Method Article

Generation of Brown Fat-Specific Knockout Mice Using a Combined Cre-LoxP, CRISPR-Cas9, and Adeno-Associated Virus Single-Guide RNA System

DOI:

10.3791/65083

March 24th, 2023

In This Article

Summary

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

In this protocol, we describe the technical procedures to generate brown adipose tissue (BAT)-specific knockout mice leveraging a combined Cre-LoxP, CRISPR-Cas9, and adeno-associated virus (AAV) single-guide RNA (sgRNA) system. The described steps include the design of the sgRNAs, the preparation of the AAV-sgRNA particles, and the microinjection of AAV into the BAT lobes.

Abstract

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Brown adipose tissue (BAT) is an adipose depot specialized in energy dissipation that can also serve as an endocrine organ via the secretion of bioactive molecules. The creation of BAT-specific knockout mice is one of the most popular approaches for understanding the contribution of a gene of interest to BAT-mediated energy regulation. The conventional gene targeting strategy utilizing the Cre-LoxP system has been the principal approach to generate tissue-specific knockout mice. However, this approach is time-consuming and tedious. Here, we describe a protocol for the rapid and efficient knockout of a gene of interest in BAT using a combined Cre-LoxP, CRISPR-Cas9, and adeno-associated virus (AAV) single-guide RNA (sgRNA) system. The interscapular BAT is located in the deep layer between the muscles. Thus, the BAT must be exposed in order to inject the AAV precisely and directly into the BAT within the visual field. Appropriate surgical handling is crucial to prevent damage to the sympathetic nerves and vessels, such as the Sultzer's vein that connects to the BAT. To minimize tissue damage, there is a critical need to understand the three-dimensional anatomical location of the BAT and the surgical skills required in the technical steps. This protocol highlights the key technical procedures, including the design of sgRNAs targeting the gene of interest, the preparation of AAV-sgRNA particles, and the surgery for the direct microinjection of AAV into both BAT lobes for generating BAT-specific knockout mice, which can be broadly applied to study the biological functions of genes in BAT.

Introduction

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Obesity is increasing at a significant rate worldwide, leading to a broad spectrum of metabolic diseases1,2,3. The adipose tissue is key to these pathologies. The two functionally distinct types of adipose tissue that exist are white adipose tissue (WAT), which stores excess calories, and brown adipose tissue (BAT) and its related beige/brite fat, which dissipate energy for thermogenesis. While BAT has been recognized for its energy-dissipating function, it also has endocrine functions via the production of bioactive molecules that regulate metabolism in distal organs4,5. Numerous studies in rodents have demonstrated that increasing the amount or activity of brown or beige fat leads to increased energy expenditure and improved insulin sensitivity. In humans, people with detectable BAT have a significantly lower prevalence of cardiometabolic diseases6. Thus, BAT holds excellent therapeutic potential for obesity-related metabolic sequelae7,8,9.

To investigate the physiology and pathophysiology of BAT development and function and to elucidate the molecular mechanisms involved in these processes, the BAT-specific transgenic mouse model is a method of choice10. The Cre-LoxP recombination system is the most commonly used means to produce conditional knockout mice by editing the mouse genome. This system has enabled the modification (overexpression or knockout) of genes of interest in a tissue/cell-specific manner11. It can also be utilized to label a specific cell type by expressing a selective fluorescent reporter gene.

Recently, the Cre-LoxP system approach has been further developed by combining the CRISPR-Cas9 technology and the adeno-associated virus (AAV) single-guide RNA (sgRNA) system12. The CRISPR-Cas9 system is a specific and efficient gene-editing tool to modify, regulate, or target precise regions of the genome13. CRISPR-Cas9-based genome editing allows for rapid genetic manipulation of genomic loci because it does not require homologous recombination with a gene-targeting vector. Combined Cre-LoxP, CRISPR-Cas9, and AAV-sgRNA techniques enable researchers to understand gene functions more precisely by allowing the investigation of the role of genes of interest at desired times in tissues/cells. Additionally, these combined techniques reduce the time and effort required to generate transgenic mice and allow the temporal control of CRISPR-Cas9 activity for inducible genome editing in mice if an inducible Cre line is used14.

AAV vectors are safe and effective in vivo gene delivery systems. However, AAVs targeting adipose tissue have lagged behind applications in other tissues, such as the brain, heart, liver, and muscle15. Due to the relatively low transduction efficiency and tropism with naturally occurring serotype vectors, AAV-guided gene delivery to adipose tissue is still challenging15. Over the last 5 years, we and others have successfully established effective and minimally invasive ways to deliver AAV-guided genes into adipose tissue and created mouse models that allow us to gain an understanding of the genes involved in the regulation of BAT function16,17,18,19. For example, by using AAV8 to deliver sgRNA targeting Alox12, which encodes 12-lipoxygenase (12-LOX), into the BAT of the Ucp1-Cre/Cas9 mice, we have discovered that activated BAT produces 12-LOX metabolites, namely 12-hydroxy-eicosapentaenoic acid (12-HEPE) and 13R, 14S-dihydroxy docosahexaenoic acid (maresin 2), to regulate glucose metabolism and resolve obesity-associated inflammation, respectively16,17. Here, we provide a step-by-step protocol on the technical procedures, particularly the surgery for the direct microinjection of AAV-sgRNA into the BAT lobes, to generate BAT-specific knockout mice using the combined Cre-LoxP, CRISPR-Cas9, and AAV-sgRNA system.

Access restricted. Please log in or start a trial to view this content.

Protocol

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

All the animal experiments and care procedures were approved by the Institutional Animal Care and Use Committee at Joslin Diabetes Center.

1. Screening effective sgRNAs in cultured cells

NOTE: To make the assay cost-effective, before packaging the sgRNAs into AAV particles, we recommend testing different sgRNAs in cultured cells via a lentivirus-based system for Cas9/sgRNA expression (Figure 1) and selecting the sgRNAs that give the highest knockdown efficiency for in vivo experiments.

  1. CRISPR-Cas9 sgRNA design
    1. Design sgRNAs using online tools, such as the Broad sgRNA design tool (https://portals.broadinstitute.org/gppx/crispick/public)20,21, the CRISPOR online tool (http://crispor.tefor.net/)22, and other available tools.
    2. Enter gene names or DNA target sequences in the gene name box, and select NGG as the protospacer adjacent motif (PAM) for SpCas9 to generate potential sgRNA sequences.
    3. Select the sgRNAs with high predicted on-target efficiency and low off-target activity. For instance, sgRNAs with a specificity score of at least 50 on the CRISPOR output are recommended for use. Among the specific sgRNAs that pass the filter, pick the ones with high efficiency scores23.
      NOTE: In general, three or four sgRNAs are picked to ensure the identification of effective sgRNAs.
  2. Construction of the CRISPR-Cas9 sgRNA plasmid
    1. Synthesize sgRNA oligo pairs encoding 20 nucleotide (nt) targeted sequences with overhangs (both 5' and 3') from the BsmBI restriction site (Table 1) through a DNA synthesis platform.
    2. Ligate annealed oligo pairs with BsmBI-linearized lentiCRISPR v2 vector.
    3. Transform the ligation product into the Stbl3 E. coli strain, and confirm the sgRNA insertions by Sanger DNA sequencing using U6 forward primer.
      NOTE: See the detailed cloning procedure in Addgene's protocol entitled LentiCRISPRv2 and lentiGuide-Puro: lentiviral CRISPR/Cas9 and single guide RNA24.
  3. Producing lentiviral particles
    1. Approximately 24 h before transfection, plate 7 x 105 HEK-293 cells in 4 mL of complete growth medium in a 6 cm tissue culture plate.
    2. Add 15 µL of LT1 transfection reagent to 250 µL of serum-free medium, and incubate at room temperature for 5 min.
    3. Prepare a transfection cocktail for each sgRNA as per Table 2 in 250 µL of serum-free medium. Mix the transfection reagent prepared in step 1.3.2 with the plasmid cocktail, and incubate for 20-30 min at room temperature.
    4. Replace the complete growth medium with 3.5 mL of fresh growth medium for HEK-293 cells, and then add the DNA transfection reagent mixture dropwise to the HEK-293 cells cultured in the 3.5 mL of fresh growth medium.
    5. After 12-15 h of transfection, change the medium to remove the transfection reagent, and replace it with 4 mL of fresh growth medium.
    6. After 24 h of incubation, collect the cell culture medium that contains lentiviral particles, and filter the medium through a 0.45 µm filter to remove any HEK-293 cells. The viruses may be stored at 4 °C for a few days. For long-term storage, the viruses should be frozen at −80 °C.
      NOTE: Follow biosafety guidelines when preparing lentiviral particles, and work in an environment (e.g., BL2+) suitable for handling lentivirus. See the detailed lentivirus preparation procedure in Addgene's protocol entitled pLKO.1 - TRC Cloning Vector (https://www.addgene.org/protocols/plko/#G).
  4. Infection of brown preadipocytes and determination of sgRNA-mediated knockdown
    1. Plate 1 x 106 mouse immortalized brown preadipocytes in 1 mL of fresh medium containing 8 µg/mL polybrene per well in a 6-well plate.
      NOTE: In this study, the immortalized brown preadipocytes were generated using SV40 T antigen25. Brown preadipocytes are cultured in high-glucose DMEM with 10% FBS.
    2. Add 1 mL of lentiviral particle solution from step 1.3 to infect the cells. Maintain one uninfected well of cells in parallel to serve as the antibiotic selection control.
    3. Change to fresh medium 24 h after infection. Add the corresponding antibiotics (e.g., puromycin with a final concentration of 1 µg/mL) to the medium to kill the uninfected cells and select the infected ones. Change to fresh medium containing the selected antibiotic every other day until all the uninfected control cells are dead.
    4. Collect protein from the virus-infected cells, and determine the knockdown efficiency of the sgRNAs by western blot analysis. Follow the detailed western blotting procedure in Eslami and Lujan26. Due to the varying turnover rate among proteins, test multiple time points (e.g., from day 6 to day 12 after virus infection) to observe the loss of protein signal.
      NOTE: If an antibody that recognizes the protein encoded by the gene of interest is not available, Sanger sequencing can alternatively be utilized to determine the genome editing efficiency of each sgRNA. Briefly, amplify the genomic DNA using primers flanking the sgRNA-targeted region to generate PCR amplicons of ~700 bp in length. The projected break site should preferably be ~200 bp downstream from the sequencing start site. Then, subject the PCR product to Sanger sequencing. Analyze the sequencing results using the online tools, such as Tracking of Indels by DEcomposition (TIDE), to determine the frequency of small indels generated by each sgRNA in a pool of cells27.

2. Construction of the AAV-sgRNA plasmid

NOTE: In this step, the effective sgRNAs identified from the above screen are cloned into the pAAV-U6-BbsI-gRNA-CB-EmGFP vector28 (Figure 2). In the meantime, a non-targeting sgRNA (e.g., TCTGATAGCGTAGGAGTGAT29) that does not recognize any sequence in the mouse genome is also cloned into the same vector to serve as a non-edited control.

  1. Linearize pAAV-U6-BbsI-gRNA-CB-EmGFP backbone using BbsI, which generates identical overhangs with synthesized sgRNA oligos.
  2. Ligate the annealed oligo pairs with linearized pAAV vector, and confirm the sgRNA insertions as described in step 1.2.
    ​NOTE: The cloning procedure for lentiCRISPRv2-sgRNA is also applied for the AAV-sgRNA plasmid construction.

3. AAV packaging

  1. Package the AAV vectors generated in section 2 into AAV serotype 8. Prepare high-titer AAV according to a previous protocol30, or request an AAV packaging service from viral cores or commercial services. Dilute the virus titer to 1 x 1013 genome copies/mL.
    ​NOTE: The modified AAV2 genome expressing an sgRNA is packaged into AAV serotype 8. This serotype was chosen due to its high efficiency for adipose tissue18,31. To prevent immune response induced by contaminants, such as cell debris and small amounts of medium components, ultra-purified AAV is required for in vivo injection. Ultra-purification can be achieved by iodixanol gradients and ultracentrifugation30.

4. Preparation of Ucp1 Cre/Cas9 mice

  1. Purchase the Ucp1-Cre mouse strain (see Table of Materials) that expresses Cre recombinase under the control of the Ucp1 promoter. Purchase homozygous Rosa26-floxed STOP-Cas9 knock-in mice32 (see Table of Materials), in which the expression of Cas9 is regulated in a Cre recombinase-dependent manner.
  2. Cross these strains to generate Ucp1-Cre/Cas9 mice, as previously described16,17. Keep all the mice in a temperature- and humidity-controlled room (23 °C, 30% humidity) on a 12 h light-dark cycle (lights on at 6:30 am; lights off at 6:30 pm) with free access to chow diet and water.
  3. Treat the resulting Ucp1-Cre/Cas9 mice with AAVs carrying either control sgRNA or sgRNA targeting the gene of interest through the method described below. In this study, 12-15 week old male Ucp1-Cre/Cas9 mice weighing approximately 30 g were used.

5. Surgery for AAV injection into the BAT in mice

  1. Anesthetize the mice with continuous inhalation of 2.5% isoflurane for induction and maintenance.
  2. Lubricate both eyes to prevent drying. Then, give analgesics (banamine, 2.5 mg/kg body weight [BW], subcutaneous injection, see Table of Materials) to the mice to minimize and prevent postoperative pain and distress.
  3. Shave the mouse fur on the interscapular area using a shaver and sterilize the surgical area with at least three alternating rounds of an iodine-based or chlorhexidine-based scrub followed by 70% ethanol. Then, apply sterile surgical drapes around the incision site.
  4. Incise the skin between the scapulae using a scalpel (Figure 3A-B), and then peel the shaved skin off to expose the fat tissues on the neck using surgical scissors (Figure 3C-D). The size of the incision is dependent on the body size, but generally, the incision should be approximately 2 cm to expose the fat tissues on the interscapular region.
  5. Cut the fat tissues on the border between the distal region of the fat tissues and muscles using a single incision (Figure 3E-F). The size of the incision should be approximately 1 cm to just open the entrance for the insertion of the surgical scissors for blunt peeling of the fat tissues.
  6. Using the dominant hand, peel the fat tissues off bluntly and vertically with surgical scissors to expose the BAT while pinching the fat tissues, including the BAT, with the non-dominant hand (Figure 3G). Use the Sultzer's vein as a landmark to indicate the precise BAT location.
    NOTE: The BAT in Figure 3H was completely exposed for the purpose of a picture demonstration. Excess dissection may cause damage to the nerves of the surrounding BAT. Incorrect direction of the scissors may hurt the surrounding muscles and the Sultzer's vein draining the BAT and could lead to excess bleeding.
  7. For each mouse, inject 40 µL of AAV slowly into both BAT lobes (20 µL per one lobe of the BAT) using a sharp needle (32 G, see Table of Materials) connected to a Hamilton syringe (100 µL, see Table of Materials; Figure 3I). Check for successful injection as indicated by no leakages from the injected site during AAV administration.
    NOTE: The BAT in Figure 3I was completely exposed for the purpose of a picture demonstration. The volume of AAV solution to be administered into a BAT lobe is determined by the size of the BAT of the recipient mouse. We have determined that 20 µL of AAV solution is appropriate for one BAT lobe weighing approximately 0.05 g in a regular C57BL6/J mouse weighing 30 g. If necessary, the viral solution may need to be concentrated to achieve the desired volume.
  8. Confirm no bleeding from the injected BAT or surrounding tissues. Press gauze soaked with hydrogen peroxide solution (see Table of Materials) onto a bleeding site for hemostasis.
  9. Place the exposed fat tissues back to their normal position. Stitch up the edge of the fat tissues and muscle using a 5-0 absorbable monofilament thread (Figure 3J). Suture the open skin with 5-0 coated vicryl undyed braided threads (Figure 3K-L).
    NOTE: Figure 4 describes the steps for stitching the peeled fat tissues and muscles.
  10. Maintain the animals on a heating pad following the surgery until complete recovery. Provide the animals with access to food, water, and ample bedding for nesting. Monitor them regularly for any signs of distress or illness for 7 days of recovery prior to the beginning of the experiment.
  11. Confirm the efficiency of the targeted gene deletion by western blot analysis in the BAT dissected from mice, as in Sugimoto et al.16.

Access restricted. Please log in or start a trial to view this content.

Results

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Throughout the above procedures, the precise delivery of AAV-sgRNA to the BAT is crucial to the success of the protocol. To maximize the effect of AAV-sgRNA and minimize the tissue damage during surgery, it is essential to understand the three-dimensional (3D) anatomical location of the BAT. As shown in Figure 3E, it is hard to identify the precise location of the BAT without exposing the tissue. However, excess BAT exposure may damage the tissue (Figure 3

Access restricted. Please log in or start a trial to view this content.

Discussion

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The existing published methods for AAV-mediated gene delivery to the interscapular BAT do not contain detailed pictures and videos describing the surgical techniques and approach for direct AAV injection into the BAT. In most of the published methods33,34, the AAV is injected into the fat tissues surrounding the interscapular BAT instead of the BAT itself. Hence, there are several key steps in this protocol that determine the success of the study. These include t...

Access restricted. Please log in or start a trial to view this content.

Disclosures

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The authors have nothing to disclose.

Acknowledgements

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

This work was supported in part by U.S. National Institutes of Health (NIH) grants R01DK122808, R01DK102898, and R01DK132469 (to Y.-H.T.), as well as P30DK036836 (to Joslin Diabetes Center's Diabetes Research Center). T. T. was supported by the SUNSTAR Research Fellowship (Hiroo Kaneda Scholarship, Sunstar Foundation, Japan) and the American Heart Association grant 903968. Y. Z. was supported by the Charles A. King Trust Fellowship. We thank Sean D. Kodani for kindly proofreading the manuscript.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
Chemicals, Peptides and Recombinant Proteins
OPTI-MEM serum-free mediumInvitrogen31985
Polybrene Infection / Transfection ReagentSigmaTR-1003-G
TransIT-LT1 Transfection ReagentMirusMIR 2300
Recombinant DNA
lentiCRISPR v2 vector Addgene52961
pAAV-U6-BbsI-gRNA-CB-EmGFPAddgene89060
pMD2.G envelope plasmidAddgene12259
psPAX2 packaging plasmidAddgene12260
Experimental Models: Cell Lines
HEK-293 cellsATCCCRL-1573
WT-1 cellsDeveloped in Tseng labPMID: 14966273
Experimental Models: Organisms/Strains
Cas9 knockin miceJackson Laboratories24857
Ucp1-CRE miceJackson Laboratories24670
Others
BanaminePatterson07-859-1323
Hamilton syringeHamiltonModel 710 RN Syringe
Hydrogen peroxide solutionFisher ScientificH325-500
NeedleHamilton32 gauge, small hub RN needle, needle point style 2
Suture 5-0 Unify PCL25 P-3 Undyed 18 inch Monofilament 12/BxHenry Schein1273504
Suture 5-0 Unify Silk P-3 Black 18 inch 12/BxHenry Schein1294522

References

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,
  1. Kopelman, P. G. Obesity as a medical problem. Nature. 404 (6778), 635-643 (2000).
  2. Finkelstein, E. A., et al. Obesity and severe obesity forecasts through 2030. American Journal of Preventive Medicine. 42 (6), 563-570 (2012).
  3. Craft, S. Insulin resistance and Alzheimer's disease pathogenesis: Potential mechanisms and implications for treatment. Current Alzheimer Research. 4 (2), 147-152 (2007).
  4. Villarroya, F., Cereijo, R., Villarroya, J., Giralt, M. Brown adipose tissue as a secretory organ. Nature Reviews Endocrinology. 13 (1), 26-35 (2017).
  5. Scheele, C., Wolfrum, C. Brown adipose crosstalk in tissue plasticity and human metabolism. Endocrine Reviews. 41 (1), 53-65 (2020).
  6. Becher, T., et al. Brown adipose tissue is associated with cardiometabolic health. Nature Medicine. 27 (1), 58-65 (2021).
  7. Kajimura, S., Spiegelman, B. M., Seale, P. Brown and beige fat: Physiological roles beyond heat generation. Cell Metabolism. 22 (4), 546-559 (2015).
  8. Scheja, L., Heeren, J. The endocrine function of adipose tissues in health and cardiometabolic disease. Nature Reviews Endocrinology. 15 (9), 507-524 (2019).
  9. Darcy, J., Tseng, Y. H. ComBATing aging-does increased brown adipose tissue activity confer longevity. Geroscience. 41 (3), 285-296 (2019).
  10. da Silva Xavier, G., Hodson, D. J. Mouse models of peripheral metabolic disease. Best Practice & Research Clinical Endocrinology & Metabolism. 32 (3), 299-315 (2018).
  11. Kim, H., Kim, M., Im, S. K., Fang, S. Mouse Cre-LoxP system: General principles to determine tissue-specific roles of target genes. Laboratory Animal Research. 34 (4), 147-159 (2018).
  12. Wang, D., Zhang, F., Gao, G. CRISPR-based therapeutic genome editing: Strategies and in vivo delivery by AAV vectors. Cell. 181 (1), 136-150 (2020).
  13. Sander, J. D., Joung, J. K. CRISPR-Cas systems for editing, regulating and targeting genomes. Nature Biotechnology. 32 (4), 347-355 (2014).
  14. Dow, L. E., et al. Inducible in vivo genome editing with CRISPR-Cas9. Nature Biotechnology. 33 (4), 390-394 (2015).
  15. Bates, R., Huang, W., Cao, L. Adipose tissue: An emerging target for adeno-associated viral vectors. Molecular Therapy. Methods & Clinical Development. 19, 236-249 (2020).
  16. Sugimoto, S., et al. Brown adipose tissue-derived MaR2 contributes to cold-induced resolution of inflammation. Nature Metabolism. 4 (6), 775-790 (2022).
  17. Leiria, L. O., et al. 12-lipoxygenase regulates cold adaptation and glucose metabolism by producing the omega-3 lipid 12-HEPE from brown fat. Cell Metabolism. 30 (4), 768-783 (2019).
  18. Shamsi, F., et al. FGF6 and FGF9 regulate UCP1 expression independent of brown adipogenesis. Nature Communications. 11, 1421(2020).
  19. Romanelli, S. M., et al. BAd-CRISPR: Inducible gene knockout in interscapular brown adipose tissue of adult mice. Journal of Biological Chemistry. 297 (6), 101402(2021).
  20. Doench, J. G., et al. Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nature Biotechnology. 34 (2), 184-191 (2016).
  21. Sanson, K. R., et al. Optimized libraries for CRISPR-Cas9 genetic screens with multiple modalities. Nature Communications. 9, 5416(2018).
  22. Concordet, J. P., Haeussler, M. CRISPOR: Intuitive guide selection for CRISPR/Cas9 genome editing experiments and screens. Nucleic Acids Research. 46, 242-245 (2018).
  23. Haeussler, M., et al. Evaluation of off-target and on-target scoring algorithms and integration into the guide RNA selection tool CRISPOR. Genome Biology. 17 (1), 148(2016).
  24. Sanjana, N. E., Shalem, O., Zhang, F. Improved vectors and genome-wide libraries for CRISPR screening. Nature Methods. 11 (8), 783-784 (2014).
  25. Tseng, Y. H., Kriauciunas, K. M., Kokkotou, E., Kahn, C. R. Differential roles of insulin receptor substrates in brown adipocyte differentiation. Molecular and Cellular Biology. 24 (5), 1918-1929 (2004).
  26. Eslami, A., Lujan, J. Western blotting: Sample preparation to detection. Journal of Visualized Experiments. (44), e2359(2010).
  27. Brinkman, E. K., Chen, T., Amendola, M., van Steensel, B. Easy quantitative assessment of genome editing by sequence trace decomposition. Nucleic Acids Research. 42 (22), 168(2014).
  28. Jarrett, K. E., et al. Somatic genome editing with CRISPR/Cas9 generates and corrects a metabolic disease. Scientific Reports. 7, 44624(2017).
  29. Zhang, Y., et al. Optimized RNA-targeting CRISPR/Cas13d technology outperforms shRNA in identifying functional circRNAs. Genome Biology. 22 (1), 41(2021).
  30. Fripont, S., Marneffe, C., Marino, M., Rincon, M. Y., Holt, M. G. Production, purification, and quality control for adeno-associated virus-based vectors. Journal of Visualized Experiments. (143), e58960(2019).
  31. Jimenez, V., et al. In vivo adeno-associated viral vector-mediated genetic engineering of white and brown adipose tissue in adult mice. Diabetes. 62 (12), 4012-4022 (2013).
  32. Platt, R. J., et al. CRISPR-Cas9 knockin mice for genome editing and cancer modeling. Cell. 159 (2), 440-455 (2014).
  33. Huang, W., Queen, N. J., Cao, L. rAAV-mediated gene delivery to adipose tissue. Methods in Molecular Biology. 1950, 389-405 (2019).
  34. Xue, K., Wu, D., Qiu, Y. Specific and efficient gene knockout and overexpression in mouse interscapular brown adipocytes in vivo. STAR Protocols. 3 (4), 101895(2022).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Tags

Brown Fat KnockoutCre LoxP SystemCRISPR Cas9 EditingBrown Adipose TissueTissue Specific KnockoutAAV MicroinjectionGene TargetingEnergy Metabolism

Related Articles