We present a method for culturing and gene editing primary rhesus macaque B cells using CRISPR/Cas9 and recombinant adeno-associated virus serotype 6 for the study of B cell therapies.
Method Article
We present a method for culturing and gene editing primary rhesus macaque B cells using CRISPR/Cas9 and recombinant adeno-associated virus serotype 6 for the study of B cell therapies.
B cells and their progeny are the sources of highly expressed antibodies. Their high protein expression capabilities together with their abundance, easy accessibility via peripheral blood, and amenability to simple adoptive transfers have made them an attractive target for gene editing approaches to express recombinant antibodies or other therapeutic proteins. The gene editing of mouse and human primary B cells is efficient, and mouse models for in vivo studies have shown promise, but feasibility and scalability for larger animal models have so far not been demonstrated. We, therefore, developed a protocol to edit rhesus macaque primary B cells in vitro to enable such studies. We report conditions for in vitro culture and gene-editing of primary rhesus macaque B cells from peripheral blood mononuclear cells or splenocytes using CRISPR/Cas9. To achieve the targeted integration of large (<4.5 kb) cassettes, a fast and efficient protocol was included for preparing recombinant adeno-associated virus serotype 6 as a homology-directed repair template using a tetracycline-enabled self-silencing adenoviral helper vector. These protocols enable the study of prospective B cell therapeutics in rhesus macaques.
B cells are the foundation of humoral immunity. Upon activation by cognate antigen and secondary signals, naïve B cells give rise to germinal center B cells, memory B cells, and plasma cells1. The latter is the source of the secreted antibodies that mediate the protective functions of most currently available vaccines2. Plasma cells have been described as antibody factories as they secrete vast amounts of antibodies into the serum-about 2 ng/day/cell3, amounting to 7-16 g/L serum, making antibodies one of the three most abundant proteins in serum4. B cells are abundant in blood and can, thus, be easily obtained and infused back into an individual.
These traits have made B cells a target of cell therapy efforts to gene-edit the B cell receptor (BCR) and express broadly neutralizing antibodies (bNAbs) to the human immunodeficiency virus (HIV)5,6,7,8,9,10,11,12,13,14,15 and other proteins16,17,18,19,20,21. Such approaches have shown potential in numerous mouse studies in vivo7,8,10,11,16,22. However, several hurdles still must be overcome for clinical translation9,15,23, among them safety, duration, and magnitude of the therapeutic efficacy, as well as scaling to larger animals such as non-human primates (NHPs). Indeed, NHPs, and in particular rhesus macaques, which have a long history in antibody and HIV research24,25, are the most suitable model to test these parameters.
Here, we developed protocols that enable these issues to be addressed. To date, few studies have attempted to culture rhesus macaque B cells ex vivo, and only positive selection using CD20 has been reported for the purification of rhesus macaque B cells26,27,28. We have established a protocol for the isolation of untouched rhesus macaque B cells by the negative depletion of other cell types. Furthermore, culturing conditions are defined for the targeted gene editing of rhesus macaque B cells. This protocol outlines the use of CRISPR/Cas9 ribonucleoproteins (RNPs) and recombinant adeno-associated virus serotype 6 (rAAV6) as homology-directed repair template (HDRT) to gene edit cultured rhesus macaque B cells. Using this protocol, editing efficiencies up to 40% with large (~1.5 kb) inserts were achieved. We also present a fast and cost-effective method to produce rAAV6 using a tetracycline-enabled, self-silencing adenoviral helper29 to enable the fast testing of HDRTs in this format. Combined, these protocols describe an efficient workflow for the gene editing of rhesus macaque B cells (Figure 1), enabling the evaluation of B cell therapies in an NHP model.
To start the experiments, donor material can be ordered from commercial sources or obtained by phlebotomies or splenectomy. In this study, the phlebotomies and blood collections were performed as previously described30 using the anticoagulant EDTA. To obtain splenic, primary rhesus macaque B cells, partial (25%-50%) or total splenectomies were performed using techniques reported earlier31. The animals were fasted overnight before the surgery. Briefly, during the surgery, the abdomen was clipped and prepared with alternating scrubs of chlorhexidine and 70% isopropyl alcohol three times. An incision (5-10 cm) was made in the abdomen to identify and isolate the spleen. The vasculature of the spleen was ligated with either sutures or vascular clamps. The incision was closed in two layers with 4-0 PDS polydioxanone sutures. Splenectomy was performed a single time for an individual animal. Single-cell suspensions were prepared from macaque spleens by maceration through cell strainers. Mononuclear cells from blood and splenic cell suspensions were prepared using density gradient centrifugation and stored in liquid nitrogen.
All animal procedures and experiments were performed according to protocols approved by the Institutional Animal Care and Use Committee of the National Institute of Allergy and Infectious Diseases, National Institutes of Health. A summary of the following protocols is presented in Figure 1. Male and female rhesus macaques (Macaca mulatta) of Indian genetic origin aged 2-8 years old were housed and cared for in accordance with the guidelines of the Committee on the Care and Use of Laboratory Animals in a biosafety level 2 facility.
CAUTION: All experiments were performed in compliance with the universal precautions for bloodborne pathogens, with sterile/aseptic techniques and proper biosafety level 2 equipment in laminar flow hoods.
1. rAAV6 production
2. Preparing B cell media and stimuli
3. Preparation and culture of rhesus macaque B cells
NOTE: Cryopreserved rhesus macaque PBMCs or splenocytes are used to set up the cell culture30,31.
4. Optional negative depletion of non-B cells
NOTE: Yield and purity depend on the input percentage of B cells among the PBMCs, which can differ drastically among individual rhesus macaques27. Expect 80%-95% purity, 60% efficiency, and 1 x 106-1.5 x 106 cells from 1 x 107 PBMCs.
5. Primary rhesus macaque B cell gene editing
The production of rAAV6 with the use of the tetracycline-enabled, self-silencing adenoviral helper resulted in the production of 4 x 1010 GC/mL of cell culture medium on average, thus outperforming the production using a standard, helper-free triple transfection by 30-40-fold (Figure 2).
The optional purification of rhesus macaque B cells resulted in the elimination of the vast majority of the CD3+ T cells and CD14+ and/or CD16+ myeloid cells, with purities of 80%-95% CD20+ B cells being routinely obtained (Figure 3). Based on our previous designs in murine B cells7, we developed a method to edit the B cell receptor specificity of rhesus macaque B cells while simultaneously maintaining allelic exclusion in the vast majority of B cells by deleting endogenous antibody light chains through the disruption of their constant region. We constructed a promoter-less HDRT to be inserted into the IGH locus in between the last IGHJ gene and the Eµ enhancer of rhesus macaque B cells (Figure 4). This construct utilizes the endogenous VH promoter of the naturally rearranged upstream VDJ region in mature B cells and is, thus, not expressed by episomal AAV genomes. Moreover, this construct requires splicing into downstream antibody heavy chain constant regions to be expressed on the cell surface. Therefore, specific antigen binding on the cell surface shown by flow cytometry indicates correct target locus integration and that the inserted sequence is functional.
We packaged such a construct encoding antibody Ab1485, a rhesus macaque-derived anti-HIV bNAb40, into rAAV6 and used it to edit activated primary rhesus macaque splenocyte or PBMC cultures, as described above (Figure 5A). The protocol maintained high cell viability (~90%) while simultaneously deleting the light chain expression in ~80% of B cells. The majority of the B cells still expressed the isotype IgM (Figure 5B). The addition of the rAAV6 encoding the Ab1485 HDRT resulted in gene editing and Ab1485 surface expression in 16%-21% of the B cells (Figure 5A), albeit at a lower fluorescence intensity for antibody chains than on unedited B cells (Figure 5A right panel, Figure 5C). This may be the result of epitope competition between the antigen stain and the monoclonals used to detect the surface BCR in flow cytometry, as well as actual reduced protein expression due to the polycistronic nature of the HDRT and less efficient splicing. The addition of 1% DMSO and extended, concentrated incubations with the rAAV6 HDRT generally increased the editing efficiency (Figure 6A-C). Using this specific method, typically 5%-20%, and up to 40%, editing efficiency is achieved depending on the individual rhesus macaque (Figure 5A, Figure 6A-E) and the quality of the rAAV6 HDRT batch (Figure 6E). Overall, we present protocols for efficient rAAV6 production as well as the culture, purification, and geneediting of rhesus macaque B cells.
| Reagents | Volume | Stock | Final concentration |
| DMEM, High Glucose | 500 mL | 1 x | ~ 88.5% |
| FCS, heat-inactivated | 50 mL | 1 x | ~ 8.85% |
| Antibiotic/Antimycotic | 5 mL | 100 x | 1 x |
| Glutamine | 5 mL | 200 mM | 2 mM |
| Sodium Pyruvate | 5 mL | 100 mM | 1 mM |
Table 1: The 293AAV cell culture medium.
| Reagents | Volume | Stock | Final concentration |
| DMEM, High Glucose | 500 mL | 1 x | ~ 95.2% |
| FCS, heat-inactivated | 10 mL | 1 x | ~ 1.9% |
| Antibiotic/Antimycotic | 5 mL | 100 x | 1 x |
| Glutamine | 5 mL | 200 mM | 2 mM |
| Sodium Pyruvate | 5 mL | 100 mM | 1 mM |
Table 2: The 293AAV cell production medium.
| Dilution Series | Volume of sample (µL) | Diluent and volume | Dilution factor | Total dilution | Reference AAV6 |
| GC/mL | |||||
| Dilution 1 | 2 µL sample or AAV reference standard at 4.1 x 1011 GC/mL | 18 µL DNAseI buffer and enzyme | 10 x | 10 x | 4.1 x 1010 |
| Dilution 2 | 15 µL Dil. 1 | 60 µL H2O | 5 x | 50 x | 8.2 x 109 |
| Dilution 3 | 20 µL Dil. 2 | 80 µL H2O | 5 x | 250 x | 1.6 x 109 |
| Dilution 4 | 20 µL Dil. 3 | 80 µL H2O | 5 x | 1250 x | 3.3 x 108 |
| Dilution 5 | 20 µL Dil. 4 | 80 µL H2O | 5 x | 6250x | 6.6 x 107 |
| Dilution 6 | 20 µL Dil. 5 | 80 µL H2O | 5 x | 31250 x | 1.3 x 107 |
| Dilution 7 | 20 µL Dil. 6 | 80 µL H2O | 5 x | 156250 x | 2.6 x 106 |
| Dilution 8 | 20 µL Dil. 6 | 80 µL H2O | 5 x | 781250 x | 5.24 x 105 |
| Dilution 9 | 20 µL Dil. 7 | 80 µL H2O | 5 x | 3906250 x | 1.05 x 105 |
Table 3: qPCR dilution table.
| Reagent | Volume | Stock | Final concentration |
| RPMI-1640 | 420 mL | 1 x | 84% |
| FCS, heat-inactivated | 50 mL | 1 x | 10% |
| Antibiotic/Antimycotic | 5 mL | 100 x | 1 x |
| Glutamine | 5 mL | 200 mM | 2 mM |
| Sodium Pyruvate | 5 mL | 100 mM | 1 mM |
| HEPES | 5 mL | 1 M | 10 mM |
| 2-B-mercapto-ethanol | 550 µL | 55 mM | 55 µM |
| Non-essential amino acids | 5 mL | 100 x | 1 x |
| Insulin-Transferin-Selenium | 5 mL | 100 x | 1 x |
Table 4: B cell culture medium.
| Reagent | Dilution | Stock | Final concentration |
| MegaCD40L | 1:1000 | 100 µg/mL | 100 ng/mL |
| CpG ODN | 1:300 | 1 mg/mL | 3.33 µg/mL |
| Human BAFF | 1:1000 | 40 µg/mL | 40 ng/mL |
| Human IL-2 | 1:1000 | 50 µg/mL | 50 ng/mL |
| Human IL-10 | 1:1000 | 50 µg/mL | 50 ng/mL |
Table 5: B cell stimulants.
| Antibody | Clone | Dilution | Final Conc. |
| anti-human CD3 | FN-18 | 1:40 | 2.5 µg/mL |
| anti-human CD8a | RPA-T8 | 1:200 | 2.5 µg/mL |
| anti-human CD14 | M5E2 | 1:200 | 2.5 µg/mL |
| anti-human CD16 | 3G8 | 1:200 | 2.5 µg/mL |
| anti-human CD33 | AC104.3E3 | 1:50 | 1 test |
| anti-human CD64 | 10.1 | 1:800 | 0.625 µg/mL |
| anti-human CD66 | TET2 | 1:11 | 1 test |
| anti-human CD89 | A59 | 1:800 | 0.625 µg/mL |
Table 6: Antibodies for the optional depletion of non-B cells.
| Reagent | Type/clone | working dilution/concentration |
| anti-human CD14 AlexaFluor647 | M5E2 | 1:50 |
| anti-human CD16 AlexaFluor700 | 3G8 | 1:50 |
| anti-human CD20 PECy7 | 2H7 | 1:50 |
| anti-human CD3 PE | SP34-2 | 1:50 |
| Zombie-NIR | - | 1:500 |
| anti-human HLA-DR BV605 | L243 | 1:200 |
| anti-human Ig light chain lambda APC | MHL-38 | 1:50 |
| anti-human Kappa Light Chain FITC | polyclonal | 1:500 |
| anti-human IgM BV421 | MHM-88 | 1:50 |
| RC1 antigen, randomly biotinylated | - | 5 µg/mL |
| Streptavidin-PE | - | 1:500 |
Table 7: Flow cytometric reagents for analysis.

Figure 1: Schematic overview of rAAV6 production and the gene editing of primary rhesus macaque B cells. The protocols are divided into rAAV6 production (step 1) and the gene editing of rhesus macaque B cells (steps 2-5), including an optional step for the depletion of non-B cells (step 4). Steps in the protocols are indicated with red circles. Please click here to view a larger version of this figure.

Figure 2: High rAAV6 yields using a self-silencing adenoviral helper. rAAV6 was produced using the methods described here (pAAV transfection [TF] + self-silencing helper RepCap6, self-silencing adenoviral helper) or typical helper-free triple transfection of pAAV, pHelper, and pRepCap6 (pRC6). rAAV6 was purified from the cell supernatant only. The methods using the self-silencing adenoviral helper vectors produced 30-40-fold more rAAV titered by qPCR, as described above. Each dot represents an individual rAAV production using various pAAV constructs from 2 to 20 independent experiments. Mean ± SEM is plotted. Please click here to view a larger version of this figure.

Figure 3: B cell enrichment by the negative depletion of non-B cells. Rhesus macaque B cells were enriched from PBMCs using the protocol described and enriched to 90% purity. The pre-enrichment input and output after enrichment are shown. Gated on live, singlet PBMCs. Representative of five independent experiments. Please click here to view a larger version of this figure.

Figure 4: Targeting strategy used for editing the B cell receptor specificity of rhesus macaque B cells. rAAV6 was produced containing the HDRT depicted. The HDRT consists of a 266 bp 5' homology arm, followed by 111 bp of the rhesus macaque IGHM exon 1 splice acceptor, then a GSG-linker with a Thosea asigna virus self-cleaving 2A peptide sequence (T2A), followed by a leader sequence and the complete light chain of rhesus macaque antibody Ab1485 as rhesus macaque IGLC1. This is followed by a furin cleavage site, a GSG linker, and a porcine teschovirus self-cleaving 2A peptide sequence (Furin-P2A), followed by another leader sequence and the Ab1485 heavy chain variable, followed by 52 bp of the rhesus macaque IGHJ4 splice donor sequence, to allow splicing into downstream antibody heavy chain constant regions, and a 514 bp homology arm. This construct was targeted into the IGH locus between the last IGHJ gene and the Eµ enhancer using the sgRNA target sequence GAGATGCCAGAGCAAACCAG. Both homology arms were designed to end at the cut site of this sgRNA, thus removing the target sequence and allowing optimal integration efficiencies. Simultaneously, to maintain allelic exclusion and the expression of a single B cell receptor, we deleted endogenous light chains using sgRNAs targeting the rhesus macaque IGKC with the target sequence GGCGGGAAGATGAAGACAGA and IGLC1, IGLC2, IGLC3, IGLC6, and IGLC7S using the target sequence CTGATCAGTGACTTCTACCC. The HDRT included silent mutations preventing the cleavage of the IGLC1 sequence by this sgRNA. Please click here to view a larger version of this figure.

Figure 5: Gene editing of primary rhesus macaque B cells. (A) Primary splenocytes (top panel) or PBMCs (bottom panel) from the same rhesus macaque were cultured without the depletion of non-B cells and edited as described above. The targeting strategy was as shown in Figure 4. Two days after electroporation, the cells were harvested and surface-stained for flow cytometric analysis. The left column was gated on singlet cells, and the other columns were then gated, as indicated in the top row. The viability of the cells, the purity of the B cells, the deletion efficiency of the light chains, and the knock-in efficiency of Ab1485 by staining with the specific antigen RC141 are indicated in untreated, RNP transfected, or RNP transfected + rAAV6 transduced samples (MOI = 5 x 105). Representative of six independent experiments with cells from different rhesus macaques. (B) IgM expression on cultured rhesus macaque B cell controls or after editing and (C) geometric mean fluorescence intensity (gMFI) of IgM on B cells that have not lost Ig expression due to IgLC and IgKC targeting (unedited) or B cells that bind the expected antigen (edited). The red dot indicates the gMFI of cultured untransfected control B cells. **** indicates p < 0.0001 in a paired t-test. Please click here to view a larger version of this figure.

Figure 6: Effects of DMSO, prolonged concentrated incubation with rAAV6 HDRT, rAAV batch quality, and reproducibility among different donor NHPs on gene editing efficiency in primary rhesus macaque B cells. (A) Splenocytes were cultured and edited as described. After electroporation, 5 x 105 cells were cultured in medium with or without 1% DMSO and incubated in 50 µL of medium containing rAAV6 HDRT at an MOI of 5 x 105 for either 2 h or 5 h before the addition of another 450 µL of medium. The cells were analyzed 2 days after electroporation by flow cytometry, as in Figure 5. Representative of four independent experiments. (B) Quantification of (A) over four independent experiments. The dots indicate technical replicates with transfection settings of 1,350 V, 10-20 ms, and 1 pulse electroporation duration and DMSO concentrations ranging from 0.75%-1.25%. (C) Average fold change in editing efficiency from (B). * p > 0.05 in Mann-Whitney U test. (D) Editing efficiencies over independent experiments with different macaques using a lower-efficiency commercial rAAV6 batch. (E) Editing efficiency using two different commercial batches of rAAV6 into which the same construct was packaged in the B cells of two different NHPs in the same experiment. The dots indicate technical replicates with transfection settings of 1,350 V, 10-20 ms, and 1 pulse electroporation. Please click here to view a larger version of this figure.
The protocols presented here provide a fast and efficient method to generate high yields and titers of rAAV6s as HDRTs and novel methods to efficiently gene-edit primary rhesus macaque B cells in vitro.
The rAAV6 production protocol is comparatively simple and fast, allowing the production and testing of many different constructs simultaneously without excessive labor. If desired, rAAV6 can be further purified using established protocols such as iodixanol gradient ultracentrifugation34 or aqueous two phase partitioning35 before buffer exchange and concentration.
Although it reduced the overall yield, we opted to only use serum-reduced cell culture medium for the rAAV6 purification instead of purification from the cell pellet, since the majority of rAAV6 is released into the medium36, and purification from the cell pellet adds more cost and labor. The use of the self-inactivating adenoviral helper increased the yields 30-40-fold on average, allowing the testing of constructs packaged into AAV6 in a single 15 cm dish. Although our purification method is basic, using this method, we obtain relatively little batch-to-batch variation in gene editing efficiency or cell viability after transduction using various cell lines or other primary cells (data not shown).
We developed a rhesus macaque B cell purification protocol to obtain untouched primary B cells using the negative depletion of undesired populations. Although not necessary for gene editing these cells, it provides a way to obtain a relatively pure population of primary rhesus macaque B cells for this or other applications should other cell types interfere with the experimental goals. However, purity comes at the cost of reduced overall B cell yields. Notably, for both the enriched and unenriched B cell cultures, the fraction of B cells in the initial PBMC or splenocyte preparations is crucial. For PBMCs in particular, we recommend screening different macaques for individuals with a high percentage of B cells in peripheral blood to obtain high numbers of B cells for experiments, as this value can differ dramatically between individuals27. PBMCs may be obtained by regular bleeding or leukapheresis42.
The gene editing protocol leads to efficient gene editing, typically between 60%-80% of knock-out and 5%-20% of knock-in B cells, although we have achieved up to 90% BCR knock-out and 40% BCR knock-in B cells (Figure 5 and Figure 6).
The major parameters for the efficient editing of rhesus macaque B cells are the cutting efficiency of the sgRNA, the electroporation parameters, the MOI, and the quality of the rAAV6 preparation. The cutting efficiencies of candidate sgRNAs should be determined empirically to allow for optimal editing and design of the HDRT. The electroporation parameters presented here balance efficiency with viability to obtain the maximum total number of edited B cells rather than the highest percentage of edited B cells. If a higher percentage of edited cells is required, increased voltages (up to 1,750 V) or altered pulse lengths (10-30 ms) are recommended, though more cell death may be observed. We also noted slightly higher editing efficiencies in splenic B cells compared to B cells from PBMCs from the same individual (Figure 5); however, the underlying reason for this is currently unknown.
We found that the addition of 1% DMSO after electroporation significantly increased the gene editing efficiency by ~40% in rhesus macaque B cells without affecting the cell viability (Figure 6A-C), in line with reports in other cells43. However, extended culture in 1% DMSO should be avoided and may affect cell viability. DMSO may be completely omitted if desired.
The culture of the cells in a small volume after electroporation for several hours together with the rAAV6 leads to higher editing efficiencies, probably due to the better transduction of HDRT by the rAAV6 and, thus, the higher intracellular concentration of HDRT at the relevant time when Cas9 is active. We found that culturing the cells this way for up to 8 h did not affect the cell viability, but the editing efficiencies did not increase dramatically beyond 5 h (Figure 6). If only knock-out instead of knock-in is required, this step may be omitted.
In conclusion, we present comprehensive protocols for the gene editing of rhesus macaque B cells in vitro and the production of rAAV6 HDRT necessary for the efficient knock-in of desired constructs. These protocols enable the rapid, cost-effective testing of many constructs packaged as rAAV6 and enable the preclinical testing of the feasibility and scalability of B cell therapies in a more relevant non-human primate model.
No competing interests are declared.
We would like to thank Harry B. Gristick and Pamela Bjorkman for providing the RC1 antigen and the entire Nussenzweig and Martin laboratories for critical discussion. This work was supported by The Bill and Melinda Gates Foundation grant INV-002777 (to M.C.N.) and the Intramural Research Program of the National Institute of Allergy and Infectious Diseases, National Institutes of Health. (R.G. and M.A.M). M.C.N. is an HHMI Investigator.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| 1.5 mL tube sterile, Dnase, Rnase and purogen free | Stellar Scientific | T17-125 | or similar |
| 10 mL serological pipette, polystyrene, sterile, nonpyrogenic, DNase-/RNase-free, and Human DNA-free | Corning | 4488 | or similar |
| 15 cm tissue culture dish | Falcon | 353025 | or similar |
| 15 mL polypropylene conical tybe | Falcon | 352097 | or similar |
| 25 mL serological pipette, polystyrene, sterile, nonpyrogenic, DNase-/RNase-free, and Human DNA-free | Corning | 4489 | or similar |
| 250 mL polypropylene conical tybe | Corning | 430776 | or similar |
| 293AAV cell line | Cell Biolabs | AAV-100 | |
| 2-B-mercapto-ethanol, 55mM (1000x) | Gibco | 21985-023 | |
| 48-well tissue culture plate | Corning | 3548 | or similar |
| 5 mL serological pipette, polystyrene, sterile, nonpyrogenic, DNase-/RNase-free, and Human DNA-free | Corning | 4487 | or similar |
| 5 mL syringes with Luer-Lok Tip | BD | 309646 | or similar |
| 50 mL polypropylene conical tybe | Falcon | 352070 | or similar |
| 50 mL serological pipette, polystyrene, sterile, nonpyrogenic, DNase-/RNase-free, and Human DNA-free | Corning | 4490 | or similar |
| 6-well tissue culture plate | Falcon | 353046 | or similar |
| AAV-6 Packaging System (plasmids) | Cell Biolabs | VPK-406 | |
| AAV6 Reference Materials (full capsids) | Charles River | RS-AAV6-FL | |
| Accu-jet S Pipette Controller | Brand | 26350 | or similar pipette controller |
| Antibiotic/Antimycotic 100x | Gibco | 15260-062 | |
| anti-human CD14 AlexaFluor647 | Biolegend | 301812 | |
| anti-human CD14 biotin | BioLegend | 301826 | |
| anti-human CD16 AlexaFluor700 | BD Biosciences | 557920 | |
| anti-human CD16 biotin | BioLegend | 302004 | |
| anti-human CD20 PECy7 | Biolegend | 302312 | |
| anti-human CD3 biotin | Thermo Fisher | APS0309 | |
| anti-human CD3 PE | BD Biosciences | 552127 | |
| anti-human CD33 biotin | Miltenyi | 130-113-347 | |
| anti-human CD64 biotin | BioLegend | 305004 | |
| anti-human CD66 biotin | Miltenyi | 130-100-143 | |
| anti-human CD89 biotin | BioLegend | 354112 | |
| anti-human CD8a biotin | BioLegend | 301004 | |
| anti-human HLA-DR BV605 | Biolegend | 307640 | |
| anti-human Ig light chain lambda APC | Biolegend | 316610 | |
| anti-human IgM BV421 | Biolegend | 314516 | |
| anti-Human Kappa Light Chain FITC | Fisher Scientific | A18854 | |
| Autoclave | Steris | Amsco Lab 250 | or similar |
| Cell culture CO2 incubator | Fisher Scientific | 51026331 | or similar |
| Centrifugal Filter Unit (Amicon Ultra - 4, 100 kDa) | Millipore | UFC810024 | |
| Centrifuge 5920 R | Eppendorf | EP022628188 | or any other, coolable swinging bucket centrifuge with inserts for 96-well plates, 15, 50 and 250 mL size tubes |
| Chloroform | Fisher Scientific | C298SK-4 | |
| Cpg ODN | Invivogen | tlrl-2395 | |
| Dimethyl sulfoxide (DMSO) | Sigma-Aldrich | 34869-500ML | |
| DMEM, High Glucose | Gibco | 11965092 | |
| DNaseI (RNase-free) | New England Biolabs | M0303L | |
| DPBS, no calcium, no magnesium | Gibco | 14190144 | |
| Electroporation kit (Neon Transfection System 10 µL) | Fisher Scientific | MPK1096 | or other sizes or 100 uL transfection kit MPK 10096 |
| Electroporation system (Neon Transfection System) | Fisher Scientific | MPK5000 | |
| FCS | Hyclone | SH30910.03* | |
| Ficoll-PM400 (Ficoll-Paque PLUS) | Cytiva | 17144002 | or similar |
| Fume Hood | Fisher Scientific | FH3943810244 | or similar |
| Glutamine 200 mM | Gibco | 25030-081 | |
| Graduated Cylinder 1L | Corning | 3022-1L | or similar |
| Hemocytometer | Sigma-Aldrich | Z375357-1EA | or similar |
| HEPES 1M | Gibco | 15630-080 | |
| HEPES 1M | Gibco | 15630-080 | |
| Hot Plate Magnetic Stirrer | Fisher Scientific | SP88857200 | or similar |
| Human BAFF | Peprotech | 310-13 | |
| Human BD Fc Block | BD | 564220 | |
| Human IL-10 | Peprotech | 200-10 | |
| Human IL-2 | Peprotech | 200-02 | |
| Hydrochloric acid | Fisher Scientific | A144S-500 | |
| Hydrophilic Polyethersulfone Syringe Filters, (Supor membrane), Sterile - 0.2 µm, 25 mm | Pall | 4612 | |
| Insulin-Transferin-Selenium, 100x | Gibco | 41400-045 | |
| ITR primer forward: GGAACCCCTAGTGATGGAGTT | Integrated DNA Technologies | custom | |
| ITR primer reverse: CGGCCTCAGTGAGCGA | Integrated DNA Technologies | custom | |
| Laminar flow biosafety cabinet | The Baker Company | SG403A | or similar |
| Large magnetic depletion (LD) Column | Miltenyi Biotec | 130-042-901 | |
| Magentic seperator (MidiMACS separator and multistand) | Miltenyi Biotec | 130-090-329 | |
| Magnetic stir bar | Fisher Scientific | 14-512-127 | or similar |
| Magnetic streptavidin beads (Streptavidin MicroBeads) | Miltenyi Biotec | 130-048-101 | |
| Maxiprep kit | Machery-Nagel | 740414.5 | or similar |
| Media Bottles 2L with cap | Cole-Parmer | UX-34514-26 | or similar |
| MegaCD40L | Enzo | ALX-522-110-C010 | |
| MicroAmp Optical 384-well Reaction Plate | Fisher Scientific | 4309849 | |
| MicroAmp Optical Adhesive Film | Fisher Scientific | 4311971 | |
| Microcentrifuge 5424 R | Eppendorf | 5404000014 | or any other table top centrifuge for 1.5 mL tubes |
| Microwave oven | Panasonic | NN-SD987SA | or similar |
| Nikon TMS Inverted Phase Contrast Microscope | Nikon | TMS | or any other Inverted phase-contrast microscope for cell culture |
| Non-essential amino acids, 100x | Gibco | 11140-050 | |
| Nuclease-free Duplex buffer | Integrated DNA Technologies | 11-01-03-01 | |
| Nuclease-free Water | Qiagen | 129115 | |
| pH meter | Mettler Toledo | 30019028 | or similar |
| Pipetman Classic Starter Kit, 4 Pipette Kit, P2, P20, P200, P1000 and tips | Gilson | F167380 | or similar set of pipettes and tips |
| Pluronic F-68 10 % | Gibco | 24040-032 | |
| Polyethylene Glycol 8000 | Fisher Scientific | BP233-1 | |
| Polyethylenimine, Linear, MW 25000, Transfection Grade (PEI 25K | Polysciences | 23966-100 | |
| Precision Balance | Mettler Toledo | ME4001TE | or similar |
| Pre-Separation Filters (30 µm) | Miltenyi Biotec | 130-041-407 | |
| Pyrex glass beaker 2 L | Cole-Parmer | UX-34502-13 | or similar |
| Pyrex glass beaker 250 mL | Millipore Sigma | CLS1000250 | or similar |
| qPCR Instrument | Fisher Scientific | 4485691 | or similar |
| RC1 antigen randomly biotinylated | Bjorkman lab, CalTech | in house | |
| RPMI-1640 | Gibco | 11875-093 | |
| S.p. Cas9 Nuclease | Integrated DNA Technologies | 1081059 | |
| Scientific 1203 Water Bath | VWR | 24118 | or any water bath set to 37 °C |
| Sodium chloride | Sigma-Aldrich | S7653-5KG | |
| Sodium hydroxide | Sigma-Aldrich | S8045-500G | |
| Sodium Pyruvate 100 mM | Gibco | 11360-070 | |
| Sterile Disposable Filter Units with PES Membranes | Thermo Scientific Nalgene | 567-0020 | |
| Streptavidin-PE | BD Biosciences | 554061 | |
| SYBR Green Master Mix | Fisher Scientific | A25742 | |
| Tetracycline-enabled, self-silencing adenoviral vector RepCap6 | Oxgene | TESSA-RepCap6 | |
| Trypan Blue Solution, 0.4% | Gibco | 15250061 | |
| Trypsin-EDTA (0.05%), phenol red | Gibco | 25300054 | |
| Water Purification System | Millipore Sigma | ZEQ7000TR | or similar |
| Zombie-NIR | Biolegend | 423106 |