. CHOPCHOP v3: Expanding the CRISPR web toolbox beyond genome editing. Nucleic Acids Research. 47, 171-174 (2019).">Labun, K., et al. CHOPCHOP v3: Expanding the CRISPR web toolbox beyond genome editing. Nucleic Acids Research. 47, 171-174 (2019).
  34. Comparative analysis of cesium chloride- and iodixanol-based purification of recombinant adeno-associated viral vectors for preclinical applications. Human Gene Therapy Methods. 26 (4), 147-157 (2015).">Strobel, B., Miller, F. D., Rist, W., Lamla, T. Comparative analysis of cesium chloride- and iodixanol-based purification of recombinant adeno-associated viral vectors for preclinical applications. Human Gene Therapy Methods. 26 (4), 147-157 (2015).
  35. Rapid and simplified purification of recombinant adeno-associated virus. Journal of Virological Methods. 183 (2), 139-146 (2012).">Guo, P., et al. Rapid and simplified purification of recombinant adeno-associated virus. Journal of Virological Methods. 183 (2), 139-146 (2012).
  36. Efficient serotype-dependent release of functional vector into the culture medium during adeno-associated virus manufacturing. Human Gene Therapy. 21 (10), 1251-1257 (2010).">Vandenberghe, L. H., et al. Efficient serotype-dependent release of functional vector into the culture medium during adeno-associated virus manufacturing. Human Gene Therapy. 21 (10), 1251-1257 (2010).
  37. Easy quantitative assessment of genome editing by sequence trace decomposition. Nucleic Acids Research. 42 (22), 168(2014).">Brinkman, E. K., Chen, T., Amendola, M., van Steensel, B. Easy quantitative assessment of genome editing by sequence trace decomposition. Nucleic Acids Research. 42 (22), 168(2014).
  38. Inference of CRISPR edits from Sanger trace data. The CRISPR Journal. 5 (1), 123-130 (2022).">Conant, D., et al. Inference of CRISPR edits from Sanger trace data. The CRISPR Journal. 5 (1), 123-130 (2022).
  39. Cas9-AAV6 gene correction of beta-globin in autologous HSCs improves sickle cell disease erythropoiesis in mice. Nature Communications. 12, 686(2021).">Wilkinson, A. C., et al. Cas9-AAV6 gene correction of beta-globin in autologous HSCs improves sickle cell disease erythropoiesis in mice. Nature Communications. 12, 686(2021).
  40. A broadly neutralizing macaque monoclonal antibody against the HIV-1 V3-Glycan patch. eLife. 9, 61991(2020).">Wang, Z., et al. A broadly neutralizing macaque monoclonal antibody against the HIV-1 V3-Glycan patch. eLife. 9, 61991(2020).
  41. Immunization expands B cells specific to HIV-1 V3 glycan in mice and macaques. Nature. 570 (7762), 468-473 (2019).">Escolano, A., et al. Immunization expands B cells specific to HIV-1 V3 glycan in mice and macaques. Nature. 570 (7762), 468-473 (2019).
  42. Leukapheresis protocol for nonhuman primates weighing less than 10 kg. Journal of the American Association for Laboratory Animal Science. 52 (1), 70-77 (2013).">Pathiraja, V., Matar, A. J., Gusha, A., Huang, C. A., Duran-Struuck, R. Leukapheresis protocol for nonhuman primates weighing less than 10 kg. Journal of the American Association for Laboratory Animal Science. 52 (1), 70-77 (2013).
  43. DMSO increases efficiency of genome editing at two non-coding loci. PLoS One. 13 (6), 0198637(2018).">Stratigopoulos, G., De Rosa, M. C., LeDuc, C. A., Leibel, R. L., Doege, C. A. DMSO increases efficiency of genome editing at two non-coding loci. PLoS One. 13 (6), 0198637(2018).

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Tags

CRISPR Cas9B Cell ElectroporationrAAV6 TransductionHomology Directed RepairPeripheral Blood Mononuclear CellsFlow CytometrySanger SequencingAntibody Expression

Related Articles